A drought-resistance gene CrWRKY40, its amplification method, and its application in improving plant drought resistance.
By providing the drought-resistant gene CrWRKY40 and its amplification method and gene silencing technology, the problem of improving the stress resistance of citrus and other plants under drought conditions has been solved, the drought resistance of plants has been improved and water consumption has been reduced, and the development of green agriculture and water-saving agriculture has been supported.
Patent Information
- Application Number
- CN202410684304.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-30
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-05-30
AI Technical Summary
The lack of effective drought-resistant gene screening in existing technologies fails to meet the needs of improving the stress resistance of plants such as citrus under drought conditions, thus limiting the development of the citrus industry.
This study provides the drought-resistant gene CrWRKY40 and its amplification method. CrWRKY40 is expressed or overexpressed in plants using PCR amplification and gene silencing techniques. Target plants are then transformed using recombinant vectors to enhance or reduce their drought resistance.
It improves the drought resistance of plants, reduces water consumption, lowers production costs, and at the same time eliminates the food safety risks associated with genetically modified organisms (GMOs), making it easily acceptable to the public and providing new genetic resources to support green and water-saving agriculture.
Smart Images

Figure CN118667831B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a drought-resistant gene CrWRKY40, its amplification method, and its application in improving plant drought resistance. Background Technology
[0002] Drought, caused by insufficient rainfall leading to soil moisture loss, is one of the most severe types of natural disasters in the world. Globally, the losses to agriculture and society caused by drought are equivalent to the sum of all other natural disasters. Citrus is one of the world's most important fruit trees, ranked first among the world's four major fruits. China is the origin and main production area of citrus, with a long history of cultivation. In my country, citrus is mostly cultivated in hilly and mountainous areas with harsh growing environments and poor drought resistance, making it more susceptible to the impact of drought. Water is one of the main limiting factors for obtaining high-yield and high-quality products. Therefore, improving the drought resistance of citrus and achieving high-quality and high-yield production has become a crucial issue.
[0003] Drought not only severely limits the cultivation range of citrus but is also a major abiotic factor restricting the development of the citrus industry. Therefore, cultivating new drought-resistant citrus varieties is extremely important for the sustainable, stable, and healthy development of the citrus industry. The rapid development of biotechnology has provided new avenues for plant breeding. Genetic engineering allows for targeted genetic improvement of crops and has already demonstrated significant value in cultivating new stress-resistant crop varieties (materials). Discovering and identifying stress-resistant genes is a prerequisite and key to creating stress-resistant plants using genetic engineering; however, the current screening quantity for drought-resistant genes is still very limited and cannot meet the needs of scientific research and production. Summary of the Invention
[0004] The purpose of this invention is to provide a drought-resistant gene CrWRKY40, an amplification method, and its application in improving plant drought resistance. This provides new gene resources for molecular design breeding of plant stress resistance, and new genetic resources for implementing green agriculture and water-saving agriculture, which is conducive to reducing agricultural production costs and achieving environmental friendliness.
[0005] The present invention provides a drought-resistant gene CrWRKY40, the nucleotide sequence of which is shown in SEQ ID No.1.
[0006] The present invention also provides the protein encoded by the drought-resistant gene CrWRKY40.
[0007] Preferably, the amino acid sequence of the protein is shown in SEQ ID No. 2.
[0008] The present invention also provides a set of primer pairs for amplifying the above-mentioned drought-resistant gene CrWRKY40, including an upstream primer with a nucleotide sequence such as SEQ ID No. 3 and a downstream primer with a nucleotide sequence such as SEQ ID No. 4.
[0009] The present invention also provides a method for amplifying the drought-resistant gene CrWRKY40 using the above primer pair, comprising the following steps: using the nucleic acid molecule of citrus as a template, preparing the template and primer pair into a PCR amplification system for PCR amplification to obtain the drought-resistant gene CrWRKY40.
[0010] Preferably, the PCR amplification program includes: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.
[0011] This invention also provides the application of the above-mentioned drought-resistant gene CrWRKY40, the above-mentioned protein, or the drought-resistant gene CrWRKY40 amplified by the above-mentioned method in improving plant drought resistance.
[0012] The present invention also provides a method for improving plant drought resistance, including expressing or overexpressing the drought resistance gene CrWRKY40 or the drought resistance gene CrWRKY40 amplified by the above method in the target plant.
[0013] This invention also provides the application of the above-mentioned drought-resistant gene CrWRKY40, the above-mentioned protein, or the drought-resistant gene CrWRKY40 amplified by the above-mentioned method in the cultivation of germplasm of different drought-resistant crops.
[0014] Preferably, the target plant is transformed with a recombinant vector that overexpresses or interferes with the drought-resistant gene CrWRKY40 to obtain plants with enhanced or reduced drought resistance.
[0015] Beneficial effects: This invention provides a drought-resistant gene CrWRKY40, which belongs to the WRKY family. Its nucleotide sequence is shown in SEQ ID No.1, and the amino acid sequence of the encoded protein is shown in SEQ ID No.2. It contains a 957bp open reading frame (ORF) that encodes 318 amino acids, has an isoelectric point of 8.35, and a predicted molecular weight of 35.29kDa.
