Use and method of wheat TaMICU1-6A gene

Abstract

Use and method of wheat TaMICU1-6A gene. The present application provides the use of the wheat TaMICU1-6A gene or the protein encoded thereby in increasing the tiller number of crops and / or increasing the yield of crops, and a method for increasing the tiller number of crops and / or increasing the yield of crops, the method comprising: overexpressing the wheat TaMICU1-6A gene in crops. The present application discovers that the TaMICU1-6A gene can be used for rice breeding. The tiller number of the TaMICU1-6A gene overexpressing plants is significantly increased, which helps to improve the production efficiency and yield of rice. Through genetic engineering, the present application can more precisely regulate the expression of the TaMICU1-6A gene in rice, which greatly promotes the improvement of rice breeding efficiency, shortens the breeding cycle, and increases the success rate of breeding new varieties.

Description

Technical Field

[0001] This article generally relates to the field of genetic engineering technology, and particularly to the use of the wheat TaMICU1-6A gene or the protein encoded thereby in increasing the tiller number of crops and / or increasing the yield of crops. Background Art

[0002] Wheat (Triticum aestivum L.) is an important food crop, and there is a need to increase yields in production and life to meet the demand for food production. Tiller refers to the branches of gramineous plants. For gramineous plants, the number of spikes per plant, the number of grains per spike, and the grain weight are the determinants of yield. The tiller number of a single plant determines the number of spikes per plant and is one of the important agronomic traits in food production. The number of tillers is directly related to the yield of crops, and the increase in effective tillers can increase the yield of crops. At present, the growth of the population and the development of society require us to cultivate high-yield crops, and high-yield crops (such as wheat, corn, and rice, etc.) mainly rely on increasing the yield per plant. Therefore, it is very important to identify more genes related to the tiller number. Summary of the Invention

[0003] Based on this, the present application provides a new use of the wheat mitochondrial calcium uptake protein (TaMICU1-6A) gene or the protein encoded thereby. Through research, it is found in the present application that in rice, the overexpression of the wheat TaMICU1-6A gene can increase the tiller number of crops, and thus increase the yield of crops.

[0004] On the one hand, the present application provides the use of the wheat TaMICU1-6A gene or the protein encoded thereby in increasing the tiller number of crops and / or increasing the yield of crops.

[0005] On the other hand, the present application also provides a method for increasing the tiller number of crops and / or increasing the yield of crops, wherein the method includes: overexpressing the wheat TaMICU1-6A gene in crops.

[0006] On the other hand, the present application also provides the use of the transgenic crops obtained by the method described herein in crop breeding.

[0007] Through genetic engineering technology, the present application realizes the overexpression of the TaMICU1-6A gene in rice, and conducts targeted editing and regulation of the gene. Comparative phenotypic analysis is carried out on the overexpressing plants and the wild-type rice Nipponbare. The traits of these plants are observed and measured under the same environmental conditions, and the differences between them are compared. It is observed that the tiller number of the overexpressing plants is significantly increased. This method of comparative phenotypic analysis more directly evaluates the influence of the TaMICU1-6A gene on the traits of rice, thereby determining the importance of the TaMICU1-6A gene in rice breeding.

[0008] Due to the role of the TaMICU1-6A gene in rice breeding, this application may also have application potential in the breeding of other crops. Other crops such as wheat, corn, soybeans, sorghum, etc. may also benefit from regulating growth and development to improve their tillering traits and stress resistance.

[0009] Other features and advantages of this application will be described in the subsequent specification, and partly will become apparent from the specification, or will be understood by implementing this application. Other advantages of this application can be achieved and obtained through the solutions described in the specification and the drawings. Brief Description of the Drawings

[0010] The drawings are used to provide an understanding of the technical solutions of this application, and constitute a part of the specification. Together with the embodiments of this application, they are used to explain the technical solutions of this application, and do not constitute a limitation to the technical solutions of this application.

[0011] Figure 1 Shows the PCR identification results of the TaMICU1-6A gene overexpression plants of this application.

[0012] Figure 2 Shows that the tillering of the TaMICU1-6A gene overexpression plants of this application is significantly increased compared with the wild type.

[0013] Figure 3 Is a statistical result graph of the tiller numbers of the TaMICU1-6A gene overexpression plants and wild type plants of this application.

[0014] Figure 4 Is a result graph of the tissue-specific analysis of the TaMICU1-6A gene expression in the TaMICU1-6A gene overexpression plants of this application. Among them, A is the root at the seedling stage; B is the stem at the seedling stage; C is the leaf at the seedling stage; D is the root at the tillering stage; E is the stem at the tillering stage; F is the leaf at the tillering stage; G is the tiller bud; H is the anther at the heading stage.

