Neutrophil gelatinase-associated lipocalin antibody and preparation method and application thereof

Abstract

The present invention relates to a neutrophil gelatinase-related lipid carrier antibody and its preparation method and application. Including: (1) constructing recombinant neutrophil gelatinase-associated lipid carrier antigen; (2) obtaining neutrophil gelatinase-associated lipid carrier antigen monomers and dimers; (3) mouse immunity; (4) constructing a single-chain antibody library for phages; (5) enrichment and screening. The invention uses antibody genetic engineering technology and phage display technology to construct a single-chain antibody library of phages, and screens out the ScFv of neutrophil gelatinase-related lipid carrier antibodies. It has high specificity and sensitivity and can specifically recognize neutrophil gelatinase-related lipid carrier antibodies. It is suitable for immunological detection, especially immunohistochemical detection, and provides a theoretical basis and material basis for the later establishment of rapid immunological detection of neutrophil gelatinase-related lipid carrier antibodies.

Description

Technical Field

[0001] The invention relates to a neutrophil gelatinase-associated lipocalin antibody and a preparation method and application thereof, belonging to the field of biology and immunology technology. Background Art

[0002] Neutrophil gelatinase-associated lipocalin (NGAL), also known as human neutrophil lipocalin (HNL), is a glycoprotein discovered in neutrophils by Kjeldsen.L and Venge.P et al. in the early 1990s. Under normal physiological conditions, NGAL is expressed at low levels in tissues such as the liver, kidney, stomach, intestine, pancreas, bronchi and prostate. Studies have shown that NGAL is involved in biological processes such as inflammation, immune response, cell differentiation and apoptosis.

[0003] A large number of studies have shown that NGAL in the human body exists mainly in three molecular forms: monomers (25 kDa), homodimers connected by disulfide bonds (45 kDa), and heteropolymers (135 kDa) that form covalent bonds with gelatinase through intermolecular disulfide bonds. It is reported that different molecular forms of NGAL have different sources and different functions. For example, monomeric NGAL may have a relatively high correlation with acute kidney injury, homodimers have high specificity and sensitivity for distinguishing bacterial infections from viral infections, and heterodimers may be related to tumor invasion.

[0004] Recent studies have found that NGAL is mainly related to kidney damage and bacterial infection, and many companies have developed NGAL in vitro diagnostic kits based on immunoassays. Antibodies are an indispensable raw material in the kit, but the existing antibody preparation methods are complex and time-consuming, and the antibody specificity and sensitivity are low. The time required to obtain single-chain antibodies through phage display technology is short and the antibody specificity is higher.

[0005] Using NGAL as the immunogen, mice are immunized and an anti-NGAL phage antibody library is constructed, which can effectively screen antibodies that antagonize NGAL. Through genetic engineering and protein expression technology, antagonistic NGAL antibodies can be produced on a large scale for the diagnosis and treatment of diseases related to NGAL abnormalities. Summary of the invention

[0006] In view of the deficiencies in the prior art, the present invention provides a neutrophil gelatinase-associated lipocalin antibody and a preparation method and application thereof.

[0007] The technical solution of the present invention is as follows:

[0008] A method for preparing a neutrophil gelatinase-associated lipocalin antibody comprises the following steps:

[0009] (1) Artificially synthesizing the nucleotide sequence of neutral granule gelatinase-associated lipocalin and inserting it into the expression vector pET-DsbA to obtain the recombinant plasmid pET-Dsba-NGAL; transforming the recombinant plasmid pET-Dsba-NGAL into Escherichia coli to obtain recombinant Escherichia coli; culturing the recombinant Escherichia coli, collecting the cells, and obtaining the recombinant neutral granule gelatinase-associated lipocalin antigen after separation and purification;

[0010] (2) adding the recombinant neutrophil gelatinase-associated lipocalin antigen obtained in step (1) to a dithiothreitol aqueous solution, reacting overnight at 4°C for 12 to 16 hours, to obtain a neutrophil gelatinase-associated lipocalin antigen monomer; adding the recombinant neutrophil gelatinase-associated lipocalin antigen obtained in step (1) to a dimethyl sulfoxide aqueous solution, reacting overnight at 4°C for 12 to 16 hours, to obtain a neutrophil gelatinase-associated lipocalin antigen dimer;

[0011] (3) using the neutrophil gelatinase-associated lipocalin antigen monomer and the neutrophil gelatinase-associated lipocalin antigen dimer obtained in step (2) to immunize mice respectively, determining the titer of mouse serum antibodies, and taking the spleen of the mouse with a higher titer;

[0012] (4) extracting the mouse spleen RNA obtained in step (3) and performing reverse transcription to obtain cDNA; then using the cDNA as a template to perform PCR amplification to obtain the heavy chain variable region gene and the light chain variable region gene of the neutrophil gelatinase-associated lipocalin; connecting the heavy chain variable region gene and the light chain variable region gene of the neutrophil gelatinase-associated lipocalin to obtain the single-chain antibody gene of the neutrophil gelatinase-associated lipocalin; connecting the single-chain antibody gene to the plasmid pCANTAB5E to obtain the recombinant plasmid pCANTAB5E-scFv; transforming the recombinant plasmid pCANTAB5E-scFv into Escherichia coli to obtain recombinant Escherichia coli; culturing the recombinant Escherichia coli and collecting the bacterial solution; adding a helper phage to the bacterial solution, continuing the culturing, and obtaining a phage single-chain antibody library after separation and purification;

[0013] (5) using the recombinant neutrophil gelatinase-associated lipocalin antigen obtained in step (1) to enrich and screen the phage single-chain antibody library obtained in step (4) to obtain neutrophil gelatinase-associated lipocalin monomeric single-chain antibodies M1 and M2 and neutrophil gelatinase-associated lipocalin dimer single-chain antibodies D1 and D2.

