A universal method for detecting RNA methyltransferase activity

Abstract

This invention provides a universal method for detecting RNA methyltransferase activity. Specifically, this invention discloses a method for detecting RNA methyltransferase activity, comprising the following steps: providing a single-stranded RNA molecule with a length of 15-50 nt as a reaction substrate; performing test reactions on the molecule separately; and directly substituting the test enzyme results into calculations to obtain the enzyme activity. Furthermore, the detection method of this invention can simply, rapidly, and accurately detect RNA methyltransferase activity. The measurement results of this invention have low variability and good reproducibility.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a universal method for detecting RNA methyltransferase activity. Background Art

[0002] Donor and posttranscriptional modifications of RNA molecules occur in all kingdoms of life, and most of these modifications include a methylation step. The transfer of methyl groups to RNA nucleosides is catalyzed by RNA methyltransferases (RNA MTases), which almost exclusively use S-adenosylmethionine (SAM) as a methyl donor. RNA methyltransferases are responsible for the co-transcriptional and posttranscriptional methylation of nucleotides in a variety of RNA substrates. Examining the target specificity, catalytic activity, and function of these enzymes requires in vitro methylation assays.

[0003] At present, there are patent reports on related RNA methyltransferase activity detection methods. The earliest scheme is substrate radioactive labeling, the reaction is carried out between [methyl-3H]-SAM and short GpppX-RNA, the transferred [3H]CH3 is quantitatively analyzed and then grouped using TLC product separation and radioactivity counting. By using radioactively labeled RNA / nucleotides, changes in the structure of nucleotide substrates can be observed. This method has low safety, radioactive contamination, cumbersome steps, high experimental environment requirements, and high costs. In recent years, some non-radioactive labeling methods have been developed.

[0004] CN106053795A uses immunological methods to detect the content of SAH to determine the activity of methyltransferase in the reaction system. This solution involves the preparation and use of protein-SAH conjugates, which is relatively complicated.

[0005] CN116840197A utilizes S-adenosyl-L-homocysteine ​​hydrolase and adenosine deaminase to irreversibly convert the generated S-adenosyl-L-homocysteine ​​into homocysteine; the compound formed after the thiol-specific fluorescent molecular probe binds to homocysteine ​​uses a molecular probe that specifically binds to the thiol group and emits fluorescence to directly measure the homocysteine ​​content generated in the reaction, and then calculates the corresponding S-adenosyl-L-homocysteine ​​content to measure the 2'-O-methyltransferase activity. The disadvantage of this scheme is that it is necessary to design a specific fluorescent molecular probe with a label, which is relatively costly.

[0006] One method for detecting SAM methyltransferase is to obtain the detection result of SAM methyltransferase through the enzyme coupling reaction of S-adenosine-homocysteine ​​hydrolase and adenosine deaminase. This method relieves the feedback inhibition of the product, but the steps are cumbersome and involve multiple chain reactions.

[0007] Another method in the prior art is to measure the formation of SAH in different systems and compare it with the standard curve to obtain the quantitative result of SAH. However, it is not possible to accurately quantify the activity of methyltransferase.

[0008] Therefore, there is an urgent need in the art to develop a universal method for detecting RNA methyltransferase activity with good reproducibility and accurate quantification. Summary of the invention

[0009] The purpose of the present invention is to provide a universal method for detecting RNA methyltransferase activity with good reproducibility and accurate quantification.

[0010] In a first aspect of the present invention, a method for detecting RNA methyltransferase activity is provided, comprising the following steps:

[0011] (S1) providing a single-stranded RNA molecule with a length of 15-50 nt (preferably 18-40 nt, more preferably 20-30 nt) as a reaction substrate;

[0012] (S2) performing the following test reactions on the RNA molecules in (S1), respectively, wherein the test reactions include reactions in a negative test system, a first test system, and a second test system, and the reaction time is t, wherein:

[0013] In the negative test system, no enzyme is included;

[0014] In the first test system, a standard enzyme of RNA methyltransferase is included;

[0015] The second test system includes the RNA methyltransferase to be detected;

[0016] (S3) detecting the amount of SAH generated in the negative test system, the first test system, and the second test system, which are recorded as A0, A1, and A2, respectively;

[0017] (S4) Based on the analysis of the SAH production amounts A0, A1, and A2, a detection result of the RNA methyltransferase activity to be detected is obtained.