[0016] According to the embodiments of the present invention Figure 1The procedure shown describes the isolation and cloning of the drought-resistant gene CrWRKY40 from the extremely drought-resistant variety Sanhu Red Orange. After obtaining the full length of the drought-resistant gene CrWRKY40, its expression in Sanhu Red Orange was interfered with by transiently overexpressing tobacco and by virus-mediated gene silencing (VIGS) technology. The resulting transgenic plants were verified by biological function testing. The transiently overexpressed tobacco plants showed enhanced drought resistance, while the plants with interfered expression showed significantly reduced drought resistance, indicating that the CrWRKY40 gene cloned in this invention has drought-resistant function.
[0017] The drought-resistant gene CrWRKY40 can effectively improve the drought tolerance of plants, significantly reducing water consumption and production costs. It can also be used to improve fruit tree rootstock materials, poses no genetically modified food safety risks, and is easily accepted by the public. By introducing this gene into plants through Agrobacterium-mediated transformation and identifying its function under drought or in vitro dehydration conditions, this study provides new genetic resources for molecular breeding of drought-resistant plants and for implementing green and water-saving agriculture. Attached Figure Description
[0018] Figure 1 This is a flowchart illustrating the technical process of the present invention.
[0019] Figure 2 This is a schematic diagram of the CrWRKY40 gene cloning of the present invention;
[0020] Figure 3 This is a diagram illustrating the expression pattern of the CrWRKY40 gene in this invention.
[0021] Figure 4 This is a schematic diagram illustrating the analysis of yeast single-hybridization results of the CrWRKY40 gene and CrWRKY57 promoter of the present invention;
[0022] Figure 5 This is a schematic diagram illustrating the dual-luciferase activity detection of the CrWRKY40 gene and CrWRKY57 promoter according to the present invention.
[0023] Figure 6 This is a schematic diagram of the subcellular localization fluorescence of the CrWRKY40 gene in this invention;
[0024] Figure 7 This is a schematic diagram illustrating the identification of CrWRKY40 transcriptional activation in this invention;
[0025] Figure 8 This is a schematic diagram of the semi-quantitative (A) and quantitative (B) analysis of CrWRKY40-VIGS according to the present invention;
[0026] Figure 9 This is a schematic diagram of the drought phenotype of CrWRKY40-VIGS of the present invention;
[0027] Figure 10 This is a schematic diagram of the observation of stomatal density and aperture of the CrWRKY40-VIGS leaves of the present invention; (A) shows the stomatal density observation of TRV control and TRV-CrWRKY40; (B) shows the comparison of stomatal density of TRV control and TRV-CrWRKY40; (C) shows the stomatal aperture observation of TRV control and TRV-CrWRKY40 under dehydration conditions; (D) shows the comparison of stomatal diameter of TRV control and TRV-CrWRKY40.
[0028] Figure 11 Figure 1 shows a schematic diagram of the palisade and spongy tissue of the CrWRKY40-VIGS leaf of the present invention; Figure 2 shows a microstructure of the TRV control leaf; Figure 3 shows a microstructure of the TRV-CrWRKY40 leaf; Figure 4 shows a comparative analysis of the palisade tissue of TRV and TRV-CrWRKY40 leaves; Figure 5 shows a comparative analysis of the spongy tissue of TRV and TRV-CrWRKY40 leaves; Figure 6 shows a palisade-to-spongy ratio analysis of TRV and TRV-CrWRKY40 leaves.
[0029] Figure 12 This is a schematic diagram illustrating the analysis of the root system (A), main root length (B), and number of lateral roots (C) of the CrWRKY40-VIGS of the present invention.
[0030] Figure 13 This is a diagram showing the phenotypic observation and analysis of *Tobacco Benedict* before and after drought following transient transformation with overexpression of the CrWRKY40 gene, as presented in this invention.
[0031] Figure 14 This is a graph showing the relative conductivity of tobacco before and after in vitro dehydration following transient transformation with overexpression of the CrWRKY40 gene, according to the present invention. Detailed Implementation
[0032] The present invention provides a drought-resistant gene CrWRKY40, the nucleotide sequence of which is shown in SEQ ID No.1.
[0033] The sequence shown in SEQ ID No. 1 of this invention is a 957 bp open reading frame, and the drought-resistant gene CrWRKY40 is located in the cell nucleus. The drought-resistant gene CrWRKY40 of this invention possesses transcriptional activation activity, and the self-activation activity is located at the N-terminus.
[0034] The present invention also provides the protein encoded by the drought-resistant gene CrWRKY40.
[0035] The protein described in this invention encodes a total of 318 amino acids, with a preferred sequence as shown in SEQ ID No. 2. The protein CrWRKY40 encoded by the drought-resistant gene CrWRKY40 of this invention has a theoretical isoelectric point of 8.35 and a predicted molecular weight of 35.29 kDa.
[0036] The present invention also provides a set of primer pairs for amplifying the above-mentioned drought-resistant gene CrWRKY40, including an upstream primer with a nucleotide sequence such as SEQ ID No. 3 and a downstream primer with a nucleotide sequence such as SEQ ID No. 4.
