Osssiii b gene and application thereof in regulating crop quality

Abstract

The application provides an OsSSIIIb gene and application thereof in regulating crop quality, and belongs to the technical field of crop breeding. The OsSSIIIb gene provided by the application can be used as a quality-related gene of a Gramineae plant, and is especially used for regulating rice trait indexes, including regulating the content of storage substances, yield or eating quality, and the like, thereby providing more gene resources for regulating rice quality. Through the technical scheme provided by the application, in the field of rice quality research and development, if a target rice species is excellent in other traits but the protein content in the rice is too low, the protein content in the rice can be increased by knocking out or mutating the OsSSIIIb gene in the target rice species, so that the OsSSIIIb gene is not expressed, or the OsSSIIIb gene with weakened or no function is expressed; if a target rice species is excellent in other traits but the protein content in the rice is too high, the protein content in the rice can be reduced by increasing the expression level of the OsSSIIIb gene, thereby improving the gel consistency and eating quality.

Description

Technical Field

[0001] This invention relates to the field of crop breeding technology, and in particular to the OsSSIIIb gene and its application in regulating crop quality. Background Technology

[0002] Rice (Oryza sativa L.) is an important source of carbohydrates and energy for humans. The main edible part of rice is the endosperm, which consists of two main components: starch (up to 90% dry weight) and protein (8-10%). Therefore, starch and protein are the main determinants of the nutritional quality, appearance quality, cooking quality, and processing quality of rice.

[0003] The rice-related genes disclosed in existing technologies are diverse, including:

[0004] Chinese patent CN101130785A discloses a WRKY protein derived from rice and associated with drought tolerance, along with its encoding gene. This gene, or a DNA sequence encoding a homologous protein with the same function, is introduced into plant tissues, cells, or organs. The transformed plant cells, tissues, or organs are then cultivated into transgenic plants with enhanced drought tolerance. Experiments have shown that transforming rice with this gene significantly improves rice's tolerance to drought stress without significantly affecting its normal growth and economic traits. This protein and its encoding gene have significant theoretical and practical implications for the study of plant drought tolerance mechanisms and the improvement of drought tolerance and related traits in plants. It will play a crucial role in the genetic engineering improvement of drought tolerance in plants (especially cereal crops) and has broad application prospects.

[0005] Chinese patent CN108034661A discloses the application of the OsNPF8.8b gene in improving rice yield and nutritional quality, belonging to the field of plant genetic engineering. The amino acid sequence and cDNA sequence of the protein encoded by the OsNPF8.8b gene are shown in SEQ ID NO. 1 and 2. This invention, through constructing rice plants overexpressing the OsNPF8.8b gene, found that increasing the expression of the OsNPF8.8b gene increases the number of tillers and effective panicles, the number of grains per plant and the dry weight of grains per plant, and the globulin content in rice. Through constructing mutant plants, it was found that knocking out the OsNPF8.8b gene reduces the number of tillers, the number of grains per plant and the dry weight of grains per plant, and the globulin content in rice. Therefore, the OsNPF8.8b gene can be used to promote rice yield and quality improvement, and has important applications in improving nitrogen use efficiency and rice quality.

[0006] However, there is still a lack of more solutions in the existing technology that can be used to improve the quality of rice. Summary of the Invention

[0007] The purpose of this invention is to provide the OsSSIIIb gene and its application in regulating crop quality, thus providing more gene resources for regulating rice quality.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] This invention provides a quality-related gene OsSSIIIb for grasses, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0010] The present invention also provides a protein encoded by the above-mentioned quality-related gene OsSSIIIb of the Gramineae family, the amino acid sequence of which is shown in SEQ ID NO.2.

[0011] The present invention also provides the application of the above-mentioned quality-related gene OsSSIIIb in grass plants, which improves the yield and / or taste quality of grass plants by overexpressing OsSSIIIb.

[0012] Preferably, the method for overexpressing OsSSIIIb includes the following steps:

[0013] The cloned OsSSIIIb was constructed into a gene overexpression vector to obtain a recombinant vector;

[0014] The resulting recombinant vector was transformed into Agrobacterium;

[0015] Agrobacterium is inoculated into crops to achieve gene overexpression.