[0018] In another preferred embodiment, the detection result is a quantitative result.

[0019] In another preferred embodiment, the negative test system is completely identical to the other reaction conditions in the first test system, except that the first test system contains a standard enzyme of RNA methyltransferase;

[0020] The other reaction conditions in the first test system and the second test system are completely the same, and the only difference is that the second test system contains the RNA methyltransferase to be detected.

[0021] In another preferred embodiment, the step S1 includes:

[0022] (S1a) chemically synthesizing a DNA with a purity of 200-1500 ng / μl; the DNA length is 15-50 nt, preferably 18-40 nt, and more preferably 20-30 nt;

[0023] (S1b) the DNA is transcribed to obtain ssRNA, wherein the length of the ssRNA is 15-50 nt, preferably 18-40 nt, more preferably 20-30 nt, and more preferably 22 nt;

[0024] (S1c) The ssRNA is subjected to a Cap0 capping reaction to obtain Cap0 ssRNA as a reaction substrate.

[0025] In another preferred embodiment, the reaction substrate is a single-stranded RNA molecule with a length of 20-30 nt.

[0026] In another preferred example, the nucleotide sequence of the single-stranded RNA molecule is shown as SEQ ID NO.3.

[0027] In another preferred embodiment, a first buffer system is provided for the test reaction;

[0028] Take out one portion as the negative test system; divide the remaining first buffer system into at least two portions, which are recorded as A and B buffer systems, wherein:

[0029] Adding a standard enzyme of RNA methyltransferase to the A buffer system as the first test system;

[0030] The RNA methyltransferase to be detected is added to the buffer system B as the second test system.

[0031] In another preferred embodiment, the analysis in step (S4) is compared with a standard curve to obtain the RNA methyltransferase activity to be detected.

[0032] In another preferred embodiment, the analysis in step (S4) is to convert the known concentration of the RNA methyltransferase standard enzyme to obtain the RNA methyltransferase activity to be detected.

[0033] In another preferred embodiment, the first test system contains a predetermined amount of RNA methyltransferase standard enzyme.

[0034] In another preferred embodiment, the amount of SAH generated in the negative test system is A0; in the first test system, when the amount of the standard enzyme of RNA methyltransferase is C1, C2, C3, C4, C5, the amount of SAH generated is A1, A2, A3, A4, A5; the amount of SAH generated in the third test system is A6; wherein,

[0035] A0 represents the quality control value, i.e., the amount of SAH generated in the negative test system;

[0036] A1, A2, A3, A4, and A5 represent the SAH production of the standard enzyme of RNA methyltransferase when the enzyme amount is C1, C2, C3, C4, and C5, respectively;

[0037] A6 represents the amount of SAH generated by the RNA methyltransferase to be detected;

[0038] If A0=0, the test system is considered normal; if A0>0, the test is considered failed;

[0039] If the standard curve is drawn with the amount of standard enzyme as the horizontal axis and the amount of SAH generated as the vertical axis, and the vertical intercept is calibrated to 0, the standard curve y=ax is obtained. 2 ≥0.99, the standard curve was considered to be successfully drawn;

[0040] If A6>0, the RNA methyltransferase to be tested is considered to have enzymatic activity, activity = A6 / a;

[0041] If A6=0, the RNA methyltransferase to be detected is considered inactive.

[0042] In another preferred example, the sequence of the single-stranded RNA molecule is shown as SEQ ID NO.3.

[0043] In another preferred embodiment, the single-stranded RNA molecule has no interfering matching structure, such as a stem-loop.

[0044] In another preferred embodiment, the RNA methyltransferase is mRNA 2'-O-methyltransferase.

[0045] In another preferred embodiment, in the negative test system, the first test system, and the second test system, the final concentration of the RNA is independently 150 μg / 500 μl-350 μg / 500 μl, preferably 250 μg / 500 μl.

[0046] In another preferred embodiment, the negative test system, the first test system, the second test system or the third test system each independently comprises SAM, 10× capping reaction buffer and RNase inhibitor.

[0047] In another preferred embodiment, the final concentration of the 10× capping reaction buffer is 1× capping reaction buffer.

[0048] In another preferred embodiment, the final concentration of the SAM is 0.5 mM-1.0 mM, preferably 0.7 mM.

[0049] In another preferred embodiment, the final concentration of the RNase inhibitor is 0.5 U / μl-2 U / μl, preferably 0.8 U / μl.

