A molecular marker related to immune indicators of Tibetan sheep and its application in breeding
By detecting base mutations of SNP molecular markers in hidden sheep and evaluating their immunoglobulin content, the problem of difficulty in screening high disease resistance in the prior art is solved, and efficient breeding selection and breeding basis are achieved.
Patent Information
- Application Number
- CN202410843118.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-27
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2044-06-27
AI Technical Summary
In the prior art, effective molecular markers are lacking in screening for high disease resistance to Tibetan sheep, and it is difficult to improve the breeding efficiency and accuracy of Tibetan sheep through molecular marker assisted selection.
Provide a SNP molecular marker located at base 12065580 on chromosome 1, version 1 of the sheep reference genome Oar_v4.0, to evaluate the immunoglobulin content of hiding sheep by detecting different mutation forms (C or T) of the base, design specific primer pairs for PCR amplification and sequencing, and develop kits for detecting and screening of high immunity hiding sheep breeds.
By detecting the SNP molecular markers of hidden sheep, it can significantly distinguish the immunoglobulin content of different genotypes, provide a high-immune basis for breeding of hidden sheep, and improve breeding selection efficiency and accuracy.
Smart Images

Figure CN118638934B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to a molecular marker related to immune indicators of Tibetan sheep and its application in breeding. Background Art
[0002] Tibetan sheep have lived in the Qinghai-Tibet Plateau for a long time. The environment in the region is harsh, and sheep with high immunity and high disease resistance are needed to adapt to such an environment.
[0003] Immune indicators reflect an animal's disease resistance. This ability depends primarily on the health and capabilities of its immune system. The immune system's primary function is to identify and eliminate invading pathogens, such as bacteria and viruses. When a pathogen invades, the immune system quickly responds, initiating a series of immune responses to combat and eliminate the pathogen.
[0004] An animal's disease resistance is also influenced by factors such as genetics, environmental factors, nutritional status, and age. Therefore, immune indicators serve as an important reference for assessing an animal's disease resistance and health. By monitoring changes in immune indicators, we can promptly identify immune issues and take appropriate measures to improve its disease resistance, preventing and treating illnesses.
[0005] With the rapid development of molecular marker technology, in Tibetan sheep breeding, the search for mutation sites in genes at the gene level, the analysis of their association with traits to find the relationship between genes and traits, and early selection, thereby improving the efficiency and accuracy of seed selection, has broad application value. Therefore, molecular markers provide a basis for people to study the genetic mechanism of Tibetan sheep immunity at the molecular level. Screening corresponding molecular markers for more efficient use in Tibetan sheep breeding is an important issue in this field. There are not many molecular markers related to Tibetan sheep immunity in the prior art for molecular marker-assisted selection related to immunity. It is particularly important to provide a molecular marker related to the immune traits of Tibetan sheep, so as to be used in Tibetan sheep molecular marker-assisted breeding to screen Tibetan sheep with high disease resistance. Summary of the Invention
[0006] The purpose of the present invention is to provide a molecular marker related to immune indicators of Tibetan sheep and its application in breeding.
[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0008] The present invention provides a SNP molecular marker associated with the immune traits of Tibetan sheep. The SNP molecular marker is located at the 12065580th base on chromosome 1 of the sheep reference genome Oar_v4.0 version, and the mutant base is C or T.
[0009] Preferably, the genotype of the Tibetan sheep with the mutant base C is CC or CT;
[0010] The genotype of Tibetan sheep with the mutant base T is TT;
[0011] The immunoglobulin content in Tibetan sheep with genotype TT was higher than that in Tibetan sheep with genotype CC or CT.
[0012] The immunoglobulin content in Tibetan sheep with genotype CT was higher than that in Tibetan sheep with genotype CC.
[0013] Preferably, the immunoglobulin includes one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.
[0014] The present invention also provides the use of the SNP molecular marker in preparing a product for detecting the immunity of Tibetan sheep.
[0015] The present invention also provides the use of the SNP molecular marker in preparing a product for screening Tibetan sheep breeds with high immunity.
[0016] The present invention also provides a primer pair for amplifying the gene fragment of the SNP molecular marker, and the primer pair is shown as SEQ ID NO. 1-2.
[0017] The present invention also provides application of the primer pair in preparing a product for detecting the immunity of Tibetan sheep.
[0018] The present invention also provides the use of the primer pair in preparing a product for screening Tibetan sheep breeds with high immunity.
[0019] The present invention also provides a kit for detecting the immunity of Tibetan sheep, comprising a reagent for detecting the SNP molecular marker or the primer pair.
[0020] The present invention also provides a kit for screening Tibetan sheep breeds with high immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.