[0016] The present invention also provides the application of the above-mentioned quality-related gene OsSSIIIb in grass plants, which increases the content of storage substances in grass grains by inhibiting the expression of OsSSIIIb.

[0017] Preferably, the inhibition of OsSSIIIb expression includes gene mutation of OsSSIIIb, complete or partial restriction of OsSSIIIb expression level, and complete or partial restriction of protein activity of OsSSIIIb expression.

[0018] Preferably, the grass plant is rice.

[0019] The present invention also provides an amplification primer set for detecting the above-mentioned quality-related gene OsSSIIIb in grass plants, the primer set comprising an upstream primer and a downstream primer;

[0020] The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3;

[0021] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.4.

[0022] This invention also provides the application of the above-mentioned primer set for amplifying the quality-related gene OsSSIIIb in grass plants in crop quality-related research, for use in auxiliary breeding of protein content quality traits in crops.

[0023] This invention also provides the application of the above-mentioned primer set for amplifying the quality-related gene OsSSIIIb in grass plants in crop quality-related research, for auxiliary breeding of the gel consistency and / or eating quality traits of crops.

[0024] The beneficial effects of this invention are:

[0025] The OsSSIIIb gene provided by this invention can serve as a quality-related gene for gramineous plants, particularly for regulating rice traits, including the content of storage substances, yield, and eating quality. This invention demonstrates that knockout or silencing of this gene leads to an increase in protein content in rice, especially gluten. Transmission electron microscopy revealed a significant increase in the average cross-sectional area of ​​protein bodies I and II, which are used for protein storage, within the endosperm cells of OsSSIIIb gene knockout or silencing materials. Phenotypic analysis of all OsSSIIIb gene transgenic materials showed a significant increase in rice flour consistency and eating quality in overexpression materials. Agronomical trait analysis revealed that overexpressing plants of the OsSSIIIb gene resulted in an approximately 3.4g increase in yield per plant compared to the control due to an increase in the number of panicles and effective panicles per plant.

[0026] According to the technical solution provided by this invention, in the field of rice quality research and development, if the target rice variety has excellent other traits but the protein content in the rice is too low, the protein content in the rice can be increased by knocking out or mutating the OsSSIIIb gene in the target rice variety, so that the OsSSIIIb gene is not expressed, or its expression function is weakened or non-functional. If the target rice variety has excellent other traits but the protein content in the rice is too high, the protein content in the rice can be reduced by increasing the expression level of the OsSSIIIb gene, while improving the gel consistency and eating quality. Attached Figure Description

[0027] Figure 1 Figure 1 shows the combined analysis results of ChIP-seq data for Ghd7 and OsNF-YC12 proteins. Figure 2a is the Venn diagram, Figure 3b is the GO enrichment result, Figure 4c is the KEGG enrichment result, and Figure 5d is the gene classification enrichment diagram for starch and sucrose metabolic pathways.

[0028] Figure 2The diagram shows the molecular interactions between Ghd7 and OsNF-YC12 proteins and the OsSSIIIb gene as demonstrated by the EMSA assay. The scale bar is 1000 bp.

[0029] Figure 3 Figure showing the regulatory effects of Ghd7 and OsNF-YC12 proteins on the OsSSIIIb gene in a rice protoplast luciferase reporter assay.

[0030] Figure 4 This figure shows the spatiotemporal expression pattern of the OsSSIIIb gene in near-isogenic lines.

[0031] Figure 5 This is a diagram showing the subcellular localization of the OsSSIIIb gene expression protein, with a scale bar of 5 μm.