[0050] In another preferred embodiment, in the first test system, the final concentration of the RNA methyltransferase standard enzyme is 0.1 U / μl-0.5 U / μl.

[0051] In another preferred embodiment, in the second test system, the final concentration of the RNA methyltransferase to be detected is 0.05 mg / ml-0.2 mg / ml, preferably 0.15 mg / ml.

[0052] In another preferred embodiment, the reaction time t is 0.8-1.4h; preferably, the reaction time t is 1h.

[0053] In another preferred embodiment, the test reaction is carried out at 35-38°C; preferably, at 37°C.

[0054] In another preferred embodiment, in the first test system, the reaction conditions are: at 37°C, the reaction time t is 0.8-1.4h; preferably, at 37°C, the reaction time t is 1h.

[0055] In another preferred embodiment, in the second test system, the reaction conditions are: at 37°C, the reaction time t is 0.8-1.4h; preferably, at 37°C, the reaction time t is 1h.

[0056] In another preferred embodiment, in (S1), the single-stranded RNA molecule with a length of 10-50 nt is Cap0 mRNA.

[0057] In another preferred embodiment, in (S1), the single-stranded RNA molecule with a length of 10-50 nt is mRNA obtained by in vitro transcription of DNA.

[0058] In another preferred embodiment, (S1) further includes:

[0059] (S1.1) Provide a DNA of a target gene;

[0060] (S1.2) in vitro transcribing the DNA in (S1) to obtain mRNA transcribed from the DNA;

[0061] (S1.3) DNA transcribed mRNA to obtain capped Cap0 mRNA.

[0062] In another preferred embodiment, (S1.2) further includes: placing the purified transcribed mRNA in a PCR instrument at 65°C for 5 minutes, and immediately placing it on ice for 5 minutes after the reaction is completed.

[0063] In another preferred embodiment, in (S1.2), DNA is transcribed using T7 RNA polymerase to obtain mRNA transcribed from the DNA.

[0064] In another preferred embodiment, the mRNA sequence is shown as SEQ ID NO.3.

[0065] In another preferred embodiment, in (S1.3), the transcribed mRNA is capped using vaccinia virus capping enzyme to obtain the Cap0mRNA.

[0066] In another preferred embodiment, in (S3), the detection is HPLC detection.

[0067] In another preferred embodiment, (S3) includes:

[0068] (S3.1) Setting chromatographic conditions suitable for SAH separation;

[0069] (S3.2) Drawing a standard curve for RNA methyltransferase: Gradually dilute the RNA methyltransferase standard enzyme in the second test system into RNA methyltransferase standard enzyme solutions with different enzyme amounts, and draw a standard curve y=ax under the chromatographic conditions of (S3.1), based on the SAH peak area in the liquid chromatography, with the enzyme amount of the RNA methyltransferase standard enzyme as the abscissa and the SAH peak area as the ordinate, and calibrate the ordinate intercept to 0;

[0070] (S3.3) Calculate the content of SAH: Under the chromatographic conditions described in (S3.1), respectively detect the first test system, the second test system and the negative control group, obtain the corresponding SAH peak areas, substitute them into the standard curves in (S3.2) for calculation, and obtain the corresponding RNA methyltransferase enzyme amounts in the first test system, the second test system and the negative control group.

[0071] In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.

[0072] In another preferred embodiment, the method is an in vitro method.

[0073] In another preferred embodiment, the "chromatographic conditions suitable for SAH separation" means that the peak position t1 of SAH, compared with the peak position t0 of SAM in the test system, (t1-t0)≥5min; preferably ≥10min; more preferably ≥15min.

[0074] In a second aspect of the present invention, a kit for detecting RNA methyltransferase activity is provided, the kit comprising:

[0075] (a) a first container, and a negative test system located in the first container;

[0076] (b) a second container, and a first test system located in the second container;

[0077] (c) a third container, and a second test system located in the third container;

[0078] (d) a fourth container, and a reaction substrate in the fourth container; the reaction substrate is a single-stranded RNA molecule with a length of 15-50 nt; wherein,

[0079] The negative test system does not contain an enzyme; the first test system contains an RNA methyltransferase standard enzyme; and the second test system contains an RNA methyltransferase to be detected.

[0080] In another preferred embodiment, the negative test system, the first test system, and the second test system each independently contain SAM, 10× capping reaction buffer, and RNase inhibitor.

