A kind of GPCR inhibitor and the application of GPCR gene NPFF2 in tobacco whitefly resistance management
By inhibiting GPCR signal transduction in whiteflies using GPCR inhibitors or dsNPFF2, the resistance of whiteflies to neonicotinoid pesticides was resolved, thus improving the control efficacy of insecticides.
Patent Information
- Application Number
- CN202410710469.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-03
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-06-03
AI Technical Summary
Whiteflies have developed severe resistance to neonicotinoid pesticides, leading to a decline in the effectiveness of chemical insecticide control. Effective control methods are urgently needed to reduce pesticide use and improve control efficacy.
GPCR inhibitors such as suramin or double-stranded RNA with interfering fragments (dsNPFF2) are used to specifically inhibit GPCR signal transduction in whiteflies, thereby reducing pest resistance and increasing sensitivity to insecticides.
It significantly improves the sensitivity of whiteflies to neonicotinoid agents, increases the control effect of insecticides, and enhances the control effect on whiteflies.
Smart Images

Figure FT_1 
Figure BDA0004873859450000041 
Figure BDA0004873859450000051
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to application of a GPCR inhibitor and a GPCR gene NPFF2 in pest control and belongs to the field of plant protection. Specifically, the application relates to application of a GPCR inhibitor and a GPCR gene NPFF2 in resistance management of Bemisia tabaci to neonicotinoid insecticides. BACKGROUND
[0002] G protein-coupled receptors (GPCRs) are one of the largest families of cell membrane receptors and have been widely concerned. GPCRs are 7-transmembrane receptors that participate in the process of signal transduction from extracellular stimuli to intracellular processes, and are important proteins for more than 80% of cell signal transduction. The receptors are widely involved in reproduction, development, endocrine and metabolism and other physiological processes, and are closely related to a variety of diseases, so more than 50% of global medical drug research and development targets act on GPCR receptors. In insects, GPCR genes and their functions have been discovered and widely involved in growth and development and reproductive processes. In addition, upregulation of multiple GPCR genes plays an important role in the formation of insect resistance, such as metabolic resistance of Culex pipiens pallens, Aedes aegypti, Drosophila melanogaster and Lymantria dispar to pyrethroid insecticides and neonicotinoid insecticides. In view of the above, GPCRs can be used as new targets in the development of insecticides and pest control, and the development of GPCR management technology for drug-resistant pests has application value.
[0003] Bemisia tabaci belongs to Hemiptera Aleyrodidae insects, has a wide range of host plants, fast population growth, strong invasiveness, can transmit multiple plant viruses, and is easy to develop drug resistance, and is an important agricultural pest with worldwide distribution. For a long time, the control of Bemisia tabaci mainly relies on chemical insecticides, but due to the abuse of insecticides, the drug resistance of Bemisia tabaci is becoming increasingly serious and is rapidly spreading and spreading worldwide. In particular, the resistance of Bemisia tabaci to neonicotinoid insecticides is particularly prominent and has attracted widespread attention. Therefore, it is urgent to manage the resistance of Bemisia tabaci to neonicotinoid insecticides, reduce the use of pesticides, and ensure the service life and control effect of insecticides. SUMMARY
[0004] The purpose of the present application is to provide application of a GPCR inhibitor and a GPCR gene NPFF2 in pest control, in particular, application thereof in resistance management of Bemisia tabaci to neonicotinoid insecticides, and the effect is remarkable. The present application provides the development of a new type of insecticide or a related functional product designed for a specific target GPCR, which can be applied to the production and control of pests such as Bemisia tabaci, and in particular, provides application guidance for pest resistance management.
[0005] The application provides the technical scheme of the application, which is an application of a G protein-coupled receptor (GPCR) inhibitor in pest control, and the application is an application in resistance management of Bemisia tabaci to neonicotinoid insecticides.
[0006] Preferably, the G protein-coupled receptor (GPCR) inhibitor is a specific GPCR receptor inhibitor produced commercially.
[0007] Meanwhile, the application provides an application of a GPCR gene NPFF2 in pest control, and the application is an application in resistance management of Bemisia tabaci to neonicotinoid insecticides.
[0008] Preferably, the application is a functional product containing double-stranded RNA (dsNPFF2) containing an interfering fragment.
[0009] Meanwhile, the application provides an application of a G protein-coupled receptor (GPCR) inhibitor or a GPCR gene NPFF2 in resistance management of Bemisia tabaci, and preferably, the G protein-coupled receptor (GPCR) inhibitor is selected from a commercial GPCR receptor inhibitor suramin, which is purchased from Merck Sigma Company and has a product number of HY-B0879A.