[0032] Figure 6 Figure 1 shows the creation of OsSSIIIb gene transgenic materials and the results of grain protein content. Figure 2 shows the target and mutation results of the OsSSIIIb gene (scale bar: 100 bp); Figure 3 shows the plant morphology of OsSSIIIb knockout mutants and wild-type plants (scale bar: 10 cm); Figure 4 shows the OsSSIIIb gene overexpression and silencing vectors; Figure 5 shows the plant morphology of OsSSIIIb gene overexpressing plants, silent plants, and wild-type plants (scale bar: 10 cm); Figure 6 shows the grain storage protein content of OsSSIIIb transgenic materials and wild-type plants; Figure 7 shows the total grain protein content of OsSSIIIb transgenic materials and wild-type plants; Figure 8 shows the transmission electron micrographs of OsSSIIIb transgenic materials and wild-type plants during the grain-filling stage (scale bar: 5 μm); Figure 9 shows the statistical results of grain protein body area of ​​OsSSIIIb transgenic materials and wild-type plants during the grain-filling stage.

[0033] Figure 7 Figure 1 shows the results of the food quality analysis of OsSSIIIb transgenic materials. Figure 2 shows the amylose content of the seeds of each OsSSIIIb transgenic material and the wild type; Figure 3 shows the total starch content of the seeds of each OsSSIIIb transgenic material and the wild type; Figure 4 shows the gel consistency of each OsSSIIIb transgenic material and the wild type; and Figure 5 shows the food quality value of each OsSSIIIb transgenic material and the wild type.

[0034] Figure 8 Figure 1a shows the results of the agronomic trait survey of OsSSIIIb gene transgenic materials. Figure 2a shows the plant type, heading date, number of panicles per plant, number of effective panicles per plant, number of grains per panicle, panicle length, seed setting rate, thousand-grain weight, and yield per plant for each OsSSIIIb transgenic material and wild type. Detailed Implementation

[0035] The OsSSIIIb sequence information provided by this invention:

[0036] The nucleotide sequence of the OsSSIIIb gene (SEQ ID NO.1):

[0037]

[0038] The amino acid sequence of the OsSSIIIb protein (SEQ ID NO.2):

[0039]

[0040] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Example

[0042] Genetic material involved in this invention

[0043] Kongyu 131 (KY131) is a japonica rice variety introduced from Japan. It is characterized by early maturity, cold resistance, lodging resistance, high tillering, and high yield.

[0044] Daohuaxiang No. 2 (DHX2) is a renowned japonica rice variety with excellent eating quality, meeting the highest standards for rice quality in all aspects. In addition, Daohuaxiang No. 2 is characterized by late maturity and resistance to rice blast, but it is not cold-hardy and prone to lodging.

[0045] Nihonbare was developed in 1957 by the Aichi Prefectural Agricultural Research Station in Japan through hybridization of "Yamahiko" and "Sachikaze," using an accelerated generation method of three generations per year, and was bred over six years. It is characterized by a slightly more white belly, a glossy appearance, good quality and appearance, and excellent taste.

[0046] NIL(KY131) and NIL(DHX2) are a pair of near-isogenic lines (NILs) at the Ghd7 locus, constructed through multiple generations of continuous backcrossing using Daohuaxiang 2 as the donor and Kongyu 131 as the recipient.

[0047] Construction of OX-3b overexpression material: The full-length CDS of the OsSSIIIb gene was amplified by PCR using cDNA from Daohuaxiang 2 as a template (the primer sequences used were: OX-3bF: CCATTTACGAACGATAGCCGGTACCATGGAGATGGCGCATAGCCCGCT, as shown in SEQ ID NO.3; OX-3bR: GATCTTTGTAATCGGATCCGGATCCGTTCTTGCGAGCGGAATGGTACA, as shown in SEQ ID NO.4). The CDS was then subcloned into the overexpression vector PU2301-flag. The recombinant plasmid was transformed into the recipient variety Kongyu 131 using Agrobacterium-mediated transformation, and finally, OsSSIIIb overexpressing plants (OX-3b) were obtained through appropriate molecular detection.