[0081] In another preferred embodiment, the kit further includes instructions for use.

[0082] In another preferred embodiment, the RNA methyltransferase standard enzyme is used to draw a standard curve of RNA methyltransferase.

[0083] In a third aspect of the present invention, a device for detecting RNA methyltransferase activity is provided, the device comprising:

[0084] (d1) a reaction module, wherein the reaction module comprises a negative control chamber, a first reaction chamber, and a second reaction chamber, wherein:

[0085] The negative control chamber contains the negative test system and reaction substrate;

[0086] The first reaction chamber comprises a first reaction module, wherein the first reaction module comprises a first test system and a reaction substrate;

[0087] The second reaction chamber comprises a second reaction module, and the second reaction module comprises a second test system and a reaction substrate;

[0088] Wherein, the negative test system does not contain an enzyme; the first test system contains a standard enzyme of RNA methyltransferase; the second test system contains an RNA methyltransferase to be detected; the reaction substrate is a single-stranded RNA molecule with a length of 15-50nt;

[0089] (d2) a data acquisition module, wherein the data acquisition module is configured to collect data on the SAH peak area in each reaction chamber in the reaction module;

[0090] (d3) an analysis module, wherein the analysis module is configured to analyze the SAH peak area from the data acquisition module through a "peak area-enzyme amount" standard curve of RNA methyltransferase to obtain an analysis result of the RNA methyltransferase activity to be screened;

[0091] (d4) An output module, which outputs the analysis results of the screening analysis module.

[0092] In another preferred embodiment, in the first test system, the final concentration of the RNA methyltransferase standard enzyme is 0.1 U / μl-0.5 U / μl.

[0093] In another preferred embodiment, in the second test system, the final concentration of the RNA methyltransferase is 0.05 mg / ml-0.2 mg / ml, preferably 0.15 mg / ml.

[0094] In another preferred embodiment, in the first test system, the reaction conditions are: reaction at 37°C for 0.8-1.4 hours; preferably, reaction at 37°C for 1 hour.

[0095] In another preferred embodiment, in the second test system, the reaction conditions are: reaction at 37°C for 0.8-1.4h; preferably, reaction at 37°C for 1h.

[0096] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1 Chromatograms of SAH standards and actual reaction systems are shown.

[0098] Figure 2 The standard curve of the mRNA 2'- O -methyltransferase standard is shown, wherein the horizontal axis represents the different enzyme amounts (U / µl) of the mRNA 2'-O-methyltransferase standard and the vertical axis represents the SAH peak area (mAU) at different enzyme amounts.

[0099] Figure 3 The graph shows the change curves of RNA methyltransferase standards and SAH reaction products with different enzyme amounts when the amount of substrate Cap0 mRNA added in the reaction system is the same.

[0100] Figure 4 The figure shows the effect of long fragment Cap 0 mRNA substrate and short fragment Cap 0 mRNA substrate on the activity detection reaction results.

[0101] Figure 5 The standard curve of the vaccinia virus capping enzyme standard is shown. The standard curve is plotted with the enzyme amount (U / µl) as the horizontal axis and the SAH peak area (mAU) as the vertical axis. DETAILED DESCRIPTION

[0102] After extensive and in-depth research, the inventors have developed for the first time a method for quantitatively detecting the activity of universal RNA methyltransferases that is efficient, safe, reproducible and highly accurate. The inventors unexpectedly discovered that, compared with the conventional single-stranded RNA molecules of several hundred nt as substrates, the use of short single-stranded RNA molecules of a specific length as reaction substrates actually has the advantages of higher measurement accuracy and reproducibility. The present invention was completed on this basis.

[0103] Specifically, in the present invention, the target gene Cap0 mRNA is subjected to Cap1 capping reaction by RNA methyltransferase, and the amount of SAH (S-adenosylhomocysteine) produced in the above reaction is detected by HPLC method, thereby obtaining the quantitative measurement result of RNA methyltransferase activity (compared with the standard curve or calculated by substitution into the formula). In addition, the inventors have also optimized the enzyme activity test system, so that the activity detection of RNA methyltransferase can be completed simply, quickly and accurately, and the volatility of the measurement result is very small and the reproducibility is good.

[0104] the term

[0105] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0106] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0107] As used herein, the terms "Cap 0 ssRNA", "Cap 0 mRNA", "short fragment Cap 0 mRNA", "short fragment RNA substrate", "single-stranded RNA with a length of 15-50 nt" can be used interchangeably and all refer to the single-stranded RNA molecule defined in the first aspect of the present invention.