[0037] The primer pairs described in this invention are preferably designed based on the sequence of the sweet orange CrWRKY40 gene, and the primer pair sequences are shown below:
[0038] Upstream primer (SEQ ID No. 3): 5'-TTTACTTGGCTTTGTGGGTTTGC-3';
[0039] Downstream primer (SEQ ID No. 4): 5'-TTAGGTAAATAACTTTGTTCTGCCA-3'.
[0040] The present invention also provides a method for amplifying the drought-resistant gene CrWRKY40 using the above primer pair, comprising the following steps: using the nucleic acid molecule of citrus as a template, preparing the template and primer pair into a PCR amplification system for PCR amplification to obtain the drought-resistant gene CrWRKY40.
[0041] In this embodiment of the invention, cDNA from Sanhu red orange is preferably used as a template, and PCR amplification is performed using the above-mentioned primer pair to obtain the drought resistance gene CrWRKY40. The PCR amplification system of this invention, in 50 μL, preferably includes: 1-5 TM The PCR amplification program of this invention includes: 25 μL of 2× High-Fidelity MasterMix, 2 μL each of forward and reverse primers (10 μM), 1 μL of template cDNA, and 20 μL of sterile water. The program consists of: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 20 s, 35 cycles; and 72℃ extension for 10 min.
[0042] The cDNA template used in this invention is preferably obtained by reverse transcription of RNA extracted from leaves. In the example, total RNA was extracted from the leaves of Sanhu Red Orange using the RNAiso Plus kit (the kit was purchased from TAKARA, and the operation method was in accordance with the instructions). The extracted Sanhu Red Orange RNA was used to synthesize the first strand of cDNA according to the operation manual of the TOYOBO reverse transcription kit.
[0043] This invention provides primer sequence pairs for quantitative PCR of the drought-resistant gene CrWRKY40, as shown in SEQ ID NO. 5 and SEQ ID NO. 6, and primer sequence pairs for the internal reference gene, as shown in SEQ ID NO. 7 and SEQ ID NO. 8. The primer sequences are as follows:
[0044] Actin-F (SEQ ID NO.5): 5'-CATCCCTCAGCACCTTCC-3'
[0045] Actin-R (SEQ ID NO.6): 5'-CCAACCTTAGCACTTCTCC-3'
[0046] qRT-PCR-F (SEQ ID NO.7): 5'-GCGAAGAAAGAATTGCAAGG-3'
[0047] qRT-PCR-R (SEQ ID NO.8): 5'-TGCTTTCGGATTTTCGTTTC-3'
[0048] This invention also provides the application of the above-mentioned drought-resistant gene CrWRKY40, the above-mentioned protein, or the drought-resistant gene CrWRKY40 amplified by the above-mentioned method in improving plant drought resistance.
[0049] In this invention, drought stress can induce the expression of the drought-resistance gene CrWRKY40, indicating that CrWRKY40 is a drought-response gene. In this invention, the drought resistance traits of the drought-resistance gene CrWRKY40 in transgenic plants were compared using virus-mediated gene silencing technology. It was found that transgenic plants with silenced CrWRKY40 exhibited significantly reduced drought resistance, indicating that silencing the drought-resistance gene CrWRKY40 reduces plant drought resistance. The plant used in this invention is preferably Sanhu Red Orange. In another embodiment of this invention, transient overexpression of tobacco was verified to enhance drought resistance.
[0050] This invention also provides a method for improving plant drought resistance, comprising expressing or overexpressing the drought-resistant gene CrWRKY40 in the target plant, or amplifying the drought-resistant gene CrWRKY40 using the above method. In this invention, transient transformation of Nicotiana benthamiana into plants overexpressing the CrWRKY40 gene is used. After drought treatment, Nicotiana benthamiana plants overexpressing the CrWRKY40 gene exhibit stronger drought resistance.
[0051] The present invention also provides a method for improving plant drought resistance, including expressing or overexpressing the drought resistance gene CrWRKY40 or the drought resistance gene CrWRKY40 amplified by the above method in the target plant.
[0052] This invention also provides the application of the above-mentioned drought-resistant gene CrWRKY40, the above-mentioned protein, or the drought-resistant gene CrWRKY40 amplified by the above-mentioned method in the cultivation of germplasm of different drought-resistant crops.
[0053] In preferred embodiments of this invention, the recombinant vector used to interfere with the drought-resistance gene CrWRKY40 is transformed into target plants to obtain plants with reduced drought resistance. The base vector of the recombinant vector preferably includes a pTRV1 or pTRV2 vector, such as inserting the drought-resistance gene CrWRKY40 between the EcoRI and BamHI sites in the pTRV2 vector. Preferably, the recombinant vector is transferred into the plant genome, and the drought-resistance gene CrWRKY40 is interfered with using a transient transformation method to obtain plants with reduced drought resistance.
[0054] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a drought-resistant gene CrWRKY40, its amplification method, and its application in improving plant drought resistance, is provided by the present invention, but should not be construed as limiting the scope of protection of the present invention.
[0055] Example 1
[0056] The isolation and cloning of CrWRKY40 is carried out as follows:
[0057] 1. First, total RNA was extracted from the leaves of Sanhu Red Orange using the RNAiso Plus kit (kit purchased from TAKARA, operation method according to the instructions). The extracted Sanhu Red Orange RNA was then used to synthesize the first strand of cDNA according to the TOYOBO reverse transcription kit manual.