[0048] Construction of RNAi-3b silencing expression material: A 310 bp PCR fragment containing the third exon of OsSSIIIb (bases 77-386) was cloned into the dspCAMBIA1301 vector in both sense and antisense directions (the amplification primer sequences used were: RNAi-3bF: GAGACCTACTGTTGAATCCA, as shown in SEQ ID NO.5; RNAi-3bR: TGCACTTATTTTACCACGGT, as shown in SEQ ID NO.6). The recombinant plasmid was also transformed into the recipient variety Kongyu 131 using Agrobacterium-mediated genetic transformation. Finally, the OsSSIIIb gene-silencing expression plants (RNAi-3b) were obtained through corresponding molecular detection.

[0049] All materials were planted and grown in experimental fields of Huazhong Agricultural University in Wuhan or Lingshui, Hainan. After the rice was harvested, it was dried and stored at room temperature for at least three months before being used in the experiment.

[0050] Sample processing

[0051] a) Determination of grain protein content:

[0052] The protein content was determined using the FOSS XDS near-infrared rapid content analyzer. (2) Start the FOSS XDS RapidContentAnalyzer (Foss NIR Systems, Inc. Laurel, MD) rapid component analyzer, open the ISIscan software and warm it up for half an hour. Then fill the static round cup with the brown rice sample to be tested. Make sure there is no light transmission when observing from the bottom of the cup before the measurement can be performed. If light is transmitted, it means that the brown rice in the cup is not mixed evenly and needs to be manually shaken horizontally. (3) Select the created near-infrared measurement model 203ok for brown rice protein content to analyze the protein content of the sample. Each sample should be measured at least twice to ensure that the instrument is not affected by the external environment and that the data is stable. In addition, each sample should contain at least 10 biological replicates.

[0053] b) Extraction and determination of four storage proteins:

[0054] (1) Accurately weigh 0.1 g of refined rice flour on an analytical balance, place it in a 2 ml centrifuge tube, add albumin extraction buffer (10 mM Tris-HCl (pH 7.5)), vortex to mix, and incubate at room temperature on a shaker for 2 h. Centrifuge at 12000 rpm for 15 min at 4 °C. Aspirate the supernatant as albumin. Repeat the extraction 3 times, and mix the supernatants from the 3 extractions to obtain the total albumin content. If you do not intend to measure it immediately, you can store it in a -20 °C refrigerator.

[0055] (2) Add globulin extraction solution (1M NaCl) to the centrifuge tube containing only the precipitate from (1), vortex to mix, and incubate at room temperature on a shaker for 2 hours. Centrifuge at 12000 rpm for 15 minutes at 4°C. Aspirate the supernatant as globulin. Repeat the extraction 3 times, and mix the supernatants from the 3 extractions to obtain the total globulin content. If you do not intend to measure it immediately, you can store it in a -20°C refrigerator.

[0056] (3) Add the prolactin extraction solution (60% n-propanol containing 1 mM EDTA-2Na) to the centrifuge tube containing only the precipitate from (2), vortex to mix, and incubate at room temperature on a shaker for 2 hours. Centrifuge at 12000 rpm for 15 minutes at 4°C. Aspirate the supernatant as prolactin. Repeat the extraction 3 times, and mix the supernatants from the 3 extractions to obtain the total prolactin content. If you do not intend to measure it immediately, you can store it in a -20°C refrigerator.

[0057] (4) Add gluten extraction solution (0.05M NaOH) to the centrifuge tube containing only the precipitate from (3), vortex to mix, and incubate at room temperature on a shaker for 2 hours. Centrifuge at 12000 rpm for 15 minutes at 4°C. Aspirate the supernatant as gluten. Repeat the extraction 3 times, and mix the supernatants from the 3 extractions to obtain the total gluten content. If you do not intend to measure it immediately, you can store it in a -20°C refrigerator.

[0058] (5) The contents of four storage proteins were determined using the Coomassie Brilliant Blue method (G-250), with bovine serum albumin as the standard. A suitable standard curve was constructed to ensure that the contents of the four storage proteins fell within the range of the standard curve as much as possible. The OD values ​​of each sample were measured using a TECAN Infinite M200 multi-functional microplate reader.