[0014] Preferably according to the present invention, in step (1), the NCBI accession number of the neutrophil gelatinase-associated lipocalin is S75256.1.

[0015] Preferably, according to the present invention, in step (1), the separation and purification is sequentially performed by nickel column purification, thrombin cleavage of the tag protein and nickel column series benzamidine agarose gel FF column purification.

[0016] Preferably, according to the present invention, in step (2), the final mass concentration of the dithiothreitol aqueous solution is 10 mM; and the volume ratio of the recombinant neutrophil gelatinase-associated lipocalin antigen to the 1 M dithiothreitol aqueous solution is 99:1.

[0017] Preferably, according to the present invention, in step (2), the final mass concentration of the dimethyl sulfoxide aqueous solution is 10%; and the volume ratio of the recombinant neutrophil gelatinase-associated lipocalin antigen to the dimethyl sulfoxide aqueous solution is 9:1.

[0018] Preferably, in step (3) of the present invention, the immunization is specifically as follows: after equal volumes of neutrophil gelatinase-associated lipocalin antigen monomer or neutrophil gelatinase-associated lipocalin antigen dimer are mixed and emulsified with complete adjuvant, the mixture is injected into mice, and the mice are given a first booster immunization every 2 weeks according to the same method, for a total of 4 booster immunizations.

[0019] Preferably according to the present invention, in step (4), the ratio of the number of recombinant Escherichia coli to the number of helper phages in the bacterial solution is 1:20.

[0020] Preferably, in step (4), the further culture, separation and purification are as follows: standing infection at 37°C for 40 min, centrifuging at 12000 rpm for 20 min, and discarding the supernatant; resuspending the precipitate with YT-AG medium, shaking and culturing at 37°C and 150 rpm for 12 to 16 h, collecting the bacterial liquid, centrifuging at 12000 rpm for 20 min, taking the supernatant, and adding it to PEG / NaCl solution with 1 / 5 volume of the supernatant, mixing well, and precipitating on ice for 3 h; centrifuging at 4°C and 12000 rpm for 20 min, discarding the supernatant, resuspending the precipitate with PBS buffer, and filtering with a 0.45 μm filter membrane.

[0021] According to a preferred embodiment of the present invention, in step (5), the enrichment and screening are specifically as follows:

[0022] The recombinant neutrophil gelatinase-associated lipocalin antigen was diluted to 1 μg / mL with PBS buffer and coated on a 96-well plate at 4°C for 22 h; 350 μL of PBST was added to each well to wash the plate and patted dry twice; 200 μL of BSA-PBS blocking solution was used to block each well at 4°C for 18 h, 350 μL of PBST was added to each well to wash the plate and patted dry twice; the 96-well plate was dried for 6 h; the phage single-chain antibody library solution was taken and 100 μL of PBST was added to each well to wash the plate and patted dry twice; L / well was added to a 96-well plate and incubated at 37°C for 1h; the plate was washed 5 times with detergent and patted dry; 200 μL of Gly-HCl solution (pH=2.2) was continued to be added, and after incubation at 37°C for 10min, 20 μL of Tris-HCl (pH=7.4) was added to terminate the reaction to obtain the first round of enrichment products of the phage antibody library; the first round of enrichment products of the phage antibody library were screened using recombinant neutrophil gelatinase-associated lipocalin antigen according to the same method, for a total of 4 rounds.

[0023] A neutrophil gelatinase-associated lipocalin antibody is prepared according to the above method.

[0024] Preferably according to the present invention, the neutrophil gelatinase-associated lipocalin antibodies include neutrophil gelatinase-associated lipocalin monomer single-chain antibody M1, neutrophil gelatinase-associated lipocalin monomer single-chain antibody M2, neutrophil gelatinase-associated lipocalin dimer single-chain antibody D1 and neutrophil gelatinase-associated lipocalin dimer single-chain antibody D2;

[0025] Further preferably, the neutrophil gelatinase-associated lipocalin monomeric single-chain antibody M1 is composed of a heavy chain variable region, a flexible peptide segment, and a light chain variable region, and the connection order is heavy chain variable region-flexible peptide segment-light chain variable region, and its nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.5;

[0026] The neutrophil gelatinase-associated lipocalin monomer single-chain antibody M2 is composed of a heavy chain variable region, a flexible peptide segment, and a light chain variable region, and the connection order is heavy chain variable region-flexible peptide segment-light chain variable region, and its nucleotide sequence is shown in SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.6;

[0027] The neutrophil gelatinase-associated lipocalin dimer single-chain antibody D1 is composed of a heavy chain variable region, a flexible peptide segment, and a light chain variable region, and the connection order is heavy chain variable region-flexible peptide segment-light chain variable region, and its nucleotide sequence is shown in SEQ ID NO.3, and its amino acid sequence is shown in SEQ ID NO.7;

[0028] The neutrophil gelatinase-associated lipocalin dimer single-chain antibody D2 consists of a heavy chain variable region, a flexible peptide segment, and a light chain variable region, and the connection order is heavy chain variable region-flexible peptide segment-light chain variable region. Its nucleotide sequence is shown in SEQ ID NO.4, and its amino acid sequence is shown in SEQ ID NO.8.

[0029] The use of the above-mentioned neutrophil gelatinase-associated lipocalin antibody in detecting the content of neutrophil gelatinase-associated lipocalin.

[0030] Preferably according to the present invention, the application is specifically: detecting the content of neutrophil gelatinase associated lipocalin in serum of acute kidney injury, or detecting the content of neutrophil gelatinase associated lipocalin in serum of bacterial infection inflammation.