[0010] The application of the GPCR gene NPFF2 is a functional product containing double-stranded RNA (dsNPFF2) containing an interfering fragment.
[0011] Further, the application is to reduce the resistance of pests, increase the sensitivity to insecticides and / or increase the efficacy of insecticides on pests.
[0012] 5. Meanwhile, the application also provides a method for resistance management of Bemisia tabaci by using a GPCR inhibitor, and the method comprises the following steps: step 1, detecting the resistance level of Bemisia tabaci; step 2, feeding resistant Bemisia tabaci with the GPCR inhibitor; and step 3, determining the sensitivity of Bemisia tabaci to insecticides.
[0013] In the method, preferably, the GPCR inhibitor suramin acts on the GPCR receptor, thereby specifically inhibiting or preventing the action of GPCR signal transduction.
[0014] In the method, preferably, the molar concentration of the GPCR inhibitor is 1-5 mM, preferably 1.5-3 mM, and specifically 2 mM.
[0015] The application further provides an application or development of at least one of the following 1)-3), and the components thereof comprise the GPCR inhibitor or the interfering fragment of the NPFF2 gene as described above:
[0016] 1) preventing and treating Bemisia tabaci;
[0017] 2) managing the resistance of Bemisia tabaci.
[0018] 3) The development of insecticides or the application of related derivative products in pest control.
[0019] Furthermore, the molar concentration of the aforementioned GPCR inhibitor can be 2 mM.
[0020] Furthermore, the aforementioned insecticides can be any of the neonicotinoids.
[0021] This invention provides a method for applying a GPCR inhibitor or the GPCR gene NPFF2 in the resistance of whiteflies to neonicotinoid agents, comprising the following 1)-3):
[0022] 1) Detecting resistance of whiteflies to neonicotinoid pesticides;
[0023] 2) Feed resistant whiteflies the aforementioned GPCR inhibitor or dsNPFF2;
[0024] 3) Determine the sensitivity of whiteflies to pesticides after treatment with GPCR inhibitors or dsNPFF2.
[0025] The application of the GPCR inhibitor described in this invention in entomological research and pest control.
[0026] The application of the GPCR gene NPFF2 described in this invention in entomological research and pest control.
[0027] The application of the GPCR gene as a target in the development of insecticide drugs, as described in this invention.
[0028] Those skilled in the art will recognize that certain modifications can be made to this invention without departing from the concept or scope of the invention.
[0029] This invention provides the application of a G protein-coupled receptor (GPCR) inhibitor and the GPCR gene NPFF2 in pest control, particularly in the management of neonicotinoid resistance in whiteflies. Experiments have shown that when resistant whiteflies were fed a 2 mM GPCR inhibitor or a feeding solution containing dsNPFF2, the mortality rate of whiteflies against seven neonicotinoid pesticides significantly increased by 30-60% compared to the control group. This indicates that the GPCR inhibitor or the interfering fragment of the NPFF2 gene reduces the resistance of whiteflies to neonicotinoid pesticides, thereby increasing the control efficacy of insecticides. This invention also involves the development of novel insecticides or related functional products targeting specific GPCR targets, which can be applied to the production and control of pests such as whiteflies, providing application guidance, especially for the management of pesticide resistance in pests. Attached Figure Description
[0030] Figure 1Gene expression of the Bemisia tabaci GPCR gene NPFF2 in the resistant population. A shows the structure of the Bemisia tabaci NPFF2 gene obtained by molecular cloning, B shows the domain prediction of the NPFF2 gene, and C shows the expression of the NPFF2 gene in the resistant population. DETAILED DESCRIPTION
[0031] The following examples further illustrate the application and are not to be considered as limiting the scope of the application or the particular methods by which they are explained.
[0032] The application will be further described in connection with specific examples, and its advantages and features will be more apparent from the description. However, these examples are only exemplary and do not constitute any limitation on the scope of the application.
[0033] It should be understood by those skilled in the art that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, and such modifications and replacements fall within the protection scope of the present application.
[0034] The experimental methods used in the following examples are conventional methods unless otherwise specified.
[0035] The materials, reagents, etc. used in the following examples are obtained from commercial channels unless otherwise specified.
[0036] The GPCR inhibitor information used in the following examples is as follows:
[0037] The trade name suramin is purchased from Merck Sigma Company, item number HY-B0879A.