[0015] Figure 5 Is a result graph of the expression levels of tiller-related genes in the TaMICU1-6A gene overexpression plants of this application. Detailed Description of the Invention

[0016] Unless otherwise specified, the technical and scientific terms used herein have the same meanings as those commonly understood by one of ordinary skill in the art to which this application pertains. When a quantity, concentration, or other value or parameter is expressed in the form of a range, a preferred range, or a preferred upper numerical limit and a preferred lower numerical limit, it should be understood as specifically disclosing any range obtained by combining any pair of upper range limits or preferred numerical values with any lower range limits or preferred numerical values, regardless of whether such ranges are specifically disclosed. Unless otherwise specified, the numerical ranges listed herein are intended to include the endpoints of the range and all integers and fractions (decimals) within the range.

[0017] The terms “about” or “approximately” when used in conjunction with a numerical variable generally mean the value of the variable and all values of the variable within experimental error (e.g., within a 95% confidence interval for the mean) or within ±10% of the specified value, or a wider range.

[0018] The expression “comprising” or similar expressions synonymous therewith, such as “including,” “containing,” and “having,” are open-ended and do not exclude additional unrecited elements, steps, or components. The expression “consisting of” excludes any element, step, or component not specified. The expression “consisting essentially of” means that the scope is limited to the specified elements, steps, or components, plus optionally present elements, steps, or components that do not materially affect the basic and novel features of the claimed subject matter. It should be understood that the expression “comprising” encompasses the expressions “consisting essentially of” and “consisting of.”

[0019] The expression “at least one” or “one or more” means 1, 2, 3, 4, 5, 6, 7, 8, 9, or more.

[0020] In the process of cell signal transduction, calcium ions (Ca 2+ ) exist as important messengers. Many physiological processes will undergo corresponding changes due to the increase or decrease in the Ca 2+ concentration existing between cells, such as biotic and abiotic stresses, regulation of growth and development, and stomatal dynamics. The influx of Ca 2+ into mitochondria can serve as a calcium store for regulating intracellular calcium signal transduction, and the main pathway for mitochondrial Ca 2+ uptake is through the voltage-dependent anion-selective channel in the outer mitochondrial membrane and the mitochondrial calcium uniporter complex in the inner mitochondrial membrane. This complex includes the pore-forming subunit mitochondrial calcium uniporter MCU, which regulates Ca 2+ together with the Ca 2+uptake. MICU1 is a membrane protein with two EF-hand domains. The EF-hand domain is a key part of MICU1's ability to sense and regulate calcium signaling. MICU1 regulates Ca 2+ uptake based on the Ca 2+ concentration in the cytoplasm, closing MCU at low concentrations and opening MCU at high concentrations, enabling it to control cellular functions such as signal transduction, energy metabolism, cell death, tissue regeneration, etc. Our research found that it is also involved in the regulation of tillering. The increase in effective tillering can improve the yield of wheat, so regulating the tiller number of crops is of great significance for cultivating high-yield crops.

[0021] Traditional breeding methods for rice and wheat usually rely on natural variation or large-scale hybridization, which require years of breeding and screening to obtain ideal varieties. Moreover, traditional breeding methods are restricted by the genetic background of loci and complex genetic interactions, resulting in a slow and unpredictable improvement process for target traits. In contrast, this application utilizes genetic engineering techniques to directly achieve the improvement of target traits by regulating the expression level of the TaMICU1-6A gene, enabling precise regulation of the expression level of the TaMICU1-6A gene, thereby greatly improving the breeding efficiency and speed, and making the improvement of target traits more precisely controllable.

[0022] This application takes the wheat TaMICU1-6A gene as the research object, obtains the wheat TaMICU1-6A gene sequence from Ensemble Plant, designs specific primers, amplifies the target gene using the cDNA of Chinese Spring wheat as a template to clone the TaMICU1-6A gene, constructs an overexpression vector of the TaMICU1-6A gene, and uses the Agrobacterium-mediated genetic transformation method to introduce the overexpression vector into the normal rice variety Nipponbare to obtain overexpression plants of the TaMICU1-6A gene. When planted together with the wild-type Nipponbare and phenotypic data are counted, it can be obtained that the tiller number of the overexpression plants is significantly increased compared to the control wild-type Nipponbare. These results indicate that by increasing the expression of the TaMICU1-6A gene, the tiller number of rice plants can be promoted, thereby increasing the yield of rice. The method of this application can be applied to the breeding of rice and wheat varieties through techniques such as molecular breeding.