[0108] As used herein, the terms "mRNA 2'-O-methyltransferase standard", "standard enzyme" are used interchangeably to refer to a standard of mRNA 2'-O-methyltransferase.

[0109] As used herein, the terms "enzyme activity" and "enzyme amount" can be used interchangeably and both refer to the mRNA 2'-O-methyltransferase activity, and the unit can be expressed in "U / µl".

[0110] Cap structure and 2'-O-methyltransferase

[0111] The rapid development of mRNA vaccine technology has led to an increasing demand for RNA biology. Cap structure biosynthesis is an important step in mRNA maturation. It has become a research hotspot due to its impact on the development and treatment of many viral infections.

[0112] Eukaryotic mRNA is a complex molecule composed of various nucleotide regions. The central part of the mRNA sequence is the protein-coding segment located between the 5' and 3' untranslated regions (UTR). The 3' end of the mRNA is protected by a poly(A) tail, which consists of multiple adenosine monophosphates, which stabilizes transcription and participates in translation. A unique nucleotide structure called a "cap" is located at the 5' end of the mRNA, the "Cap". It has a 7-methylguanosine component that is connected to the first nucleotide of the nascent transcript through a 5'-5'-triphosphate bridge.

[0113] Cap biosynthesis is an important step in mRNA maturation. Cap biosynthesis involves three consecutive enzymatic reactions mediated by RNA triphosphatase (TPase), guanylate transferase (GTase) and N7-guanine methyltransferase (N7-MTase), which eventually form cap 0 structure, which is the main form in simple structures, such as yeast and plants in eukaryotes. However, in higher organisms, including humans, mRNA in the body mainly exists in the form of Cap1.

[0114] Compared with the Cap0 cap structure, the Cap1 cap structure has some more protective functions for RNA on the basis of its function. First, it can protect mRNA from rapid degradation by nuclease exonucleases. Secondly, compared with the Cap0 cap structure, the 5'Cap1 cap structure can significantly improve the translation efficiency of RNA during the translation process and improve the expression of mRNA after microinjection and transfection. In addition, the 5'Cap1 cap structure also plays a further role in preventing innate immune sensors from recognizing mRNA. Some studies have speculated that it can protect mRNA from translation shutdown triggered by innate immune responses through the type I interferon signaling pathway.

[0115] Cap0 mRNA can be methylated to Cap1 RNA. mRNA 2'-O-methyltransferase (2'-O-MTase) can add a methyl group to the 2'-O of the first nucleotide adjacent to the cap structure at the 5' end of RNA, using S-adenosylmethionine (SAM) as a methyl donor to methylate the capped Cap 0 RNA to Cap1 RNA. This enzyme can only use RNA with a 7-methylguanosine cap structure (m7GpppN, Cap0) as a substrate, and will not act on RNA with pN, ppN, pppN or GpppN at the 5' end.

[0116] As used herein, "cap" or "cap" structure are used interchangeably to refer to a unique nucleotide structure located at the 5' end of mRNA. It has a 7-methylguanosine component and is linked to the first nucleotide of the nascent transcript via a 5'-5'-triphosphate bridge.

[0117] As used herein, "SAM (S-Adenosyl-L-methionine)" and "S-adenosylmethionine" are used interchangeably to refer to a 15 H 22 The molecule of N6O5S molecular formula has the following structural formula.

[0118]

[0119] As used herein, "SAH (S-adenosyl homocysteine)" and "S-adenosyl homocysteine" are used interchangeably and refer to a molecule having the following molecular formula: 14 H 20 N6O5S. SAH is formed by demethylation of S-adenosyl-L-methionine (SAM).

[0120] In the present invention, SAH is a byproduct of the Cap0 capping reaction and the Cap1 capping reaction.

[0121] Vaccinia virus capping enzyme

[0122] The vaccinia virus capping system uses the vaccinia virus capping enzyme and related components to add a 7-methylguanosine cap structure (m7Gppp, Cap0) to the 5´ end of RNA. In eukaryotes, this structure is closely related to the stability, transport and translation of mRNA. Using enzymatic reactions to cap RNA is a simple and effective method, and the cap structure is completely consistent with the natural Cap 0 structure, which can significantly improve the stability and translation ability of RNA used for in vitro transcription, transfection and microinjection. This enzyme consists of two subunits (D1 and D12). The D1 subunit performs the functions of RNA triphosphatase and guanosine transferase, and the D12 subunit performs the function of guanine methyltransferase. They are all necessary for adding a complete Cap 0 structure m7Gppp5´N.