[0058] 2. Based on the sequence of the sweet orange CrWRKY40 gene (orange1.1t02759.1), the forward and reverse primers shown in SEQ ID No. 3 and SEQ ID No. 4 were designed using PrimerPremier5.0 to form amplification primer pairs.
[0059] 3. Using the cDNA of Sanhu red mandarin orange as a template, CrWRKY40 of Sanhu red mandarin orange was amplified by PCR.
[0060] The PCR amplification system is: 1-5 TM 25 μL of 2×High-FidelityMasterMix, 2 μL each of forward and reverse primers (10 μM), 1 μL of template cDNA, and 20 μL of sterile water.
[0061] PCR was performed according to the following procedure: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 20 s, 35 cycles, followed by 72℃ extension for 10 min after each cycle.
[0062] 4. After PCR amplification, electrophoresis was performed on a 1.2% agarose gel in a DYY-6C electrophoresis apparatus (Liuyi, Beijing) with 1XTAE buffer for 30 min, with parameters set to 120V and 150mA. The target band was excised under UV light and the specific target band was recovered using an Axygen gel recovery kit (purchased from Corning Life Sciences Co., Ltd.), following the manufacturer's instructions.
[0063] 5. The purified product was then ligated into the pMD18-T vector (Takara, Japan).
[0064] The ligation system consisted of 0.5 μL pMD18-T Vector, 5 μL Solution I, and 4.5 μL of purified PCR product. Ligation was performed overnight at 16°C. The resulting cells were then transformed into competent DH 5α cells of *E. coli* (Beijing TransGen Biotech Co., Ltd.) using a heat shock method. Positive clones were selected using the aforementioned amplification primers and validated by PCR (using the same PCR procedure as described above for gene amplification) and sequenced (performed by Wuhan Qingke Xinyue Biotechnology Co., Ltd.).
[0065] The above operations amplified a 1347 bp fragment. Open reading frame prediction using the ORF Finder on NCBI revealed a 957 bp coding region encoding a 318-amino acid protein with a molecular weight of 35.29 kDa, a theoretical isoelectric point of 8.35, an instability coefficient of 43.25 (indicating an unstable protein), a lipid index of 62.86, and an overall average hydrophilicity of -0.769 (indicating a hydrophilic protein). The ORF sequence is shown in SEQ ID No. 1, and the encoded protein sequence is shown in SEQ ID No. 2.
[0066] Example 2
[0067] The steps for analyzing the expression pattern of the CrWRKY40 gene are as follows:
[0068] 1. RNA was extracted from the roots, stems, and leaves of two-month-old wild-type Sanhu red mandarin orange seedlings and reverse transcribed into cDNA. The expression level of the CrWRKY40 gene in the roots, stems, and leaves was analyzed by real-time quantitative PCR. The results are as follows: Figure 2 As shown, the CrWRKY40 gene is expressed in roots, stems and leaves, with the highest expression level in leaves.
[0069] 2. Two-month-old wild-type Sanhu red orange seedlings were treated with 100 μmol / L ABA, dehydration, and 100 μmol / L fluazinam + dehydration at 0, 6, 12, and 24 h.
[0070] 3. After sampling at each time point, RNA was extracted and reverse transcribed into cDNA. The expression level of the CrWRKY40 gene was analyzed by real-time quantitative PCR, using citrus Actin as an internal reference gene. The results are as follows: Figure 3 As shown, under 100 μmol / L ABA treatment, the expression of the CrWRKY40 gene was significantly upregulated at 12 h. After 6 h of dehydration treatment, the expression of the CrWRKY40 gene was significantly induced. The highest expression level of the CrWRKY40 gene was observed at 6 h under 100 μmol / L fluazinam and dehydration treatments, indicating that the CrWRKY40 gene can respond to ABA and dehydration induction. The primer sequence pairs for quantifying the internal reference gene Actin and CrWRKY40 include: the forward primer for the internal reference gene (SEQ ID No. 5) and the reverse primer for the internal reference gene (SEQ ID No. 6); the forward primer for quantifying CrWRKY40 (SEQ ID No. 7) and the reverse primer for quantifying CrWRKY40 (SEQ ID No. 8).
[0071] Example 3
[0072] The interaction between CrWRKY40 and CrWRKY57 promoters (Cs7g03080) follows these steps:
[0073] 1. First, the W-box fragment of the CrWRKY57 promoter (SEQ ID No. 20: GGTCAAGGTCAAGGTCAA) was inserted into the pAbAi vector (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product code P0232) to construct the pAbAi-CrWRKY57 bait vector (Bait). The full-length CrWRKY40 gene was inserted into the pGADT7 vector (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product code P1217) to construct the pGADT7-CrWRKY40 prey vector (Prey).
[0074] 2. The pAbAi-CrWRKY57 bait vector was linearized by BstBI digestion and transformed into yeast Y1HGold competent cells, which were then cultured on SD / -Ura deficient medium (purchased from Wuhan Diyue Innovation Biotechnology Co., Ltd.). The lowest concentration of AbA that inhibited AbA growth was selected through screening.
[0075] 3. Use positive bait to create competent yeast cells and transform them into Prey.
[0076] 4. Interaction detection was performed by spotting on SD / -Leu defective culture medium.