[0038] The above GPCR inhibitors are powdery solids stored in the dark at low temperature.
[0039] The insecticides used in the following examples are 7 neonicotinoid agents:
[0040] The imidacloprid technical agent has an active ingredient content of 95%, which is purchased from Shanghai Yuan Ye Biotechnology Co., Ltd.
[0041] The thiamethoxam technical agent has an active ingredient content of 95%, which is purchased from Shanghai Yuan Ye Biotechnology Co., Ltd.
[0042] The clothianidin technical agent has an active ingredient content of 98%, which is purchased from Shanghai Yuan Ye Biotechnology Co., Ltd.
[0043] The acetamiprid technical agent has an active ingredient content of 95.8%, which is purchased from Shanghai Yuan Ye Biotechnology Co., Ltd.
[0044] The dinotefuran technical agent has an active ingredient content of 95%, which is purchased from Shanghai Yuan Ye Biotechnology Co., Ltd.
[0045] Nitenpyram TC: 99% active ingredient content, purchased from Shanghai Yuan Ye Biotechnology Co., Ltd.
[0046] Thiacloprid TC: 97.5%, purchased from Shanghai Yuan Ye Biotechnology Co., Ltd.
[0047] The above 7 neonicotinoid agents are all powdery solids.
[0048] The above insecticide TCs are all diluted with acetone as solvent to 1000 mg / L as stock solution.
[0049] The following example uses the MAPK inhibitor in the step method of whitefly resistance management:
[0050] Test insects: 2 whitefly neonicotinoid agent-resistant populations and 2 sensitive populations.
[0051] Insecticide bioassay method: the sensitivity of the above 7 neonicotinoid agents to the above whitefly resistant populations was determined by feeding method. Specifically, the above insecticide stock solution was diluted with 30% sucrose water to 6-7 series of concentration gradient, covered with Parafilm film on one end of the glass bioassay tube, and 60-80 μL of the solution was taken on the film, covered with a second layer of Parafilm film and flattened. Then 20 whitefly adults were taken with a sucking device and placed in the bioassay tube, and the other end of the tube was covered with a layer of Parafilm and a small hole was made for ventilation. The survival of the test insects was observed after 48 h.
[0052] Example 1, detection of whitefly resistance level to neonicotinoid agents
[0053] The sensitivity of different experimental populations of whitefly to 7 neonicotinoid agents was determined.
[0054] The mortality of each treatment group was calculated, and the LC 50 was calculated by POLO software. 50 The resistance ratio was calculated by the ratio of LC 50 of the resistant population to that of the sensitive population.
[0055] Table 1, resistance level of different populations of whitefly to 7 neonicotinoid agents:
[0056]
[0057]
[0058] In the above table: N shows the total number of test insects, FL (Fiducial limit) shows the confidence interval, x 2 shows the chi-square value, RR 50 shows the resistance ratio.
[0059] The results in Table 1 show that the two populations of B. tabaci have developed different levels of moderate to high resistance to the seven neonicotinoid insecticides compared to the susceptible population (S #1 , S #2 ).
[0060] Example 2, Application of GPCR inhibitors in the management of neonicotinoid insecticide resistance in B. tabaci
[0061] The following method for using the GPCR inhibitor suramin: The GPCR inhibitor was first diluted 1000 times in DMSO to form a stock solution, which was then added to 30% sucrose water to a concentration of 2.0 mM. The B. tabaci were then fed using the bioassay tube-feeding method described above, and after 48 h, live insects were taken for insecticide bioassay, using the method described above.
[0062] The following B. tabaci test populations were the B. tabaci resistant populations R #1 and R #2 .
[0063] Table 2: Sensitivity of B. tabaci resistant populations to neonicotinoid insecticides after treatment with GPCR inhibitors
[0064]
[0065]
[0066] In Table 2, the concentration of the insecticide is in mg / L, and the results are the data obtained after 48 h of bioassay.
[0067] The results in Table 2 show that after treatment of the B. tabaci neonicotinoid insecticide-resistant populations with GPCR inhibitors, their sensitivity to neonicotinoid insecticides increased, indicating that GPCR inhibitors can be used to manage the resistance of B. tabaci to neonicotinoid insecticides.
[0068] Example 3, Cloning of the GPCR gene NPFF2 and analysis of the correlation with resistance
[0069] The following NPFF2 gene was obtained by molecular cloning based on the Whitefly Genome Database (Whitefly Genome ID: Bta15373). First, total RNA was extracted from B. tabaci, and cDNA was synthesized by reverse transcription. The cloning primers for NPFF2 (F-chain primer: TACGTCGAACAACTTGGGCT, R-chain primer: GAACGAGCAGCAACGAGAAC) were used for PCR. The PCR product was then recovered and ligated, and positive single colonies were selected for sequencing by a company to obtain the accurate sequence of the NPFF2 gene in B. tabaci.