[0023] This application involves the study of the function and regulatory mechanism of the TaMICU1-6A gene. This is of great significance for in-depth research in basic fields such as the calcium ion signaling pathway and plant growth and development. This application can provide a specific research object and experimental model for research in the fields of molecular biology and genetics. Photosynthesis can affect plant antioxidant and stress resistance in plants. This application can provide a new perspective and strategy for plant stress resistance research.

[0024] In one aspect, the present application provides the use of the wheat TaMICU1-6A gene or the protein encoded thereby in increasing the tiller number of crops and / or increasing the yield of crops.

[0025] In some embodiments, the nucleic acid sequence of the wheat TaMICU1-6A gene has at least 80% sequence identity with the sequence shown in SEQ ID NO:1; or

[0026] The amino acid sequence of the protein encoded by the wheat TaMICU1-6A gene has at least 80% sequence identity with the sequence shown in SEQ ID NO:2.

[0027] In some embodiments, the nucleic acid sequence of the wheat TaMICU1-6A gene used herein has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the sequence shown in SEQ ID NO:1.

[0028] In some embodiments, the amino acid sequence of the protein encoded by the wheat TaMICU1-6A gene used herein has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the sequence shown in SEQ ID NO:2.

[0029] In some embodiments, the tiller number of crops is increased and / or the yield of crops is increased by overexpressing the wheat TaMICU1-6A gene in the crops.

[0030] In some embodiments, the crop is rice, wheat, corn or sorghum; preferably, the crop is rice.

[0031] In another aspect, the present application also provides a method for increasing the tiller number of crops and / or increasing the yield of crops, wherein the method comprises: overexpressing the wheat TaMICU1-6A gene in the crops.

[0032] In some embodiments, the wheat TaMICU1-6A gene overexpressed in the crops may have one or more nucleotide mutations on the basis of the wild-type wheat TaMICU1-6A gene. In some embodiments, the nucleic acid sequence of the wheat TaMICU1-6A gene has at least 80% sequence identity with the sequence shown in SEQ ID NO:1.

[0033] In some embodiments, the crop is rice, wheat, corn or sorghum; preferably, the crop is rice.

[0034] Any overexpression method available in the art can be used to overexpress the wheat TaMICU1-6A gene in the crop. In some embodiments, the method for overexpressing the wheat TaMICU1-6A gene in the crop includes:

[0035] 1) operably linking a strong promoter to the wheat TaMICU1-6A gene in the crop; and / or

[0036] 2) increasing the copy number of the wheat TaMICU1-6A gene on the chromosome of the crop.

[0037] In some embodiments, in the crop, the wheat TaMICU1-6A gene is linked to a constitutive promoter, and the expression of the wheat TaMICU1-6A gene is controlled by the constitutive promoter.

[0038] In some embodiments, the constitutive promoter is the 35S promoter or the ubiquitin promoter; preferably, the constitutive promoter is the ubiquitin promoter. Other types of constitutive promoters can also be used to control the expression of the wheat TaMICU1-6A gene in the crop.

[0039] On the other hand, the present application also provides the use of transgenic crops obtained by the methods described herein in crop breeding. In some embodiments, the breeding methods include transgenesis, hybridization, backcrossing, self-crossing or asexual reproduction.

[0040] In some embodiments, homologous genes of the wheat TaMICU1-6A gene can also improve some traits of crops (such as rice) through overexpression, RNAi (reducing the expression level) and gene editing.

[0041] The present application has found that the TaMICU1-6A gene can be used for rice breeding. The number of tillers of TaMICU1-6A gene overexpressing plants increases significantly, which helps to improve the production efficiency and yield of rice. Through genetic engineering, the present application can more precisely regulate the expression of the TaMICU1-6A gene in rice, which greatly promotes the improvement of rice breeding efficiency, shortens the breeding cycle, and increases the success rate of breeding new varieties. The technical solution of the present application is based on existing genetic engineering technologies, which have been widely applied in the field of plants. Therefore, the present application has the characteristics of high operability and wide application, and provides an effective method for plant genetic improvement and variety breeding.

[0042] This application describes multiple embodiments, but the description is exemplary rather than restrictive, and it will be apparent to those of ordinary skill in the art that there can be more embodiments and implementation solutions within the scope of the embodiments described in this application. Although many possible combinations of features are shown in the drawings and discussed in the detailed description, many other combinations of the disclosed features are also possible. Unless specifically restricted, any feature of any embodiment can be combined with any other feature in any other embodiment, or can replace any other feature in any other embodiment.