[0077] The results are as follows Figure 3 As shown, pAbAi-CrWRKY57 and pGADT7-CrWRKY40 were co-transformed in yeast and could grow on 500 ng / μL SD / -Leu, indicating an interaction between them.
[0078] Example 4
[0079] Detection of dual-luciferase activity of CrWRKY40 gene and CrWRKY57 promoter
[0080] 1. Vector Construction: The coding region of the CrWRKY40 gene (with the stop codon removed) was inserted between the EcoRI and XhoI restriction sites on the pGreenII-62-SK vector (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product code P0465). The sequence containing the W-box fragment on the CrWRKY57 promoter was inserted between the KpnI and XhoI restriction sites on the pGreenII 0800-LUC vector (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product code P0464). After successful sequencing, the plasmid was extracted and transformed into Agrobacterium GV3101 (p19). The primer sequences used are as follows:
[0081] 62SK-WRKY40-EcoRI-F:(SEQ ID No9):TCCCCCGGGCTGCAGGAATTCATGGATTCTTTTTCATGGGTTG
[0082] 62SK-WRKY40-XhoI-R:(SEQ ID No10):GGTACCGGGCCCCCCCTCGAGTCACCATTTCTCTCTCGGATTATGT
[0083] 2. Agrobacterium transient transformation and injection into Nicotiana benthamiana: The constructed positive vector GV3101(p19) Agrobacterium was activated and subjected to large-scale shaking in LB liquid medium containing the appropriate antibiotic (at a ratio of 1:100). OD was measured using a spectrophotometer. 600 The bacterial cells were collected by centrifugation when the pH was between 0.6 and 0.8. The cells were then resuspended in washing buffer, and the transcription factor and promoter culture were mixed at an 8:2 ratio. The volume was then brought to 10 mL with washing buffer containing 150 μmol / LAs. After dark incubation for 2-3 hours, tobacco was injected, using the mixture of empty vector and promoter culture as a control.
[0084] 4. Dual-luciferase activity assay:
[0085] (1) Select the injected leaves from the above-mentioned injected tobacco leaves, take out a uniform number of leaf discs, grind them into powder with liquid nitrogen, transfer them to centrifuge tubes for centrifugation, and collect the supernatant and store it on ice for later use.
[0086] (2) Mix the supernatant with Passive Lysis Buffer in equal proportion on a white microplate, then add Lucifause Assay Mix, mix well, let stand for 10 min, and then measure the LUC value.
[0087] (3) After measuring the LUC value, add 100 μL of Stop Glo ReagentMix and mix quickly. After standing for 10 min, measure the REN value of Renal luciferase.
[0088] (4) Finally, calculate the ratio of LUC / REN.
[0089] The results are as follows Figure 5 As shown, the dual-luciferase activity of the CrWRKY40 gene was significantly higher than that of the control, indicating that the CrWRKY40 gene can positively regulate the expression of CrWRKY57.
[0090] Example 5
[0091] Subcellular localization of the CrWRKY40 gene, following these steps:
[0092] ExPASy online analysis results showed that the CrWRKY40 protein sequence has a nuclear localization signal. In this embodiment, the transient expression of Nicotiana benthamiana and the plant subcellular localization vector pBI121-EGFP (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product code P19691) were used to study the subcellular localization of CrWRKY40.
[0093] Subcellular localization primers were designed to amplify the ORF sequence of the CrWRKY40 gene and insert it between the Xba I and Sma I restriction sites on the pBI121-EGFP vector.
[0094] Subcellular localization primers:
[0095] Forward primer (SEQ ID No. 11): 5'-gagaacacgggggacTCTAGAATGGATTCTTTTTCATGGGTTG-3';
[0096] Reverse primer (SEQ ID No. 12): 5'-GCTCACCATGGTACCCCCGGGCCATTTCTCTCTCGGATTATGTTGA-3'.
[0097] The amplification system is: 1-5 TM25 μL of 2×High-Fidelity MasterMix (Qingke Xinyue Biotechnology Co., Ltd.), 2 μL each of forward and reverse primers, 1 μL of Sanhu Red Orange cDNA from Example 1, and 20 μL of ddH2O.
[0098] The amplification PCR program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, followed by 72℃ extension for 10 min after each cycle.
[0099] After PCR amplification, all PCR products were loaded onto a 1.2% agarose gel for electrophoresis. The specific target band was recovered using an Axygen gel extraction kit (Corning Life Sciences, Inc.), following the manufacturer's instructions. The recovered products were then ligated. Carrier (Full-Type Gold, Beijing), connection system is -Blunt Cloning Vector 1μL, PCR purified product 4μL.
[0100] After ligation at 50°C for 30 min using a PCR instrument, the ligation solution was introduced into competent E. coli DH 5α cells (Beijing TransGen Biotech Co., Ltd.) through heat excitation. Positive clones were selected using primers for the target gene sequence for PCR verification (consistent with the PCR procedure used when constructing the vector). Sequencing was then performed by Wuhan Qingke Xinyue Biotechnology Co., Ltd.
[0101] The pBI121-EGFP empty vector plasmid was digested with restriction enzymes Xba I and Sma I. The double digestion system was as follows: Xba I 1 μL, Sma I 1 μL, 10xrCutSmart Buffer 5 μL, plasmid DNA 1 μg, and sterile water to a final volume of 50 μL.