[0031] The technical features of the present invention are as follows:

[0032] The neutrophil gelatinase-associated lipocalin antibody provided by the present invention is prepared by phage display technology. Phage display is a technology that inserts the DNA sequence of an exogenous peptide or protein into a certain position of the phage coat protein structural gene, so that the exogenous peptide is expressed on the surface of the phage along with the capsid protein. In the present invention, neutrophil gelatinase-associated lipocalin antigen monomers or neutrophil gelatinase-associated lipocalin antigen dimers are subcutaneously injected into immunized mice, spleens are obtained from the immunized mice, and a neutrophil gelatinase-associated lipocalin antibody phage antibody library is constructed to quickly screen neutrophil gelatinase-associated lipocalin antibodies, which can be used to prepare diagnostic reagents and therapeutic drugs for detecting abnormal neutrophil gelatinase-associated lipocalin expression and related diseases.

[0033] The beneficial effects of the present invention are:

[0034] 1. The present invention utilizes antibody genetic engineering technology and phage display technology to construct a phage single-chain antibody library, from which ScFv of neutrophil gelatinase-associated lipocalin antibody is screened out, which has high specificity and sensitivity, can specifically identify neutrophil gelatinase-associated lipocalin antibody antigen, is suitable for immunological detection, especially immunohistochemical detection, and provides a theoretical basis and material foundation for the later establishment of immunological rapid detection of neutrophil gelatinase-associated lipocalin antibody.

[0035] 2. Compared with the polyclonal antibody of neutrophil gelatinase-associated lipocalin, the genetically engineered antibody of neutrophil gelatinase-associated lipocalin prepared by the present invention has higher specificity and is less likely to cross-react. And compared with the monoclonal antibody of neutrophil gelatinase-associated lipocalin, the preparation method provided by the present invention has a simple and rapid preparation process. The antibody of neutrophil gelatinase-associated lipocalin prepared by phage display technology can be used to prepare diagnostic reagents and therapeutic drugs for detecting abnormal expression of neutrophil gelatinase-associated lipocalin and related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 These are the SDS-PAGE verification results of the neutrophil gelatinase-associated lipocalin antigen monomer and the neutrophil gelatinase-associated lipocalin antigen dimer.

[0037] Figure 2 The results of agarose gel electrophoresis of RNA from mouse spleen tissue whose titer met the experimental requirements.

[0038] Figure 3 This is the result of agarose gel electrophoresis of the single-chain antibody gene scFv of neutrophil gelatinase-associated lipocalin.

[0039] Figure 4 These are the experimental results after electroporation of monomer and dimer recombinant plasmids.

[0040] Figure 5 This is the colony PCR verification result of the recombinant Escherichia coli in Example 3. DETAILED DESCRIPTION

[0041] The following is a detailed description of the present invention in conjunction with specific embodiments. The examples described below are only preferred embodiments of the present invention and are not intended to limit the present invention in any form. Any simple modification, equivalent changes and modifications made to the embodiments based on the technical essence of the present invention are within the scope of the technical solution of the present invention.

[0042] Example 1. Preparation of recombinant neutrophil gelatinase-associated lipocalin antigen

[0043] 1. Construction of recombinant plasmid pET-Dsba-NGAL

[0044] (1) According to the neutrophil gelatinase-associated lipocalin gene sequence information (S75256.1) published by NCBI, the nucleotide sequence of neutrophil gelatinase-associated lipocalin was artificially synthesized and inserted into plasmid pUC57, and BamHI and EcoRI restriction sites were added to obtain plasmid pUC57-NGAL. Then, using plasmid pUC57-NGAL as a template, primers were used to amplify the nucleotide sequence of the artificially synthesized neutrophil gelatinase-associated lipocalin in vitro.

[0045] The primer sequences are:

[0046] Upstream primer: 5'-CGCGGATCCCAGGACTCCACCTCAGA-3',

[0047] Downstream primer: 5′-GAATTCCGGGCCGTCGATACACTGGTCG-3′.

[0048] (2) Inserting the amplified nucleotide sequence of neutrophil gelatinase-associated lipocalin into the expression vector pET-DsbA to obtain the recombinant plasmid pET-Dsba-NGAL, the specific method is as follows:

[0049] The expression vector pET-DsbA and the nucleotide sequence of the neutral gelatinase-associated lipocalin were double-digested with BamH I and EcoR I enzymes, and the digestion was carried out in a water bath at 37°C for 15 minutes. Then, a complete circular recombinant plasmid pET-Dsba-NGAL was formed under the action of T4 DNA ligase. The circular recombinant plasmid pET-Dsba-NGAL was then transformed into Escherichia coli DH5α for plasmid amplification. After the amplification was completed, the plasmid was verified.

[0050] The ligation process of the T4 DNA ligase is as follows: the nucleotide sequence of the neutrophil gelatinase-associated lipocalin and the expression vector pET-DsbA are mixed in a mass ratio of 3:1, 0.3 μL of T4 DNA ligase is added, buffer and sterile water are added, a total of 20 μL, and the mixture is placed in a water bath at 22°C for 10 minutes, and then in a water bath at 65°C for 10 minutes.

[0051] Plasmid verification: E. coli DH5α transformed with circular recombinant plasmid pET-Dsba-NGAL was cultured on LB solid medium containing 100 μg / mL Amp, 10 Amp-resistant transformants were picked and continued to be cultured overnight in LB liquid medium containing 100 μg / mL Amp, plasmids were extracted, and plasmid DNA was digested with BamH I and EcoR I. Agarose gel electrophoresis was used to analyze whether the recombinant plasmid was inserted into the correct site to verify the positive transformants. Finally, the positive recombinants found were subjected to T7 sequencing to verify the correctness of the transformed plasmid. The sequencing results showed that the measured NGAL sequence was consistent with the theoretical sequence.