[0021] The present invention provides a molecular marker associated with immune indicators of Tibetan sheep and its application in breeding. The SNP molecular marker of the present invention is located at the 12065580th base on chromosome 1 of the international sheep reference genome Oar_v4.0 version; when the 12065580th base on the chromosome is C, the genotype is CC or CT; when the 12065580th base on chromosome 1 is T, the genotype is TT; through association analysis between different genotypes and the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it was found that the immunoglobulin A, immunoglobulin G, and immunoglobulin M of Tibetan sheep individuals with the TT genotype were significantly higher than those of individuals with CC and CT genotypes (p < 0.05), and the immunoglobulin A, immunoglobulin G, and immunoglobulin M of Tibetan sheep individuals with the CT genotype were significantly higher than those of individuals with the CC genotype (p < 0.05). By detecting the base at nucleotide position 12,065,580 on chromosome 1 of Tibetan sheep, the levels of immunoglobulin A, immunoglobulin G, and immunoglobulin M in individual Tibetan sheep can be determined. This method provides a new SNP molecular marker resource for marker-assisted selection of immune traits in Tibetan sheep for non-diagnostic purposes, providing a basis for breeding Tibetan sheep with high immunity. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 is the PCR amplification product; M represents Marker; 1, 2, and 3 represent three groups of repetitions.
[0023] Figure 2 Figure 3 is the peak diagram and sequence obtained after the PCR product was purified and sequenced. DETAILED DESCRIPTION
[0024] The present invention provides a SNP molecular marker associated with the immune traits of Tibetan sheep. The SNP molecular marker is located at the 12065580th base on chromosome 1 of the sheep reference genome Oar_v4.0 version, and the mutant base is C or T.
[0025] In the present invention, the genotype of the Tibetan sheep with the mutant base C is CC or CT;
[0026] The genotype of Tibetan sheep with the mutant base T is TT;
[0027] The immunoglobulin content in Tibetan sheep with genotype TT was higher than that in Tibetan sheep with genotype CC or CT.
[0028] The immunoglobulin content in Tibetan sheep with genotype CT was higher than that in Tibetan sheep with genotype CC.
[0029] In the present invention, the immunoglobulin includes one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.
[0030] The present invention also provides the use of the SNP molecular marker in preparing a product for detecting the immunity of Tibetan sheep.
[0031] The present invention also provides the use of the SNP molecular marker in preparing a product for screening Tibetan sheep breeds with high immunity.
[0032] The present invention also provides a primer pair for amplifying the gene fragment of the SNP molecular marker, and the primer pair is shown as SEQ ID NO. 1-2.
[0033] SEQ ID NO. 1 is an upstream primer, the sequence is: 5'-CACAGGCCACATCTAAGAGC-3'; SEQ ID NO. 2 is a downstream primer, the sequence is: 5'-TGGTGGTCCAGTGATTAAGCCTA-3'. In the present invention, the primer pair was synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0034] In the present invention, the length of the amplified fragment obtained by amplification using this primer pair is 558 bp. The sequence of the amplified fragment is shown in SEQ ID NO. 3. SEQ ID NO. 3:.
[0035] In the present invention, the amplification system is 25 μL: 22 μL of Gold Mix (green), 1 μL of upstream and downstream primers, and 1 μL of genomic DNA.
[0036] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 58°C for 10 s, and 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.
[0037] The present invention also provides application of the primer pair in preparing a product for detecting the immunity of Tibetan sheep.
[0038] The present invention also provides the use of the primer pair in preparing a product for screening Tibetan sheep breeds with high immunity.
[0039] The present invention also provides a kit for detecting the immunity of Tibetan sheep, comprising a reagent for detecting the SNP molecular marker or the primer pair.
[0040] The present invention also provides a kit for screening Tibetan sheep breeds with high immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.
[0041] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0042] Example 1
[0043] 1. Sample collection
[0044] The samples came from Tibetan sheep populations under natural grazing conditions, including 58 samples from Gannan Tibetan Autonomous Prefecture, Gansu Province, 64 from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 45 from Shigatse City, Tibet Autonomous Region. 5 mL of blood samples were collected from 167 fasting Tibetan sheep and placed in a clean pro-coagulant vacuum blood collection tube. The tubes were allowed to stand for 30 minutes and then centrifuged at 3500 r / min for 15 minutes. The supernatant was aspirated into a clean PE tube, sealed, and stored in a -20°C low-temperature refrigerator. Another 5 mL of blood sample was collected in a blood collection tube with EDTA-K2 anticoagulant added. After blood sample collection, the tubes were quickly mixed and temporarily placed in a sampling box containing ice packs. After being transported back to the laboratory, they were frozen in a -20°C refrigerator for genomic DNA extraction.