[0102] The double enzyme digestion system was performed at 37℃ for 3 hours. Qualified bands were detected by agarose gel electrophoresis, and the target band was recovered using a gel extraction kit. The pBI121-EGFP empty vector plasmid, after double digestion with Xba I and Sma I, was ligated with T4 DNA Ligase to obtain the 35S-CrWRKY40-pBI121-EGFP recombinant vector, which was then transformed into Agrobacterium competent cells GV3101 (Weidi Biotechnology Co., Ltd., Shanghai). Transformation procedures are described in the instruction manual.
[0103] The location of the CrWRKY40 gene was detected using a transient expression transformation method in *Nicotiana benthamiana*. The transient expression steps in *Nicotiana benthamiana* are as follows:
[0104] (1) Bacterial activation: Add 10 μL of cryopreserved Agrobacterium (35S-CrWRKY40-pBI121-EGFP and pBI121-EGFP Agrobacterium) and 1 mL of liquid LB (50 mg / L Kan, 25 mg / L Rif) to a 2.0 mL sterile centrifuge tube and incubate at 28℃ and 225 r / m for 16–18 h.
[0105] (2) Bacterial culture expansion: Take 300 μL of activated bacterial culture and add it to 30 mL of liquid LB (50 mg / L Kan, 25 mg / L Lf), and incubate in a shaker at 28℃ and 225 r / m for 12–16 h until the bacterial culture reaches OD. 600 The value is around 0.6.
[0106] (3) Collection and washing of bacterial culture: Collect bacterial culture by centrifugation at 4000 r / m for 5 min using a 50 mL centrifuge tube, discard the supernatant, and then wash with 5 mL of washing solution (10 mmol / L MgCl2, 10 mmol / L ES, 150 μmol / L LAs, pH = 5.6).
[0107] (4) Determination of bacterial suspension OD value: Discard the supernatant, add an appropriate amount of washing solution to resuspend the bacterial suspension, and adjust the bacterial suspension OD value. 600 The value is approximately 0.6. Let it stand in the dark at room temperature for 2–3 hours.
[0108] (5) Injection: Select tobacco leaves that have grown for about 4 weeks, and inject the bacterial solution from the back of the leaves using a disposable syringe with the needle removed. Both the experimental group and the control group were injected with 2-3 leaves and cultured in the greenhouse for 2 days. Two days later, 10 μg / mL DAPI staining solution (Beijing Lanjie Keke Co., Ltd.) was injected into the leaves from the back of the tobacco leaves. Fluorescence was then observed using a confocal microscope.
[0109] The results are as follows Figure 6 As shown, the pBI121-EGFP-CrWRKY40 binary vector represents the 35S-CrWRKY40-pBI121-EGFP fusion protein. The fluorescence of the empty vector pBI121-EGFP is distributed throughout the cell, including the cell membrane and nucleus, while the fluorescence of the 35S-CrWRKY40-pBI121-EGFP fusion protein is concentrated only in the nucleus, indicating that the CrWRKY40 gene is located in the nucleus.
[0110] Example 6
[0111] The steps for analyzing the transcriptional self-activation activity of CrWRKY40 are as follows:
[0112] Recombinant construction was performed using the pGBKT7 vector (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product code P0227) to verify whether CrWRKY40 possesses transcriptional autoactivation activity. NCBI predicts that the WRKY domain of the CrWRKY40 protein is distributed between amino acids 163th and 221st, presumably representing the transcriptional activation region. Therefore, in addition to the full-length amino acid sequence of CrWRKY40, CrWRKY40 was divided into three segments based on the WRKY domain: CrWRKY40-1 (1th-162th amino acids), CrWRKY40-2 (163th-221st amino acids), and CrWRKY40-3 (222th-318th amino acids), as shown below. Figure 5 The upper-middle side figure shows the results. The open reading frame (ORF) of the CrWRKY40 gene and the gene fragments encoding CrWRKY40-1, CrWRKY40-2, and CrWRKY40-3 were ligated into the pGBKT7 vector (inserted between the EcoRI and BamHI sites). After sequencing confirmation, the four fusion expression vectors and the empty vector (pGADT7) were co-transformed into yeast strain Y2HGold (Shanghai Angyu Biotechnology Co., Ltd.). The strains were then cultured on three different deletion media: SD / -Leu / -Trp (leucine and tryptophan deficiency), SD / -Leu / -Trp / -Ade / -His (leucine, tryptophan, adenine, and histidine deficiency), and SD / -Leu / -Trp / -Ade / -His + X-α-gal (leucine, tryptophan, adenine, and histidine deficiency + yeast galactosidase chromogenic substrate deficiency). The results are shown below. Figure 7 As shown, yeast cells transformed with the empty vector and cells transformed with the four fusion vectors could grow on the deletion medium SD / -Leu / -Trp. However, only the full-length and N-terminal cells could grow and turn blue on the deletion media SD / -Leu / -Trp / -Ade / -His and SD / -Leu / -Trp / -Ade / -His+X-α-gal, indicating that CrWRKY40 has transcriptional self-activation activity, and the self-activation activity is located at the N-terminus.