[0052] 2. Expression of recombinant neutrophil gelatinase-associated lipocalin antigen

[0053] (1) The correctly sequenced recombinant plasmid pET-Dsba-NGAL was transformed into Escherichia coli BL21 (DE3) competent cells by heat shock. The specific steps are as follows: 50 μL of competent cells were transferred to 50 μL of Escherichia coli competent DH5α at 4°C, and the bottom of the centrifuge tube was gently tapped to mix, and placed on a 4°C multi-temperature zone workbench for 30 min; heat-shocked in a 42°C water bath for 90 s; immediately transferred to a 4°C multi-temperature zone workbench and placed for 2 min; added 500 μL of LB liquid culture medium and cultured at 37°C and 200 rpm for 1 h; centrifuged at room temperature and 5000 rpm for 5 min in, discard 400 μL of the supernatant, resuspend the cells with a pipette, apply them on LB solid medium containing ampicillin (100 μg / mL), invert and culture at 37°C for 12-16 hours, pick a single clone from the LB solid medium, add 400 μL of LB liquid medium containing ampicillin (100 μg / mL) to a 1.5 mL centrifuge tube, culture at 37°C, 200 rpm for 8 hours, and finally transfer to 50 mL of LB liquid medium containing ampicillin (100 μg / mL) for overnight expansion culture to obtain recombinant Escherichia coli and preserve the seeds with glycerol;

[0054] (2) Take 100 μL of the recombinant E. coli culture medium in 100 mL of LB liquid medium, culture at 30°C and 120 rpm until OD600 = 0.4, add 1M IPTG to a final concentration of 0.1 mM, and continue to culture at 30°C and 120 rpm for 24 hours; after the induction, centrifuge at 4°C and 12000 rpm for 10 minutes, collect the cells, discard the filtrate, gently resuspend the cells with 10 mL of PBS buffer, add 50 mg / mL lysozyme to a final concentration of 1 mg / mL, vortex mix, react at 37°C for 30 minutes, freeze repeatedly 4 times, centrifuge at 12000 rpm and 4°C for 20 minutes, take the supernatant, and obtain the target protein. The precipitate is resuspended with PBS buffer, and the supernatant and the resuspended precipitate are run on SDS-PAGE electrophoresis at the same time to analyze the expression. Finally, the target protein is in the supernatant, indicating that the target protein is expressed in a soluble form.

[0055] 3. Isolation and purification of recombinant neutrophil gelatinase-associated lipocalin antigen

[0056] (1) Nickel column purification

[0057] The extracted target protein supernatant was purified by nickel column affinity chromatography using a protein chromatograph: the target protein supernatant was filtered with a 0.45 μm filter membrane, and the filtered supernatant was affinity chromatographed with a nickel column, with a flow rate set to 0.5 mL / min; after the target protein sample passed through the column, the column was flushed with a binding solution PBS buffer for about 2 column volumes, and then the impurities were eluted with Ni purification eluent I (20 mM Tris pH 8.0, 500 mM NaCl, 10 mM imidazole); the column was flushed with Ni purification eluent II (20 mM Tris pH 8.0, 500 mM NaCl, 500 mM imidazole), the UV value began to rise, and the protein was recovered until the UV value decreased and no longer changed, and the recovery was stopped, the flow rate was set to 0.8 mL / min, and the eluent was stored at -20°C;

[0058] (2) Thrombin cleavage of tagged protein

[0059] The target protein purified by nickel column was desalted and replaced in 20mM Tris-HCl 150mM NaCl buffer solution. The desalted target protein was concentrated by centrifugation in a refrigerated centrifuge, protein concentrator tube (10kD), 2500g, 30min, and the concentration was determined by Nanodrop protein quantification instrument, y (mg / ml) = A280*1.45-A280*(A260 / A280)*0.74, and the tag protein was cleaved by thrombin;

[0060] (3) Nickel column connected in series with benzamidine agarose gel FF column

[0061] The target protein after enzyme digestion is purified by a nickel column connected in series with a benzamidine agarose gel FF column to remove the tag protein and thrombin. The specific steps are as follows: the nickel affinity chromatography column is equilibrated with a thrombin buffer, the target protein after enzyme digestion is added to the nickel chromatography column, and the flow-through is recovered; the benzamidine agarose gel FF column is equilibrated with an equilibration buffer (50mM Tris-HCl 0.5M NaCl pH7.4), the flow-through recovered from the nickel column is added to the benzamidine agarose gel FF column, and the flow-through is recovered, i.e., the purified target protein; elution is performed with 5 column volumes of an elution buffer (10mM HCl 0.5M NaCl pH2.0) to remove the thrombin bound to the benzamidine agarose gel FF column; the filler is equilibrated with 3 column volumes of an equilibration buffer and 5 column volumes of deionized water, and the filler is stored in 20% ethanol to obtain a recombinant neutrophil gelatinase-associated lipocalin antigen.

[0062] Example 2. Preparation and Activity Verification of Neutrophil Gelatinase-Associated Lipid Transport Protein Antigen Monomer and Neutrophil Gelatinase-Associated Lipid Transport Protein Antigen Dimer

[0063] 1. Add 1485 μL of the recombinant neutrophil gelatinase-associated lipocalin antigen obtained in Example 1 to 15 μL of a dithiothreitol (1 M) aqueous solution, and react overnight at 4° C. for 12 h to form molecular disulfide bonds, thereby obtaining a neutrophil gelatinase-associated lipocalin antigen monomer;

[0064] 1350 μL of the recombinant neutrophil gelatinase-associated lipocalin antigen obtained in Example 1 was added to 150 μL of dimethyl sulfoxide water (100%) solution, and reacted overnight at 4° C. for 12 hours to obtain neutrophil gelatinase-associated lipocalin antigen dimers.

[0065] The neutral granule gelatinase-associated lipocalin antigen monomer and neutral granule gelatinase-associated lipocalin antigen dimer were verified by SDS-PAGE. Figure 1 shown.

[0066] Depend on Figure 1 It can be seen that the present example successfully prepared the neutral granule gelatinase associated lipocalin antigen monomer or the neutral granule gelatinase associated lipocalin antigen dimer.