[0043] This application includes and contemplates combinations with features known to those of ordinary skill in the art. The embodiments and features disclosed in this application can also be combined with any conventional features to form unique inventive solutions defined by the claims. Any feature of any embodiment can also be combined with features from other inventive solutions to form another unique inventive solution defined by the claims. Therefore, it should be understood that any feature shown and / or discussed in this application can be implemented alone or in any suitable combination. Therefore, the embodiments are not subject to other limitations except those made in accordance with the appended claims and their equivalents. In addition, various modifications and changes can be made within the scope of the appended claims.

[0044] In addition, when describing representative embodiments, the specification may have presented the method and / or process as a specific sequence of steps. However, to the extent that the method or process does not depend on the specific order of the steps described herein, the method or process should not be limited to the specific order of steps described. As will be understood by those of ordinary skill in the art, other step orders are possible. Therefore, the specific order of steps set forth in the specification should not be construed as a limitation on the claims. In addition, the claims directed to the method and / or process should not be limited to performing their steps in the order written, and those skilled in the art can easily understand that these orders can vary and still remain within the spirit and scope of the embodiments of this application.

[0045] For the experimental methods without specific conditions noted in the following embodiments, they are generally determined according to national standards. The experimental materials without sources noted in the following embodiments are all commercially available raw materials. The equipment used in each step of the following embodiments is all conventional equipment. If there is no corresponding national standard, it is carried out according to general international standards, conventional conditions, or the conditions recommended by the manufacturer. Unless otherwise defined or explained, all professional and scientific terms used in this application have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the recorded content can be applied to the methods of this application.

[0046] Embodiment

[0047] The relevant materials used in the examples are as follows:

[0048] 1. Reagents and materials

[0049] 2xBioRun Magic PCR Mix (#RAA00), 2xBiorun Pfu PCR Mix (#RBC00), BioRunSeamlessCloning Kit (#RDA01), competent cells, Magic Ruler DNA marker (#RBA0O), BsmBI (#RCA01), BsaI[(#RCA02), BbsI (#RCA03). The above reagents and consumables are all from Biorun; EcorV (NEB), DNA gel extraction kit (Axygen), NaCl (Sigma), Yeast Extract NaCl (Sigma), Tryptone (Sigma)

[0050] The plant total RNA extraction kit was purchased from (Tiangen, Beijing, China); the reverse transcription kit was purchased from (Tiangen, Beijing, China); Biorun high-fidelity PCR Mix was purchased from (Wuhan Boyuan Biotechnology Co., Ltd.)

[0051] 2. Instruments

[0052] Gene amplifier, gel imaging analysis system, portable ultraviolet analyzer, universal electrophoresis power supply, constant temperature water bath, centrifuge, pipette (0.5 - 10uL), constant temperature shaking incubator, ultra-micro ultraviolet visible spectrophotometer, laminar flow hood

[0053] Example 1. Construction of TaMICU1-6A gene overexpression rice plants

[0054] (1) Extract the total RNA of wheat variety Chinese Spring using the plant total RNA extraction kit, perform quality detection by 1% agarose gel electrophoresis and detect its concentration with Genova Nano, and reverse transcribe it into cDNA using the reverse transcription kit. Obtain the wheat TaMICU1-6A gene sequence information from Ensemble Plant and design specific primers. The following primer pairs were designed:

[0055] TaMICU1-6A(+): ATTTGGAGAGAACACGGGGGACTTTGCAACATGGCCGCGCTGGCCCGCGCCTCGC (SEQ ID NO:3)

[0056] TaMICU1-6A(-): TACAGGACGTAACATCTGAAGCAGC (SEQ ID NO:4)

[0057] The TaMICU1-6A gene was obtained by PCR amplification of cDNA using Biorun high-fidelity PCR Mix. The nucleotide sequence obtained by sequencing is shown in SEQ ID NO:1, indicating that the amplified TaMICU1-6A gene sequence is correct.

[0058] (2) Based on the Type II restriction enzyme-based Golden Gate vector construction system, the obtained TaMICU1-6A gene sequence was ligated to the pBWA(V)HS vector to construct an overexpression vector of the TaMICU1-6A gene. Using the Agrobacterium-mediated genetic transformation method, the overexpression vector was introduced into the normal rice variety Nipponbare, and then transgenic rice seedlings were obtained through plant tissue culture.

[0059] The obtained transgenic seedlings were cultivated in nutrient solution. When the seedlings grew to about 15 cm, they were transplanted into the field. DNA was extracted from the leaves, and PCR amplification was performed using the primer pair TaMICU1-6A(+) / (-). The PCR products were verified by 1% agarose gel electrophoresis to determine positive plants, numbered, and the seeds were harvested and stored individually after maturity (T1 generation).