[0045] 2 Main reagents and instruments
[0046] Blood collection tubes containing EDTA-K2 anticoagulant were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; a NanoDrop 2000 spectrophotometer was purchased from ThermoFisher Scientific (USA); DL2000 marker, agarose, and nucleic acid dye were all purchased from Beijing Solebold Technology Co., Ltd.; Gold Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; an electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and a PCR instrument was purchased from BioRad. Immunoglobulin A (IgA) (E027-1-1), immunoglobulin G (IgG) (E026-1-1), and immunoglobulin M (IgM) (E025-1-1) detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.
[0047] 3 Methods
[0048] 3.1 IgA, IgG, and IgM testing
[0049] Spectrophotometric determinations were performed using the IgA, IgG, and IgM detection kits from the Nanjing Jiancheng Bioengineering Institute. First, a standard curve was established using the standard. Then, 7 μL of distilled water, standard solution, and sample to be tested were added to the blank tube, standard tube, and assay tube, respectively. The R1 solution was added to 900 μL, and the mixture was incubated at 37°C for 5 minutes. The reading at a wavelength of 340 nm was recorded as A1. Next, 180 μL of R2 solution was added to each tube, and the mixture was incubated at 37°C for 5 minutes. The reading at a wavelength of 340 nm was recorded as A2. Finally, ΔA was calculated as A2-A1. Substituting ΔA into the standard curve equation, the IgA, IgG, and IgM concentrations of the samples were calculated.
[0050] 3.2 Extraction of genomic DNA from blood
[0051] Genomic DNA was extracted from blood samples using the blood genome extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. The extracted DNA was placed under an ultraviolet spectrophotometer to detect concentration and purity. A concentration >20 ng / μL and OD260 / OD280 between 1.7 and 1.9 met the experimental requirements and was stored at -20°C for future use.
[0052] 3.3 Primer design
[0053] A pair of specific primers was designed using PrimerPremier 5.0 software with reference to the chromosome 1 gene sequence of the international sheep genome, Oar v4.0 (GenBank accession number: NC_019458.2). The nucleotide sequences of the primer pair are shown in SEQ ID NOs. 1 and 2. SEQ ID NO. 1 is the upstream primer, with the sequence: 5'-CACAGGCCACATCTAAGAGC-3'; SEQ ID NO. 2 is the downstream primer, with the sequence: 5'-TGGTGGTCCAGTGATTAAGCCTA-3'.
[0054] The amplified fragment was 558 bp in length, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0055] 3.4 PCR amplification and sequencing
[0056] PCR amplification system 25 μL: Gold Mix (green) 22 μL, 1 μL each of upstream and downstream primers, 1 μL of genomic DNA.
[0057] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 58°C for 10 s, and 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.
[0058] The PCR products were detected by 1.5% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO. 3, and the SNP marker is located at position 214 of the nucleotide sequence shown in SEQ ID NO. 3.
[0059] The bioanalysis software MEGA6.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graphs, and complete the typing.
[0060] SEQ ID NO.3: CACAGGCCACATCTAAGAGCTCACGTGCCACAGCTAAAGATCCCACATGCCGAAATGAAGATCAAAGGTCAAGCATGCCGCAGCTAAGACCCATCACAGCCAAATAAACAAAACGTGTTTTAAAAAGGAGGTATAAATGTTAAA TATTTTAAGTGAAAAGCTACACTTGTCAGATGAGCCCTAAACACTACCAGCAATTAGTAATCATATCTTTGAACATCTCACAAATTTGTACTCAGAATTTGTGAAAATTTCTCTTTTTCAGAGAAGATTTATTTATTTATTTTGGCCGT GCTGGGTCTTTGTGCTGCATGCAGGCTTTGTCCAGCTGCAGCGAGCGGGGGCTGCTCCTTGTTGCCGGGCACGAGCGTCTCGTTGCAGTGGCTCCTCGTGTTGGGGAACGCGAGCTCTGGGTGCACAGGCCTC AGTAGTTGCAGCACCGTGGACTCAGTAGCTGTGGCTCACAGGTGTAGTTGCTTCTTGGTGTGCGGGATCTTCCTGGACCAGGGATCAAACCCGTGTCCCCTTGCTTTGGTAGGCTTAATCACTGGACCACCA.
[0061] 4 Statistical analysis
[0062] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. Popgen32 software was used to calculate the g12065580C>T gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test. PIC (polymorphism information content) software was used to calculate the polymorphic information content. General linear models in IBM SPSS Statistics 22 software were used to analyze the associations between different genotypes and IgA, IgG, and IgM in Tibetan sheep. Results are expressed as mean ± standard error.
[0063] 5 Results
[0064] 5.1 PCR amplification and sequencing results
[0065] The amplified product of the g12065580C>T SNP site on chromosome 1 of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 558 bp, which was in line with the expected size, so the next experiment could be carried out.
[0066] The peak diagram and sequence of the PCR product after purification and sequencing are shown in Figure 2 .Depend on Figure 2 It can be seen that the g12065580C>TSNP site has a CT mutation, and there are three genotypes: CC, CT, and TT.