[0067] 2. Enzyme-linked immunosorbent assay (ELISA) was used to identify the activity of the prepared neutrophil gelatinase-associated lipocalin antigen monomer and neutrophil gelatinase-associated lipocalin antigen dimer.

[0068] Neutrophil gelatinase-associated lipocalin antigen monomer and neutrophil gelatinase-associated lipocalin antigen dimer were diluted to 1 μg / mL with CBS buffer, added to a 96-well ELISA plate at a volume of 100 μL / well, and coated at 4°C overnight; after coating, the plate was washed at a volume of 350 μL / well for two times, and after patting dry, a blocking solution was added at a volume of 200 μL / well for blocking, and blocked at 4°C overnight; after blocking, the plate was washed at a volume of 350 μL / well for two times, and after washing, the plate was placed in a blower dryer for drying;

[0069] The antibody (CSB-DA001DmN) of Huamei Bio was diluted with PBS buffer at 1:1000, 1:5000, 1:10000, and 1:20000, and mixed with a mixer for 30 minutes; the coated ELISA plate was taken, and the antibodies with different gradient dilutions were added to duplicate wells, 100 μL per well, PBS buffer was used as a control, and the plate was sealed with a self-adhesive sealant, and incubated at 37°C for 1 hour; the plate was washed 5 times with detergent and patted dry; the horseradish peroxidase-labeled sheep anti-mouse IgG was diluted with enzyme-labeled antibody diluent at 1:5000; 100 μL of enzyme was added to each well, and the plate was sealed with a self-adhesive sealant, and incubated at 37°C for 0.5 hour; the plate was washed 5 times with detergent and patted dry; 50 μL of color developer A was added first, and then 50 μL of color developer B was added, and the color was developed at 37°C in the dark for 10 minutes. Add 50 μL of stop solution to each well, mix well, and measure the OD value of each well with a microplate reader at dual wavelengths of 450 nm and 630 nm. The results are shown in Table 1.

[0070] Table 1. ELISA verification of antigen activity

[0071] <![CDATA[Monomeric antigen (OD 450 ) average value]]> <![CDATA[Dimer antigen (OD 450 ) average value]]> <![CDATA[Huamei antigen (OD 450 ) average value]]> PBS 0.003 0.003 0.055 1：1000 3.191 3.294 3.525 1：5000 0.291 0.549 0.778 1：10000 0.0478 0.118 0.265 1：20000 0.017 0.039 0.134

[0072] As shown in Table 1, the neutrophil gelatinase-associated lipocalin antigen monomer and the neutrophil gelatinase-associated lipocalin antigen dimer are reactive with the antibodies of Huamei Biological, indicating that the neutrophil gelatinase-associated lipocalin antigen monomer and the neutrophil gelatinase-associated lipocalin antigen dimer both have obvious antigenic activity.

[0073] Example 3: Construction of phage single-chain antibody library

[0074] 1. Mouse immunization

[0075] Eight 7-week-old BALB / c mice were immunized as follows: the neutrophil gelatinase-associated lipocalin antigen monomer and neutrophil gelatinase-associated lipocalin antigen dimer were mixed with equal volumes of complete adjuvant and emulsified, and 200 μL of emulsion / each was subcutaneously injected into the back of the mouse for the first immunization. Every 2 weeks, the mice were given the first booster immunization, and a total of 4 booster immunizations were given. One week later, blood was collected from the tail, and the blood was centrifuged at 3500r / min for 3min, and serum was collected and titered. The OD450nm value of the serum of the mouse to be tested was P, and the OD450 nm value of the serum of the healthy mouse was N. The maximum dilution multiple of the serum when P / N≥2.1 was selected as the antibody titer. The results are shown in Tables 2 and 3.

[0076] Table 2. ELISA determination of mouse serum titer (monomer)

[0077]

[0078] Table 3. ELISA determination of mouse serum titer (dimer)

[0079]

[0080] As shown in Tables 2 and 3, the serum titer of mice injected with neutrophil gelatinase-associated lipocalin antigen monomer was greater than 12800, and the serum titer of mice injected with neutrophil gelatinase-associated lipocalin antigen dimer was greater than 25600. When the titer of mice reaches the experimental requirements, the mice can be dissected, the spleen can be taken, and RNA can be extracted.

[0081] 2. Preparation of TG1 competent cells

[0082] Take out the E. coli TG1 culture stored at -80℃ and streak overnight culture; the next day, pick a single colony and inoculate it into 300mL of 2×YT liquid culture medium and shake and culture until OD600nm is about 0.6. Collect the culture liquid, ice bath for 30min, then centrifuge at 4℃ and 1000g for 15min, and discard the supernatant. Wash the cells 3 times with 10% glycerol, centrifuge at 1000g for 15min, and obtain TG1 competent cells. Finally, resuspend with 10% glycerol, aliquot 50μL / tube, and store at -80℃.

[0083] 3. Construction of recombinant plasmid scFv-pCANTAB5E

[0084] The spleen tissue (5 mg) of mice immunized with neutrophil gelatinase-associated lipocalin antigen monomer and neutrophil gelatinase-associated lipocalin antigen dimer, which had titers that met the experimental requirements, was taken to extract RNA according to the instructions of the RNA extraction kit (Tiangen Biochemical Technology Co., Ltd.), and agarose gel electrophoresis was performed for identification. The results are as follows Figure 2 shown.

[0085] The extracted RNA was reverse transcribed into cDNA using a kit (Tiangen Biochemical Technology Co., Ltd.); the reverse transcription product cDNA was used as a template, and the heavy chain and light chain variable region primer sequences (see Table 4) were used to amplify the target genes VH and VL; the purified VH / VL product was used as a template, and VH and VL were connected to form a single-chain antibody gene scFv of neutrophil gelatinase-associated lipocalin through Linker (sequence see Table 5) using SOE-PCR technology, and sfi I and Not I restriction sites were added at both ends of scFv (sequence see Table 5), and agarose gel electrophoresis was performed for identification, and the results are shown as follows Figure 3 shown.