[0070] The PCR system is as follows:
[0071] Table 3 PCR system
[0072]
[0073] The PCR reaction procedure is as follows:
[0074] Table 4 PCR procedure
[0075]
[0076]
[0077] The GPCR gene NPFF2 is analyzed by real-time fluorescence quantitative qPCR for its expression amount in the whitefly resistance. On the basis of obtaining the cDNA template of the whitefly resistance population, the qPCR quantitative primer (F chain primer: TGCATCGCCTACATAACCA, R chain primer: CGGCAAGCAAAGAATAACG) of the NPFF2 gene is synthesized, the whitefly EF1a gene and the ribosomal protein RPL29 gene are used as the internal reference gene, the QuantStudio 3 Real-time PCR System fluorescence real-time quantitative instrument is analyzed, and the 2 -ΔΔCT Method is used to calculate the relative expression amount of the gene.
[0078] Table 5 Fluorescence quantitative system
[0079]
[0080] Table 6 Fluorescence quantitative procedure
[0081]
[0082] Please refer to Figure 1 , and the test shows that the full length of the whitefly GPCR gene NPFF2 gene is 1971 bp, contains 4 exons and 3 introns, and codes 656 amino acids, the gene has the conservative structure domain of 7 times of transmembrane GPCR. It is found by qPCR analysis that the expression amount of the NPFF2 gene in the resistance population is increased by 4-6 times compared with the sensitive population, which indicates that the high expression of the gene is significantly related to the resistance.
[0083] Example 4, Sensitivity of the resistant whitefly to 7 neonicotinoid pesticides after NPFF2 treatment
[0084] The double-stranded RNA of the NPFF2 gene, namely dsNPFF2, is used, and then the above bioassay method is used to detect the sensitivity of the resistant whitefly NPFF2 gene silencing for 48 hours to the pesticides.
[0085] The synthesis of dsNPFF2 is as follows: design specific interference primers (F strand primer: TAATACGACTCACTATAGGGAGACAGGAGACCTACTTGGTCAACG, R strand primer: TAATACGACTCACTATAGGGAGATTATAGACCCAGCCGGTATGAA) with T7 linker (RNA polymerase promoter sequence). Clone the obtained Bemisia tabaci NPFF2 gene bacterial liquid DNA, and synthesize dsRNA using Promega RNA double-strand synthesis kit.
[0086] Table 7 dsRNA synthesis system (10 μg DNA)
[0087]
[0088] The following uses dsEGFP as an experimental control group.
[0089] The use method of dsNPFF2 is as follows: the synthesized dsNPFF2 is diluted to 0.5 μg / μl with Bemisia tabaci feeding liquid (30% sucrose water), and then the Bemisia tabaci is fed by using the bioassay tube feeding method as described above, and the live insects are taken after 48 h for pesticide bioassay, and the bioassay method is as described above.
[0090] The following Bemisia tabaci test population is the Bemisia tabaci resistant population R #1 and R #2 .
[0091] The following agents are 7 neonicotinoid insecticides.
[0092]
[0093] Experiments show that after the Bemisia tabaci neonicotinoid insecticide-resistant population is treated with dsNPFF2, the sensitivity of the population to neonicotinoid insecticides increases, indicating that dsNPFF2 can reduce the resistance level of Bemisia tabaci, thereby increasing the sensitivity of the insecticide to Bemisia tabaci.
Claims
1. The application of a dsRNA targeting the GPCR gene NPFF2 in pest control, characterized in that: The application is in the control of neonicotinoid resistance in whiteflies; The full-length nucleotide sequence of the GPCR gene NPFF2 is Whitefly Genome ID: Bta15373.
2. The application as described in claim 1, characterized in that, The dsRNA was synthesized using DNA from the whitefly NPFF2 gene as a template with specific interference primers. The interference primers included the F-chain primer: TAATACGACTCACTATAGGGAGACAGGAGACCTACTTGGTCAACG, and the R-chain primer: TAATACGACTCACTATAGGGAGATTATAGACCCAGCCGGTATGAA.
3. The application as described in claim 1 or 2, characterized in that, The application is to reduce pest resistance and increase sensitivity to neonicotinoid pesticides.