[0113] Example 7
[0114] The construction of the CrWRKY40 virus-induced gene silencing (VIGS) vector is as follows:
[0115] VIGS vector construction
[0116] To obtain transgenic plants with the CrWRKY40 gene silenced, recombination was performed using the pTRV2 vector. First, primers were designed to amplify the 5' end 300 bp fragment of the CrWRKY40 gene, and then inserted between the EcoRI and BamHI sites on the pTRV2 vector. The vector primer sequences are as follows:
[0117] Forward primer (SEQ ID NO.13): 5'-GTGAGTAAGGTTACCGAATTCATGGATTCTTTTTCATGGGTTG-3';
[0118] Reverse primer (SEQ ID NO.14): 5'-CGTGAGCTCGGTACCGGATCCATCAAAAAGCTCCTTACTAATCTCA-3';
[0119] PCR amplification system: 1-5 TM 25 μL of 2×High-Fidelity Master Mix (Qingke Xinyue Biotechnology Co., Ltd.), 2 μL each of forward and reverse primers, 2 μL of cDNA from Sanhu Red Orange in Example 1, and 19 μL of ddH2O.
[0120] The amplification PCR program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, followed by 72℃ extension for 10 min after each cycle.
[0121] The PCR products were recovered by gel extraction, and the pTRV2 vector plasmid was recovered after double enzyme digestion.
[0122] The recovered target fragment and vector were ligated, with a total ligation reaction volume of 10 μL: 5 μL of 2xClonexpressiveMix; 1 μL of pTRV2 vector; 4 μL of target fragment; and ligation was performed in a PCR instrument at 50℃ for 30 min.
[0123] The ligation product was then transformed into *E. coli* DH 5α, and screened on LB agar plates containing 50 mg / L kanamycin. Single clones that tested positive by PCR were sent to Wuhan Qingke Xinyue Biotechnology Co., Ltd. for sequencing. Sequencing confirmed that the reading frame was completely correct, indicating successful construction of the pTRV2-CrWRKY40 recombinant vector. The recombinant vector and helper plasmid pTRV1 were then introduced into *Agrobacterium tumefaciens* GV3101 using a freeze-thaw method, and the bacterial culture was stored at -80°C (containing 50% glycerol).
[0124] Example 8
[0125] Application of transcription factor CrWRKY40 in drought resistance of Sanhu red orange
[0126] The VIGS vector from Example 7 was introduced into Sanhu Red Orange via Agrobacterium-mediated transformation to verify whether silencing the CrWRKY40 gene would reduce the drought resistance of Sanhu Red Orange.
[0127] 1. The steps for Agrobacterium-mediated VIGS infection and identification of positive plants are as follows:
[0128] (1) Sowing
[0129] Take Sanhu red orange seeds, soak them in 1M NaOH solution for 15 minutes to remove pectin, disinfect them with 2.5% NaClO solution for 15 minutes, rinse them three to four times with sterile water, spread them flat on gauze, and place them in a 28℃ incubator to germinate. Keep the environment humid. Once the seeds have germinated to 2-3 cm, they can be used for the VIGS silencing experiment.
[0130] (2) Preparation of Agrobacterium infection solution
[0131] The activation, expansion culture, collection, and washing of Agrobacterium tumefaciens suspensions of pTRV1, pTRV2, and pTRV2-CrWRKY40 were performed as in Example 5, with an appropriate amount of washing solution added to resuspend the suspensions and adjust the OD of the suspensions to 90%. 600 The concentration is approximately 1.0. Then, pTRV1 and pTRV2 bacterial suspensions are mixed in a 1:1 ratio, and pTRV1 and pTRV2-CrWRKY40 bacterial suspensions are mixed in the same ratio. The pTRV1 bacterial suspension assists in the expression of the pTRV2 bacterial suspension. After standing in the dark at room temperature for 2–3 hours, it can be used for infection.
[0132] (3) Agrobacterium infection of Sanhu red orange
[0133] Make small holes in the germinated Sanhu red orange seeds with a needle to facilitate Agrobacterium infection, then soak them in the prepared bacterial solution; vacuum degas for 1 minute, quickly release the gas, and treat on a shaker at 80 rpm for 10 minutes, repeating this process two to three times; remove the seeds, blot the bacterial solution on the surface with filter paper, spread them evenly on moist filter paper, and incubate in the dark at 25℃. After three days, plant them in soil. Positive identification can be performed after one month.
[0134] (4) Identification of positive plants
[0135] DNA was extracted from VIGS plants, and positive plants were identified using two pairs of primers. The primers for identifying the helper plasmid pTRV1 are as follows:
[0136] Forward primer: (SEQ ID NO.15): 5'-ATTGAGGCGAAGTACGATGG-3',
[0137] Reverse primer: (SEQ ID NO.16): 5'-CCATCCACAATTATTTTCCGC-3';
[0138] The primers for identifying the pTRV2-CrWRKY40 recombinant plasmid are as follows:
[0139] Forward primer: (SEQ ID NO.17): 5'-ATTCACTGGGAGATGATACGCT-3', reverse primer: (SEQ ID NO.14).