[0086] The single-chain antibody gene scFv of neutrophil gelatinase-associated lipocalin and the plasmid vector pCANTAB5E were double-digested with NotⅠ and sfiⅠ enzymes, and the digested products were gel-recovered and purified. The double-digested single-chain antibody gene scFv of neutrophil gelatinase-associated lipocalin and the pCANTAB5E vector were inserted and ligated with T4 ligase instructions to obtain the recombinant plasmid pCANTAB5E-scFv.

[0087] The recombinant plasmid pCANTAB5E-scFv is of two types, one is the recombinant plasmid pCANTAB5E-scFv constructed by RNA of mice immunized with neutrophil gelatinase-associated lipocalin antigen monomer, and the other is the recombinant plasmid pCANTAB5E-scFv constructed by RNA of mice immunized with neutrophil gelatinase-associated lipocalin antigen dimer.

[0088] Table 4: Primer sequences for amplifying VH and VL

[0089] Primer name Primer sequence (5'-3') VH-F AGGTSMARCTGCAGSAGTCWGG VH-R TGAGGAGACGGTGACCGTGGTCCCTTGGCCCC VL-F GACATTGAGCTCACCCAGTCTCCA VL-R1 CCGTTTGATTTCCAGCTTGGTGCC VL-R2 CCGTTTTATTTCCAGCTTGGTCCC VL-R3 CCGTTTTATTTCCAACTTTGTCCC VL-R4 CCGTTTCAGCTCCAGCTTGGTCCC

[0090] Table 5: Primers for amplifying scFv

[0091]

[0092] 4. Construction of recombinant Escherichia coli

[0093] The recombinant plasmid pCANTAB5E-scFv was transferred into TG1 competent cells by electroporation to obtain recombinant Escherichia coli. Specifically, 4 μL of the recombinant plasmid pCANTAB5E-scFv was added to the TG1 competent cells, and the cells were evenly transferred into the pre-cooled electroporation cup. After the electroporation, fresh SOC liquid culture medium was added to the electroporation cup, and the mixture was mixed and aspirated into a clean sterile EP tube. The cells were revived at 37°C for 1 hour. After the culture was completed, the cells were spread on SOC solid culture medium and cultured at 37°C overnight. The cells were counted the next day. The results were as follows: Figure 4 shown.

[0094] Depend on Figure 4 It can be seen that the library capacity of the antibody bacterial liquid library is calculated to be 1.5×10 6 .

[0095] The recombinant Escherichia coli are of two types, one is a recombinant Escherichia coli constructed by RNA of mice immunized with neutrophil gelatinase-associated lipocalin antigen monomer, and the other is a recombinant Escherichia coli constructed by RNA of mice immunized with neutrophil gelatinase-associated lipocalin antigen dimer.

[0096] 5. Recombinant E. coli Verification

[0097] Take 10 single colonies of recombinant Escherichia coli constructed by neutrophil gelatinase-associated lipocalin antigen monomer and neutrophil gelatinase-associated lipocalin antigen dimer immunized mouse RNA respectively in SOC liquid culture medium, and culture them overnight at 37°C and 200rpm / min. Take 1μL of bacterial solution from each of the 10 expanded cultured single colonies as a template, and perform bacterial solution PCR according to the scFv gene splicing PCR system. After electrophoresis of PCR products, analyze the results in a gel imager. The PCR identification results are as follows: Figure 5 shown.

[0098] 6. Construction of phage single-chain antibody library

[0099] Take 10 μL of recombinant E. coli culture liquid, inoculate it into 10 mL of 2×YT-AG medium, and culture it at 37°C and 160 rpm until the logarithmic phase (A600≈0.5). Then add helper phage M13K07 at a ratio of bacterial number / helper phage number = 1 / 20, infect at 37°C for 40 min, centrifuge at 12000 rpm for 20 min, discard the supernatant; then resuspend the precipitate with 100 mL of 2×YT-AG medium, and culture at 37°C and 160 rpm with shaking. The next day, the bacterial solution was collected, centrifuged at 12000rpm for 20min, the supernatant was collected, and added to PEG / NaCl solution with 1 / 5 volume of the supernatant, mixed and precipitated in an ice bath for 3h; centrifuged at 12000rpm for 20min at 4℃, the supernatant was discarded, the phage precipitate was resuspended with PBS buffer, filtered with a 0.45μm filter membrane for sterilization, packaged, and stored at 4℃ to obtain the phage single-chain antibody library. Take 100μL of the single-chain antibody library solution and dilute it 10 times for 3 consecutive times, take 10μL of the dilution and add it to 200μL of Escherichia coli E.coli TG1 with an OD600 of about 0.6, let it stand at 37℃ for infection for 30min, all of them were applied to solid culture medium, cultured at 37℃ overnight, and the plaques on the plate were counted the next day.

[0100] There are two types of phage single-chain antibody libraries, one is a phage single-chain antibody library constructed by RNA of mice immunized with neutrophil gelatinase-associated lipocalin antigen monomers, and the other is a phage single-chain antibody library constructed by RNA of mice immunized with neutrophil gelatinase-associated lipocalin antigen dimers.

[0101] The counting results showed that the titer of the phage single-chain antibody library constructed by RNA from mice immunized with neutrophil gelatinase-associated lipocalin antigen monomer was about 8.1×10 12 The titer of the phage single-chain antibody library constructed by RNA from mice immunized with neutrophil gelatinase-associated lipocalin antigen dimer was about 8.4×10 11 .