[0123] The capped RNA product constructed by vaccinia virus capping enzyme has a "cap0" structure. Cap0-RNA can be converted to a "cap1" structure by using both mRNA Cap 2'-O-methyltransferase and vaccinia virus capping enzyme in the capping reaction. mRNA Cap 2'-O-methyltransferase prepares Cap1-RNA from Cap0-RNA by transferring a methyl group from the donor molecule SAM to the 2'-O position of the first nucleotide of the cap structure immediately adjacent to the 5' end of cap 0-RNA.

[0124] Detection method of the present invention

[0125] The present application discloses a universal method for detecting RNA methyltransferase activity, wherein the method comprises:

[0126] Step A, using T7 RNA polymerase to transcribe the target gene RNA;

[0127] Step B, using vaccinia virus capping enzyme to perform Cap0 capping reaction on the RNA in step A to prepare enzyme activity detection substrate Cap0 mRNA;

[0128] Step C, using RNA methyltransferase standard enzymes with different enzyme amount gradients to perform Cap1 capping reaction on the RNA in step B;

[0129] Step D, performing Cap1 capping reaction on the RNA in step B using the test enzyme of RNA methyltransferase;

[0130] The HPLC method is used to detect the generation level of the byproduct SAH (S-adenosylhomocysteine) in the above steps; a standard curve is drawn using the standard enzyme of the RNA methyltransferase with different enzyme amount gradients in step C, and the detection result of the RNA methyltransferase to be tested in step D is substituted into the standard curve for calculation, so as to accurately quantify the RNA methyltransferase activity of the enzyme to be tested.

[0131] Subsequent data analysis showed that this method had good reproducibility and could successfully detect RNA methyltransferase activity.

[0132] The present invention has established a universal RNA methyltransferase activity detection method through research. Taking mRNA 2'-O-methyltransferase as an example, the specific process is as follows:

[0133] First, a pair of primers IVT-Probe-F / R were designed and synthesized based on the existing target gene, and the primers were used for annealing reaction to obtain a transcriptional DNA template; then, short ssRNA fragments with a length of 15-50nt were transcribed and synthesized under the action of T7 RNA polymerase and 4 NTPs.

[0134] Next, the transcribed RNA is subjected to a Cap0 capping reaction, and after purification, it is used as the substrate Cap0 mRNA of the enzyme activity detection system; then, the standard enzyme is gradiently diluted according to the amount of enzyme and used together with the enzyme to be tested to perform a Cap1 capping reaction on the Cap0 mRNA substrate, and a negative control is added as a comparison; finally, the reaction product is subjected to HPLC detection to detect the generation level of the reaction byproduct SAH, and the activity of mRNA 2'-O-methyltransferase is determined by drawing a standard curve and substituting the detection results of the enzyme to be tested into the standard curve for calculation. The negative control does not add mRNA 2'- O-methyltransferase to react, so no methyl transfer process occurs and no SAH is generated; if the mRNA 2'-O-methyltransferase is inactive, the result is the same as the negative control; if the mRNA 2'-O-methyltransferase is active, HPLC can detect the generation of SAH.

[0135] The main advantages of the present invention include:

[0136] 1) High safety, no radioactive pollution, no need for strict grade laboratories;

[0137] 2) The substrate ssRNA used is a short fragment of Cap0 mRNA with a length of 15-50 nt, which only involves a one-step Cap1 RNA activity detection system, and does not require a Cap0+Cap1 activity detection system;

[0138] 3) Simple operation, only one step is required for testing;

[0139] 4) The amount of by-products generated in the reaction is calculated through the standard curve drawn by the standard enzyme, and the enzyme activity of the enzyme to be tested is accurately quantified. The enzyme activity can be detected stably, accurately and efficiently, and is suitable for application in industrial production.