[0059] c) Determination of amylose content:

[0060] The determination of amylose content in refined rice flour was based on the national standard NY / T2639-2014 with slight adjustments. The specific steps are as follows: First, add 10±0.5 mg of refined rice flour, 0.1 ml of 95% ethanol, and 0.9 ml of 1M sodium hydroxide sequentially to a dry 15 ml glass tube. After mixing thoroughly, tighten the cap, incubate in a boiling water bath for 10 min, cool to room temperature, and dilute with 9 ml of single-distilled water. Then, add 0.5 ml of the diluted solution to a new 15 ml glass tube, and add 9.25 ml of single-distilled water, 0.2 ml of 1M acetic acid, and 0.15 ml of 0.2% iodine-potassium iodide solution sequentially. Tighten the cap, invert the tube to mix thoroughly, and let stand for 20 min. Finally, add 0.2 ml of the above mixture and the same treatment mixture of four standard samples with amylose content (0.4%, 10.6%, 16.2%, and 26.5%) to transparent ELISA plates, respectively, and use TecanInfinite... The M200 multi-functional microplate reader measures absorbance at a wavelength of 620 nm. The amylose content of each sample is calculated using a linear equation relating the absorbance of the standard sample to its amylose content. Each single sample is measured three times, and the average value is the final amylose content.

[0061] d) Determination of total starch content:

[0062] First, weigh 2.5g of the sample (accurate to 0.1mg) into a 100mL volumetric flask, add 25mL of 1.128% hydrochloric acid solution, and shake well. Then add another 25mL of 1.128% hydrochloric acid solution. After thorough shaking, immerse the volumetric flask in a boiling water bath for hydrolysis. Shake continuously for the first 3 minutes to prevent clumping. After hydrolysis for 15 minutes, remove the volumetric flask and add 30mL of cold water, immediately cooling to 20℃. Add 5mL of zinc acetate solution, shake for 1 minute, then add 5mL of potassium ferrocyanide solution, shake for 1 minute, and dilute with water to the mark. Mix well and filter. If the filtrate is not clear, add appropriate amounts of zinc acetate solution and potassium ferrocyanide solution before testing to clarify the solution. Pour this filtrate into a 20cm polarimeter tube and measure its total optical rotation (P) using a polarimeter. Total starch content = 2000 / 185.9 * 2.5 α1 / m1 (185.9 - Specific rotation of pure starch in rice flour at 589.3 nm;) α1 -Total optical rotation; m1 - The mass of rice noodles corresponding to the total optical rotation.

[0063] e) Determination of gel consistency:

[0064] (1) Grind the rice sample into rice flour using a ball mill and pass it through a 200-mesh sieve;

[0065] (2) Add 0.1g of rice flour to a dedicated test tube, then add 0.2ml of 0.025% thymol blue solution and quickly shake the test tube to fully disperse the rice flour;

[0066] (3) Add 2 ml of 0.2 mol / L KOH solution and quickly place it on a vortex mixer to mix well;

[0067] (4) Then quickly place the test tube into a boiling water bath (it is best to use a large electric rice cooker, as water baths have poor heat retention). Place a glass bead at the mouth of the test tube and gelatinize in the boiling water bath for 8 minutes (pay special attention that the height of the colloid in the test tube should not exceed 2 / 3 of the total length of the test tube, otherwise it will easily overflow. During this process, it is best to use a hair dryer to blow air intermittently at the mouth of the test tube to prevent the colloid in the test tube from overflowing. Any overflowing samples need to be retested).

[0068] (5) After gelatinization, place the test tubes at room temperature for 5 minutes, then in an ice bath for 20 minutes, and then place all the test tubes horizontally on the experimental table and let them stand at room temperature for 1 hour.

[0069] (6) Use a ruler to measure the length of the colloid in each test tube (i.e., the consistency of the colloid). Alternatively, place the test tube on a table covered with graph paper to measure and record the consistency of each sample.