[0140] 2. Identification of drought resistance in VIGS Sanhu red oranges
[0141] To test the effectiveness of the VIGS system, this invention detected the gene expression level of CrWRKY40 in VIGS plants. The results are as follows: Figure 8 As shown, quantitative real-time PCR and semi-quantitative analysis revealed that the CrWRKY40 gene was silenced in Sanhu red mandarin oranges, and the expression level of the gene was significantly downregulated, indicating that the CrWRKY40 gene was successfully silenced in Sanhu red mandarin oranges.
[0142] To investigate the effect of silencing the CrWRKY40 gene on the resistance of Sanhu red mandarin oranges to drought stress, this invention subjected two-month-old pTRV-CrWRKY40-silenced Sanhu red mandarin oranges and a pTRV control to drought stress treatment together.
[0143] Silent plants and controls were subjected to drought for 10 days, and changes in their expression were observed. Results are as follows: Figure 9 As shown, before drought treatment, there was no significant difference in growth status between pTRV2-CrWRKY40 plants and the pTRV control. However, after 10 days of drought treatment, pTRV-CrWRKY40 plants exhibited leaf yellowing and wilting, while the leaves of the pTRV control remained essentially the same as before treatment. This result indicates that silencing the CrWRKY40 gene reduces the drought tolerance of Sanhu Red Orange.
[0144] Subsequently, stomatal density and stomatal aperture under dehydration conditions were measured in silent plants and controls. Results are as follows: Figure 10 As shown, the stomatal density of the silenced CrWRKY40 gene was significantly higher than that of the TRV control, and the stomatal aperture was also larger than that of the control after 6 hours of dehydration treatment, indicating that the leaves lost more water and their drought resistance was weakened after the CrWRKY40 gene was silenced; at the same time, the leaf microstructure was observed, and the results were as follows. Figure 11 As shown, after silencing the CrWRKY40 gene, the palisade tissue was lower than the control, while the spongy tissue was higher than the control. Their palisade-to-sponge ratio was significantly lower than the control, indicating that silencing the CrWRKY40 gene reduced the drought resistance of Sanhu Red Orange.
[0145] Next, the root growth was observed, and the results were as follows: Figure 12As shown, the silencing of the CrWRKY40 gene resulted in a shorter taproot and fewer lateral roots compared to the control. This indicates that silencing the CrWRKY40 gene reduces the drought resistance of Sanhu Red Orange.
[0146] Example 9
[0147] Transient transformation of Tobacco Benzovia by overexpression of the CrWRKY40 gene
[0148] 1. Vector Construction: The coding region of the CrWRKY40 gene was inserted into the Xba I and Sma I restriction sites of the pCAMBIA1300-EGFP vector (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product code P19463). After transformation into E. coli and successful sequencing, the plasmid was extracted and transformed into Agrobacterium competent cells GV3101 (p19). The primer sequences used are as follows:
[0149] (SEQ ID No.18)1300-EGFP-CrWRKY40-F: (Xba I)
[0150] GGAGAGAACACGGGGGAC TCTAGA ATGGATTCTTTTTCATGGGTTG
[0151] (SEQ ID No.19)1300-EGFP-CrWRKY40-R: (Sma I)
[0152] CAATCAGGATCCGGTACC CCCGGG TCACCATTTCTCTCTCGGATTATGT
[0153] 2. Activate the constructed positive vector GV3101(p19) Agrobacterium, and perform large-scale shaking culture using LB liquid medium containing the appropriate antibiotic (at a ratio of 1:100). Measure the OD using a spectrophotometer. 600 The bacterial cells were collected by centrifugation when the OD600 was between 0.6 and 0.8, and then diluted with washing buffer to approximately 1.0. The washing buffer required 200 μmol / L LAs. After dark incubation for 2-3 hours, the bacterial suspension was injected into the underside of *Nicotiana benthamiana* leaves, and the cells were incubated in the dark with controlled water for 3 days. Phenotypic changes were then observed. Results are as follows... Figure 13 As shown, before drought treatment, there was no significant difference in the phenotype of *Nicotiana benthamiana* injected with 1300-EGFP and 1300-CrWRKY40 bacterial suspensions. However, after drought treatment, the phenotype of the unloaded control showed obvious leaf drooping, while the *Nicotiana benthamiana* overexpressing the CrWRKY40 gene showed no significant difference from that before treatment.
[0154] The relative conductivity under in vitro dehydration conditions was then measured. The results are as follows: Figure 14As shown, before in vitro dehydration, there was no difference in the relative conductivity between the control and the overexpression of the CrWRKY40 gene. However, after 120 min of in vitro dehydration, the relative conductivity increased significantly, and the relative conductivity of the control was significantly higher than that of the overexpression of the CrWRKY40 gene. This indicates that after drought stress, the plant cell membrane was damaged, and the control suffered greater drought damage than the overexpression of the CrWRKY40 gene.
[0155] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of the drought-resistance gene CrWRKY40 or the protein encoded by said drought-resistance gene CrWRKY40 in improving plant drought resistance, characterized in that, The nucleotide sequence of the drought-resistant gene CrWRKY40 is shown in SEQ ID No. 1; The plant in question is Nicotiana benthamiana.
2. A method for improving plant drought resistance, characterized in that, This includes overexpression of the drought-resistant gene CrWRKY40 in the target plant, the nucleotide sequence of which is shown in SEQ ID No. 1, and the plant is Nicotiana benthamiana.