[0140] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify detailed conditions are usually based on conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0141] Example 1: RNA sample preparation

[0142] 1. Sample and material preparation

[0143] a. Materials, reagents and instruments: RNase inhibitor, Suzhou Nearshore Protein Technology Co., Ltd., catalog number: E125; 10× Capping Reaction Buffer, Suzhou Nearshore Protein Technology Co., Ltd., catalog number: E131; SAM, Suzhou Nearshore Protein Technology Co., Ltd.; DEPC-H2O, water sterilized after treatment with diethyl pyrocarbonate; SAH standard, Sinopharm; 0.2ml EP tube, PCR instrument, Qubit nucleic acid detector, etc.

[0144] b. Sample: Standard RNA methyltransferase with known activity, taking mRNA Cap 2'-O methyltransferase as an example.

[0145] 2. Preparation process of substrate Cap 0 mRNA

[0146] (1) Template preparation:

[0147] IVT-Probe-F / R annealing to obtain DNA template, the reaction process is as follows:

[0148] Design the following primers, where T7-F contains the T7 promoter sequence:

[0149] IVT-Probe-F: GCTAATACGACTCACTATAGGGAATTCCACCACGTTCCCGT (SEQ ID NO.1);

[0150] IVT-Probe-R: ACGGGAACGTGGTGGAATTCCC (SEQ ID NO. 2);

[0151] 10μΜ IVT-Probe-F / R 1:1 was mixed and denatured at 95℃. After annealing to room temperature, a 200ng / μl DNA fragment containing the target gene was obtained. After in vitro transcription of RNA reaction, 2U DNase I was added at 37℃ for 30min. After magnetic bead purification, a 22nt ssRNA was obtained;

[0152] The nucleotide sequence of the 22nt ssRNA is: GGGAAUUCCACCACGUUCCCGU (SEQ ID NO. 3).

[0153] (2) The vaccinia virus capping enzyme is used to transcribe the Cap0 mRNA substrate. The reaction system is shown in Table 1 below:

[0154] Table 1

[0155]

[0156] After the reaction system was reacted at 37°C for 1 hour (temperature controlled by PCR instrument), the obtained Cap0 mRNA was immediately purified by Trizol purification method to obtain Cap0 mRNA substrate, and the concentration was measured by Nanodrop and stored at -20°C for future use.

[0157] 3. Cap1 capping reaction:

[0158] Place the Cap 0 mRNA substrate in a PCR instrument at 65℃ for 5 minutes, and immediately place on ice for 5 minutes after the reaction. The mRNACap 2'-O methyltransferase standard enzyme was diluted to 25 U / µl, 20 U / µl, 15 U / µl, 10 U / µl and 5U / µl in a 20µl dilution system, and the Cap1 capping reaction was performed in sequence according to the RNA capping reaction system (Table 2 below). The composition of the reaction system is shown in Table 2. In addition, the composition of the negative test system is the same, except that 1μl of the dilution system (i.e., 0U of the 2'-O methyltransferase standard enzyme) was added.

[0159] Table 2

[0160]

[0161] After testing, increasing the amount of SAM added to the enzyme activity test system (optimal concentration range 20mM-40mM) is conducive to increasing the stability of the results and avoiding the error caused by partial degradation of SAM; increasing the amount of RNase inhibitor (optimal concentration range 20U / µl-60U / µl) is conducive to improving the stability of the substrate RNA in the enzyme activity test system and reducing the error caused to the results. According to the results of the standard curve, the concentration range of multiple batches of enzymes to be tested was tested, indicating that the enzyme to be tested was within the optimal range of the standard curve at 0.15mg / ml. Therefore, the enzymes to be tested were diluted to 0.15mg / ml, added to the reaction system shown in Table 3 below, and repeated 3 times:

[0162] Table 3

[0163]

[0164] After the above reaction system reacts at 37℃ for 1h (temperature controlled by PCR instrument), add 1µl 50mM EDTA and mix well. Centrifuge at 12,000 for 3-5min and draw 40µl of the supernatant (reaction product) into a sample injection bottle for HPLC analysis; or store at -20℃ for future use. The HPLC chromatographic conditions are as follows:

[0165] Mobile phase: 3%-6% methanol (containing 0.1%-0.3% glacial acetic acid).

[0166] Gradient elution program:

[0167] First, flush with 100% methanol at a flow rate of 1.0 ml / min for 30 minutes (this step can be omitted if the chromatographic column is not replaced later), and then flush with the above mobile phase at a flow rate of 1.0 ml / min until the baseline is stable. Inject according to the set program, flow rate 1.0 ml / min, column temperature 26℃, maximum pressure limit 400 bar, injection volume 10μl.