[0060] Example 2. Phenotypic analysis of transgenic plants

[0061] The harvested T1 generation seeds were germinated by hydroponics and transferred to rice nutrient solution for cultivation. When the seedlings grew to about 15 cm, they were planted individually in the field. After maturity, positive single plants were identified and the seeds were harvested (T2 generation). The T2 generation transgenic lines close to 3:1 were selected for continuous propagation until homozygous transgenic plants were identified in the T3 generation, that is, the TaMICU1-6A gene overexpression plants were obtained. PCR was performed to identify the positive transgenic plants, and the results are as Figure 1 shown.

[0062] The seeds of the overexpression plants and wild-type Nipponbare were germinated by hydroponics and transferred to nutrient solution for seedling cultivation until they reached 15 cm, and then transplanted into the field. It was found that under field cultivation, the TaMICU1-6A gene overexpression plants had significantly more tillers compared with the wild type. The phenotypic diagram is as Figure 2 shown, and the statistical results of the tiller numbers are as Figure 3 shown. From Figure 2 and Figure 3 it can be seen that under field cultivation, the three lines (L9, L15, L16) of the T3 generation of the TaMICU1-6A gene overexpression plants had significantly increased tiller numbers compared with the wild-type control Nipponbare plants.

[0063] Example 3. Analysis of gene expression in TaMICU1-6A gene overexpression rice plants

[0064] Expression analysis of TaMICU1-6A gene

[0065] The tissue specificity of TaMICU1-6A gene expression in TaMICU1-6A transgenic rice overexpression plants was analyzed by GUS staining. The analysis results are as Figure 4 shown. The results showed that the TaMICU1-6A gene was expressed in the seedling stage, tillering stage and heading stage of transgenic rice; and it was expressed in roots, stems, leaves, tiller buds and anthers; among them, the expression level was higher in the tillering stage, especially the staining degree of tiller buds was the deepest, indicating that its expression degree was very high in tiller buds.

[0066] Analysis of the expression levels of tiller-related genes in plants

[0067] The following specific primers (SEQ ID NOs: 5-18) were used:

[0068] Primer sequences of tiller-related genes

[0069]

[0070]

[0071] QPCR amplification was performed to detect the expression levels of tiller-related genes in overexpression plants, and the results are as Figure 5 shown.

[0072] Strigolactones (SLs) are a new type of plant hormone that inhibits plant branching. The expression of SLs-related genes (D10, D3, D14, D27, D53) was detected by qRT-PCR, and the results ( Figure 5 A-E in) showed that the expression levels of SLs synthesis-related genes D10 and D27 were extremely significantly down-regulated in overexpression plants, and the expression levels of SLs signal transduction genes D53, D14 and D3 were also extremely significantly down-regulated in overexpression plants.

[0073] The gene MOC1 that affects axillary bud growth is generally highly expressed at the axillary buds of rice, promoting the outward growth of axillary buds. The qRT-PCR results showed ( Figure 5 F in) that the expression level of MOC1 gene in overexpression plants was extremely significantly higher than that in wild-type plants.

[0074] The above results indicate that the TaMICU1-6A gene affects the increase in tillering of rice by affecting the inhibition of SLs hormone and promoting axillary bud growth.

[0075] The results of the above examples indicate that overexpressing the wheat TaMICU1-6A gene in rice can increase the tiller number of rice.

Claims

1. Use of wheat TaMICU1-6A gene or the protein encoded thereby in increasing tiller number of crops, wherein, The nucleic acid sequence of the wheat TaMICU1-6A gene is the sequence shown in SEQ ID NO: 1; or The amino acid sequence of the protein encoded by the wheat TaMICU1-6A gene is the sequence shown in SEQ ID NO: 2; The crop is rice or wheat.

2. The use according to claim 1, wherein By overexpressing the wheat TaMICU1-6A gene in the crop, the tiller number of the crop is increased.

3. A method for increasing the tiller number of crops, wherein, The method includes: overexpressing the wheat TaMICU1-6A gene in the crop, wherein the nucleic acid sequence of the wheat TaMICU1-6A gene is the sequence shown in SEQ ID NO: 1; or The amino acid sequence of the protein encoded by the wheat TaMICU1-6A gene is the sequence shown in SEQ ID NO: 2; The crop is rice or wheat.

4. The method according to claim 3, wherein, The method for overexpressing the wheat TaMICU1-6A gene in the crop includes: 1) operably linking a strong promoter to the wheat TaMICU1-6A gene in the crop; and / or 2) increasing the copy number of the wheat TaMICU1-6A gene on the chromosome of the crop.

Images