[0070] f) Determination of palatability value:

[0071] Accurately weigh 30.00g of polished rice and set aside, removing as much broken rice as possible. Place the prepared polished rice in a steel can, add water and soak for 30 minutes, then wash for 30 seconds. Add water according to the appropriate rice-to-water ratio (1:1.4 for indica rice and 1:1.35 for japonica rice, by weight), and cover with filter paper. Seal with a rubber ring and soak for 30 minutes starting from the start of washing. Weigh the rice when adding water: 30 + 30 * rice-to-water ratio + can weight. Then place the can, along with the filter paper, in a rice cooker (as per the rice flavoring device) and keep warm (cook rice) for 10 minutes. Remove the steel can, gently stir the rice until it is agitated, cover with filter paper, and place in the accompanying air-cooling device to cool for 20 minutes. After air cooling, remove the filter paper, replace with the accompanying steel lid, seal, and allow to cool naturally for 90 minutes. Repeat each sample 3 times, using 8.00g of japonica rice (7.00g of indica rice) for the sample, pressing the rice cake for 20 seconds on each side. The palatability score of the sample polished rice was determined using a STA1B type rice palatability meter (STA1B, SATAKE CO., Ltd., Japan) manufactured by Satake Corporation. The palatability score was read directly; the total score is 100 points. Generally, a higher palatability score indicates better palatability quality.

[0072] Analysis of Experimental Results of This Invention

[0073] Discovery and identification of the OsSSIIIb gene

[0074] Using ChIP-seq sequencing data of Ghd7 protein obtained in our previous study and publicly available ChIP-seq sequencing data of OsNF-YC12, a joint analysis was performed, identifying 582 common potential downstream target genes. Figure 1 a). GO and KEGG enrichment analyses of these 582 genes revealed that, excluding global and overview maps, carbohydrate metabolism pathways were the most enriched pathways. Figure 1 b, c). We then focused on further analyzing the genes enriched in the branched starch and sucrose metabolic pathways within the carbohydrate metabolism pathway. Figure 1 d) According to gene annotation, three genes were found to be significantly associated with starch synthesis, including the OsSSIIIb gene (Table 1). The nucleic acid sequence of the OsSSIIIb gene is shown in SEQ ID NO:1, and the protein sequence it encodes is shown in SEQ ID NO:2.

[0075] Table 1. Genes enriched in starch and sucrose metabolic pathways.

[0076] GeneID Genename Function annotation Os06g0270900 OsALDH2B1 Aldehydedehydrogenase Os10g0478200 Lactate / malatedehydrogenase,putative,expressed Os01g0720600 Starchsynthase,putative,expressed Os01g0749400 Trehalosesynthase,putative,expressed Os04g0624600 OsSSIIIb Solublestarchsynthase3,chloroplastprecursor,putative,expressed Os06g0652300 Starchsynthase,putative,expressed Os02g0523800 ES2; OsIPK2 Earlysenescence2;inositolpolyphosphatekinase Os01g0639900 Carbonicanhydrase,chloroplastprecursor,putative,expressed

[0077] The expression of the OsSSIIIb gene is co-regulated by Ghd7 and OsNF-YC12, key regulators of rice quality.

[0078] EMSA gel migration assay results showed that the recombinant Ghd7 and OsNF-YC12 proteins could bind to their respective specific probes, displaying hysteresis bands on the gel image. Furthermore, the addition of unlabeled competitive probes caused the hysteresis bands to lighten or even disappear. This indicates that the recombinant Ghd7 and OsNF-YC12 proteins can bind to the OsSSIIIb gene in vitro. Figure 2 Analysis of rice leaf sheath protoplast luciferase reporter assays showed that OsNF-YC12 promotes the transcriptional activity of the OsSSIIIb gene, while Ghd7 inhibits it. The antagonistic effects of these two factors jointly determine the transcriptional level of the OsSSIIIb gene. Figure 3 ).

[0079] Expression patterns and subcellular localization of the OsSSIIIb gene

[0080] To investigate the function of OsSSIIIb, we first examined the expression patterns of the OsSSIIIb gene in different organs and tissues using RT-qPCR. Figure 4The results showed that OsSSIIIb was expressed to varying degrees in all tested tissues and organs, with the highest expression level observed in the endosperm at 7 days of grain filling. Notably, the expression level of OsSSIIIb gradually decreased with further grain filling and maturation, becoming almost undetectable in the endosperm at 20 days of grain filling. Throughout the grain filling process, except for the 15-day mark, the expression level of OsSSIIIb in NIL(DHX2) was consistently lower than that in NIL(KY131), which is highly consistent with the results of protoplast transcriptional activity analysis.