[0102] Example 4: Enrichment and screening of phage single-chain antibody library

[0103] 1. Dilute the recombinant neutrophil gelatinase-associated lipocalin antigen obtained in Example 1 to 1 μg / mL with PBS buffer and coat a 96-well plate at 4°C overnight (22 h); wash the plate with 350 μL of PBST per well and pat dry twice; wash each well with 200 μL of Block with BSA-PBS blocking solution at 4°C for 18h, add 350μL of PBST flushing solution to each well to wash the plate, pat dry, twice in a row; put the 96-well plate in a blower dryer to dry for 6h; take the phage single-chain antibody library solution, add 100μL / well to the 96-well plate, and incubate at 37°C for 1h; wash the plate 5 times with washing solution and pat dry; continue to add 100μL of Gly-HCl solution (pH=2.2), incubate at 37°C for 10min, then add 100μL of Tris-HCl (pH=7.4) to terminate the reaction, repeatedly blow and beat to obtain the first round of enrichment products of the phage antibody library; extract 100μL from the first round of enrichment products of the phage antibody library, inoculate in 10mL 2×YT-AG culture medium for the second round of enrichment and screening, and perform adsorption-elution-infection amplification according to the same method, and so on until the end of the fourth round.

[0104] Two clones with the strongest antigen affinity were selected for sequencing analysis for the monomeric single-chain antibody of neutrophil gelatinase-associated lipocalin and the dimer single-chain antibody of neutrophil gelatinase-associated lipocalin. The nucleotide sequences of the two monomeric single-chain antibodies of neutrophil gelatinase-associated lipocalin are shown in SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequences of the two dimer single-chain antibodies of neutrophil gelatinase-associated lipocalin are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0105] 2. The positive bacterial solution screened in step 1 above was expanded and cultured to extract plasmids, primers were designed according to the sequence information, and the target gene scfv was amplified using the plasmid as a template. The pET-22b plasmid was double-digested with endonucleases, and after gel recovery and purification, the scFv was connected to pET-22b using the homologous recombination method to construct the expression recombinant plasmid pET-22b-scFv. The recombinant plasmid pET-22b-scFv was transformed into Escherichia coli Rosetta (DE3) competent cells. After successful transformation, a single colony was randomly picked for expansion culture, and the monoclonal bacterial solution was sent for sequencing.

[0106] 3. The correctly sequenced bacterial solution was inoculated into 2×YT-A liquid culture medium at a ratio of 1:1000 and cultured at 37°C overnight; the next day, it was inoculated into 2×YT-A liquid culture medium at a ratio of 1:100, cultured at 37°C with shaking until OD600=0.4-0.6, and IPTG was added at a final concentration of 1mM, and cultured at 37°C and 160rpm with shaking for 24h. After the induction, centrifuged at 8000rpm for 20min, discarded the supernatant, and the precipitate was taken. The precipitate was resuspended in PBS buffer at a ratio of 1:10, blown evenly, and then repeatedly frozen and thawed 3 times, and used an ultrasonic crusher for 20min (ultrasound 5s, stop 5s), and after the crushing was completed, centrifuged at 10000r / min for 20min, and the supernatant was collected. This solution is the periplasmic cavity protein. The precipitate was resuspended with 8 mol / L urea at a ratio of 1:10, vortexed to mix, and centrifuged at 10,000 rpm for 20 min. The supernatant was collected. This solution was the inclusion body protein. The inclusion body protein and periplasmic cavity protein were analyzed by SDS-PAGE electrophoresis. It was found that the proteins were all present in the periplasmic cavity and expressed in a soluble form.

[0107] 4. Separation and purification of the recombinant protein: The specific steps are as follows: ① Add 10 mL of nickel to the purification column and wash the nickel column with 3-5 times the volume of deionized water; ② Equilibrate the nickel column; ③ Add the protein sample to the column, control the flow rate, and collect the flow-through; ④ Rinse the column with 10 times the column volume of Wash Buffer and collect the liquid; ⑤ Elute the impurities with an eluent of 50 mM imidazole concentration and elute the target protein with an imidazole concentration of 500 mM to obtain two neutrophil gelatinase-associated lipocalin monomers and two neutrophil gelatinase-associated lipocalin dimer single-chain antibodies.

[0108] The neutrophil gelatinase-associated lipocalin monomer single-chain antibody 1 was named M1, the neutrophil gelatinase-associated lipocalin monomer 2 was named M2, the neutrophil gelatinase-associated lipocalin dimer 1 was named D1, and the neutrophil gelatinase-associated lipocalin dimer 2 was named D2.

[0109] Example 5: Identification of Neutrophil Gelatinase-Associated Lipocalin Antibodies

[0110] 1. Antibody titer identification

[0111] Neutrophil gelatinase-associated lipocalin monomer single-chain antibodies M1 and M2 and neutrophil gelatinase-associated lipocalin dimer single-chain antibodies D1 and D2 were coated on ELISA plates respectively. After blocking with 5% BSA solution, the titer of the purified monoclonal antibodies was detected by indirect ELASA method. The samples containing the above antibodies were diluted in multiples, and PBS buffer was used as a negative control. 100 μL per well was added to the ELISA plate and incubated at 37°C for 1 hour. After washing with TBST buffer, a 1:5000 diluted HRP-labeled secondary antibody (Anti-M13 Antibody) was added, 100 μL per well, and incubated at 37°C for 1 hour. After washing with TBST buffer, TMB substrate was added to develop color for 20 minutes and the reaction was terminated. The OD was read by an ELISA reader. 450 The test results are shown in Table 6.

[0112] Table 6: Antibody titer test results

[0113]

[0114] 2. Evaluation of paired antibody sensitivity

[0115] The single-chain antibodies M1 and M2 screened in this experiment were used as coating antibodies and enzyme-labeled antibodies, respectively, and gradient dilution tests were performed on HNL / NGAL monomer antigens to determine the sensitivity of the single-chain antibodies to HNL / NGAL monomer antigens, and then the coating and enzyme-labeled antibodies were screened. The results are shown in Table 7.