[0067] 5.2 Statistical analysis results
[0068] The genotype and allele frequencies of the g12065580C>T SNP locus on chromosome 1 of Tibetan sheep were analyzed from a population genetics perspective. As shown in Table 1, the CC genotype is the most frequent and dominant genotype at the g12065580C>T SNP locus, while the C allele frequency is 79.6%, indicating a dominant allele. The chi-squared fitness test indicated that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P < 0.05) (Table 1). The expected heterozygosity and PIC of this locus are 1.326 and 0.216, respectively, with a PIC < 0.25, indicating low polymorphism.
[0069] Table 1 Polymorphism of g12065580C>TSNP locus on chromosome 1 of Tibetan sheep
[0070]
[0071] 5.3 Association analysis between different genotypes and IgA, IgG, and IgM
[0072] General linear models were used in IBM SPSS Statistics 22 software to analyze the association between different genotypes and immunoglobulin (IgA), IgG, and IgM levels in Tibetan sheep. The results showed that Tibetan sheep with the TT genotype had significantly higher levels of IgA, IgG, and IgM than those with the CC and CT genotypes (p < 0.05). Tibetan sheep with the CT genotype had significantly higher levels of IgA, IgG, and IgM than those with the CC genotype (p < 0.05). This suggests that the base sequence at the g12065580C>TSNP site on chromosome 1 is significantly associated with IgA, IgG, and IgM levels in Tibetan sheep (p < 0.05), making it a SNP marker associated with IgA, IgG, and IgM in Tibetan sheep. The results are shown in Table 2.
[0073] Table 2 Relationship between different genotypes and immunoglobulins A, G and M
[0074]
[0075] Note: Data in the same row with different lowercase letters indicate significant differences (P<0.05).
[0076] The present invention provides a molecular marker associated with immune indicators of Tibetan sheep and application thereof in breeding. The SNP molecular marker of the present invention is located at the 12065580th base on chromosome 1 of the international sheep reference genome Oar_v4.0 version; when the 12065580th base on the chromosome is C, the genotype is CC or CT; when the 12065580th base on the chromosome 1 is T, the genotype is TT; through association analysis between different genotypes and immunoglobulin A, immunoglobulin G, and immunoglobulin M contents, it is found that the immunoglobulin A, immunoglobulin G, and immunoglobulin M of Tibetan sheep individuals with the TT genotype are significantly higher than those of individuals with CC and CT genotypes (p<0.05), and the immunoglobulin A, immunoglobulin G, and immunoglobulin M of Tibetan sheep individuals with the CT genotype are significantly higher than those of individuals with the CC genotype (p<0.05). By detecting the base at nucleotide position 12,065,580 on chromosome 1 of Tibetan sheep, the levels of immunoglobulin A, immunoglobulin G, and immunoglobulin M in individual Tibetan sheep can be determined. This method provides a new SNP molecular marker resource for marker-assisted selection of immune traits in Tibetan sheep for non-diagnostic purposes, providing a basis for breeding Tibetan sheep with high immunity.
[0077] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Use of a reagent for detecting SNP molecular markers in preparing a product for screening immune traits of Tibetan sheep, characterized in that: The SNP molecular marker is located at base 12065580 on chromosome 1 of the sheep reference genome Oar_v4.0 version, and the mutated base is C or T; According to the molecular marker alleles, Tibetan sheep have three genotypes: CC, CT or TT; The immunoglobulin content in Tibetan sheep with genotype TT was higher than that in Tibetan sheep with genotype CC or CT. The immunoglobulin content in Tibetan sheep with genotype CT was higher than that in Tibetan sheep with genotype CC. The reagent is a primer pair, and the primer pair is shown as SEQ ID NO. 1-2.
2. Use of a reagent for detecting SNP molecular markers in preparing a product for assisting breeding of Tibetan sheep with high immunity, characterized in that: The SNP molecular marker is located at base 12065580 on chromosome 1 of the sheep reference genome Oar_v4.0 version, and the mutated base is C or T; According to the molecular marker alleles, Tibetan sheep have three genotypes: CC, CT or TT; The immunoglobulin content in Tibetan sheep with genotype TT was higher than that in Tibetan sheep with genotype CC or CT. The immunoglobulin content in Tibetan sheep with genotype CT was higher than that in Tibetan sheep with genotype CC. The reagent is a primer pair, and the primer pair is shown as SEQ ID NO. 1-2.
3. The use according to claim 1 or 2, characterized in that The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.
Citation Information
Patent Citations
Molecular marker related to immune traits of Tibetan sheep and application of molecular marker
CN117683909A
SNP (Single Nucleotide Polymorphism) molecular marker related to immune traits of Tibetan sheep and application of SNP molecular marker
CN117904318A