[0081] Since subcellular localization is crucial for function, it is necessary to elucidate the subcellular localization sites of the OsSSIIIb protein. To verify the subcellular localization of the OsSSIIIb protein in vivo, a GFP recombinant vector was constructed and transiently expressed in rice protoplasts. Figure 5 Individual GFP is uniformly distributed in the cytoplasm and nucleus, while the OsSSIIIb-GFP fusion protein is distributed throughout the cytoplasm but does not co-localize with the autofluorescence signal of chlorophyll in chloroplasts, and is characterized by a small disc pattern. This indicates that the OsSSIIIb protein is localized in the cytoplasm but not in the chloroplasts.

[0082] Genetically modified analysis

[0083] To further determine the function of OsSSIIIb, the corresponding recombinant vectors were transformed into the recipient material KY131 using the Agrobacterium infection method to obtain OsSSIIIb gene overexpression plants (OX-3b) and silenced plants (RNAi-3b). Simultaneously, the OsSSIIIb gene from NIP was edited using the CRISPR / Cas9 system to obtain homozygous knockout mutant plants (KO-1 and KO-2) without transgenic components. Phenotypic identification was then performed on the obtained materials. Figure 6 ,7).

[0084] The results are as follows Figure 6 and 7 As shown, compared with NIP, the amylose and total starch content of KO-1 and KO-2 grains did not change significantly, but the gluten and total protein content of KO-1 and KO-2 grains increased significantly. Compared with KY131, the gluten and total protein content of OX-3b grains decreased significantly, while the gluten and total protein content of RNAi-3b grains increased significantly. Furthermore, transmission electron microscopy revealed that, compared with their respective controls, the average cross-sectional area of ​​protein body I (PBⅠ) and protein body II (PBⅡ) was significantly larger in the endosperm of KO-1, KO-2, and RNAi-3b 15 days after grain filling, while the opposite was true for OX-3b. These results collectively indicate that the OsSSIIIb gene is a negative regulator of grain protein content.

[0085] Grain protein content is also an important factor affecting the taste and quality of cooked rice; therefore, the gel consistency and taste value of these genetically modified materials were further analyzed. Figure 7 The results showed that OX-3b exhibited significantly improved gel consistency and palatability, while other materials showed no significant changes. Furthermore, agronomical traits of the OsSSIIIb gene-related transgenic materials were investigated, revealing that OX-3b significantly reduced plant height, while total panicle number, effective panicle number, and yield per plant significantly increased. Figure 6 b, d and Figure 8 ).

[0086] The above experimental results indicate that OsSSIIIb is an important gene affecting grain protein content and yield. Increased expression of this gene or other factors leading to enhanced protein function can reduce the protein content in rice, while simultaneously improving the eating quality and increasing yield.

[0087] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of the quality-related gene OsSSIIIb in grass plants, characterized by: The yield and / or palatability of a grass plant, specifically rice, is improved by overexpressing OsSSIIIb, and the nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application of the OsSSIIIb quality-related gene in grasses according to claim 1, characterized in that, The method for overexpressing OsSSIIIb includes the following steps: The cloned OsSSIIIb was constructed into a gene overexpression vector to obtain a recombinant vector; The resulting recombinant vector was transformed into Agrobacterium; Agrobacterium is inoculated into crops to achieve gene overexpression.

3. The application of the quality-related gene OsSSIIIb in grass plants, characterized by: The protein content in grains of a grass plant, specifically rice, is increased by inhibiting the expression of OsSSIIIb, and the nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. The application of the OsSSIIIb quality-related gene in grasses as described in claim 3, characterized in that, The inhibition of OsSSIIIb expression is achieved by mutating the OsSSIIIb gene.

Images