[0116] Table 7: M1+M2 paired antibody sensitivity test results

[0117]

[0118] The single-chain antibodies D1 and D2 screened in this experiment were used as coating antibodies and enzyme-labeled antibodies, respectively, and gradient dilution tests were performed on HNL / NGAL homodimer antigens to determine the sensitivity of the single-chain antibodies to HNL / NGAL homodimer antigens, and then the coating and enzyme-labeled antibodies were screened. The results are shown in Table 8.

[0119] Table 8: D1+D2 paired antibody sensitivity test results

[0120]

[0121] As shown in Tables 7 and 8, the sensitivity of the M1 (coating) + M2 (enzyme labeling) antibody pair is 0.5 ng / ml, the sensitivity of the M1 (enzyme labeling) + M2 (coating) antibody pair is 1 ng / ml, the sensitivity of the D1 (coating) + D2 (enzyme labeling) antibody pair is 0.5 ng / ml, and the sensitivity of the D1 (enzyme labeling) + D2 (coating) antibody pair is 2 ng / ml. Therefore, the M1 single-chain antibody is suitable for coating antibodies, and M2 is suitable for enzyme labeling; the D1 single-chain antibody is suitable for coating antibodies, and D2 is suitable for enzyme labeling; the paired antibodies M1+M2 and D1+D2 have a detection sensitivity of 0.5 ng / ml for HNL / NGAL monomer antigen and dimer antigen, respectively, which is higher than the sensitivity of general detection kits.

[0122] Example 6: Evaluation of clinical application of neutrophil gelatinase-associated lipocalin antibodies

[0123] A total of 200 serum samples were collected in this test case, including 95 positive samples (acute kidney injury patients) and 105 negative tests; among the 95 patients with kidney injury, 43 had inflammation caused by bacterial infection. The samples were tested using the QuicKey-human neutrophil gelatinase-associated lipocalin (NGAL) enzyme-linked immunosorbent assay kit (Cat. No.: E-TSEL-H0003, Elabscience) for acute kidney injury, and the results showed that all 95 patients with acute kidney injury were positive, and all negative test results were negative. The above 95 positive samples were tested using the Bode Bio Neutrophil Apolipoprotein (HNL) Detection Kit (enzyme-linked immunosorbent assay) for bacterial inflammation infection, and the results showed that there were 43 patients with inflammation.

[0124] Using the paired antibodies described in Example 5 of the present invention, dilute the antibodies M1 and D1 to 0.5 μg / mL with a carbonate buffer solution at pH = 9.6, coat the ELISA plates separately, and incubate at 4°C overnight. Take out the ELISA plate the next day, wash once with TBST, and block with 5% BSA solution at 37°C for 2 hours; add the collected serum sample to each well and incubate at 37°C for 1 hour. After the incubation is completed, take out the ELISA plate, wash three times with TBST, add 100 μL of HRP-labeled M2 antibody and D2 antibody (1:5000 dilution), respectively, and incubate at 37°C for 1 hour. Wash five times with TBST, add TMB substrate, and develop color at 37°C for 20 minutes. After taking out, add the stop solution and measure the OD on the ELISA instrument 450 The readings and test results are shown in Tables 9 and 10.

[0125] Table 9: Clinical performance verification effect - patients with renal impairment

[0126]

[0127] Table 10: Clinical performance verification results - renal impairment patients with bacterial infection

[0128]

[0129] It can be seen from Table 9 and Table 10 that the positive coincidence rate of the neutrophil gelatinase-associated lipocalin antibody prepared by the present invention reached 100%.

[0130] In summary, the neutrophil gelatinase-associated lipocalin genetic engineering antibody prepared by the present invention has higher specificity and is less likely to cross-react compared with the neutrophil gelatinase-associated lipocalin polyclonal antibody. And the preparation method provided by the present invention is simple and fast in preparation process compared with the neutrophil gelatinase-associated lipocalin monoclonal antibody. The neutrophil gelatinase-associated lipocalin antibody prepared by phage display technology can be used to prepare diagnostic reagents and therapeutic drugs for detecting abnormal expression of neutrophil gelatinase-associated lipocalin antibodies and related diseases.

Claims

1. A neutrophil gelatinase-associated lipocalin antibody composition, characterized in that: The neutrophil gelatinase-associated lipocalin antibody composition is composed of a neutrophil gelatinase-associated lipocalin monomer single-chain antibody M1 and a neutrophil gelatinase-associated lipocalin monomer single-chain antibody M2; or is composed of a neutrophil gelatinase-associated lipocalin dimer single-chain antibody D1 and a neutrophil gelatinase-associated lipocalin dimer single-chain antibody D2; The neutrophil gelatinase-associated lipocalin monomer single-chain antibody M1 is composed of a heavy chain variable region, a flexible peptide segment, and a light chain variable region, and the connection order is heavy chain variable region-flexible peptide segment-light chain variable region, and its nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.5; The neutrophil gelatinase-associated lipocalin monomer single-chain antibody M2 is composed of a heavy chain variable region, a flexible peptide segment, and a light chain variable region, and the connection order is heavy chain variable region-flexible peptide segment-light chain variable region, and its nucleotide sequence is shown in SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.6; The neutrophil gelatinase-associated lipocalin dimer single-chain antibody D1 is composed of a heavy chain variable region, a flexible peptide segment, and a light chain variable region, and the connection order is heavy chain variable region-flexible peptide segment-light chain variable region, and its nucleotide sequence is shown in SEQ ID NO.3, and its amino acid sequence is shown in SEQ ID NO.7; The neutrophil gelatinase-associated lipocalin dimer single-chain antibody D2 consists of a heavy chain variable region, a flexible peptide segment, and a light chain variable region, and the connection order is heavy chain variable region-flexible peptide segment-light chain variable region. Its nucleotide sequence is shown in SEQ ID NO.4, and its amino acid sequence is shown in SEQ ID NO.8.

Images