[0168] Example 2: A method for detecting mRNA 2'-O-methyltransferase activity

[0169] 1. Sample and material preparation

[0170] a. Materials, reagents and instruments: Agilent liquid chromatograph.

[0171] b. Samples: reaction product in Example 1, SAH standard (Sigma).

[0172] 2. Determination of SAH peak time

[0173] Take 10 μl of SAH standard of a certain concentration (50 μM) and any positive reaction system in Example 1, inject into liquid chromatograph for measurement, and determine the peak time of SAH in the reaction system. The results are as follows: Figure 1 As shown, the peak time of SAH in the actual reaction system, i.e., the mRNA 2'-O-methyltransferase activity detection reaction system, is about 15-16 minutes, which is the same as the peak time of SAH standard.

[0174] 3. HPLC determination:

[0175] First flush with 100% methanol at a flow rate of 1.0 ml / min for 30 minutes (this step can be omitted if the chromatographic column is not replaced later), and then flush with the above mobile phase at a flow rate of 1.0 ml / min until the baseline is stable. Inject according to the set program, flow rate 1.0 ml / min, column temperature 26°C, maximum pressure limit 400 bar. Take 10 μl of the test solution and inject it into the liquid chromatograph for measurement. Obtain the SAH chromatographic peak intensity data of the corresponding quantitative signal of each standard enzyme concentration gradient. According to the data shown in Table 4 below, use the enzyme amount gradient of each standard as the horizontal coordinate and the SAH peak area as the vertical coordinate to draw a standard curve, as shown Figure 2 Substitute the average SAH peak area of ​​the sample to be tested into the linear equation of the standard curve for calculation to obtain the enzyme activity of the sample to be tested.

[0176] Table 4

[0177]

[0178] Figure 2 The results showed that the standard curve y=ax was drawn with the enzyme amount (U / µl) as the horizontal axis and the SAH peak area (mAU) as the vertical axis. The vertical intercept was calibrated to 0, and the standard curve y=4.5496x was obtained. 2 =0.9982.

[0179] Activity detection of the enzyme to be tested: Preliminary experiments were conducted on multiple batches of the enzyme to be tested by gradient dilution according to the concentration. It was found that each batch was within the optimal range of the standard curve at a concentration of 0.15 mg / ml. Therefore, for the activity detection of the enzyme to be tested, all were diluted to 0.15 mg / ml for testing. Any batch of the enzyme to be tested was selected for HPLC detection, which was repeated 3 times. The results are shown in Table 5 below:

[0180] Table 5

[0181]

[0182] Substitute the average value into the standard curve y = 4.5496x, and calculate the enzyme activity when the original enzyme concentration is 2.54mg / ml. (For example, the enzyme activity when the original enzyme concentration is diluted 16.9 times to 0.15mg / ml = 69.973 / 4.5496 = 15.380U / µl, then the enzyme activity when the original enzyme concentration is 2.54mg / ml = 15.380*dilution factor (16.9) = 260.435U / µl). The results are shown in Table 6 below:

[0183] Table 6

[0184]

[0185] Test results such as Figure 2 As shown in the figure, a standard curve is plotted with enzyme amount (U / µl) as the horizontal axis and SAH peak area (mAU) as the vertical axis. 2 =0.9982. When the enzyme amount is 0 in Table 4, SAH is also 0, indicating that there should be no SAH generated in the negative control group, while the SAH generated in Table 5 is greater than 0, indicating that SAH is generated in the test group, proving that the test enzyme is active. The mean value of the SAH peak area of ​​the test enzyme is substituted into the standard curve, and the original enzyme activity (i.e., the total enzyme activity of the original enzyme concentration (2.54 mg / ml)) shown in Table 6 is calculated to be 260.435 U / µl.

[0186] Example 3: Validation of RNA methyltransferase activity detection method

[0187] According to the test method of this embodiment, linearity, accuracy, intermediate precision and substrate compatibility were verified.

[0188] 1. Accuracy

[0189] The mRNA 2'-O-methyltransferase obtained by detecting the activity in Example 2 was used to make its concentration reach 80%, 100%, and 120% of its content, respectively. The enzyme activity was determined according to the method described in Example 2 above. Each concentration was repeated 3 times, and the sample recovery rate (recovery rate = actual measured value / theoretical value) and relative deviation of each concentration were calculated respectively. The test results are shown in Table 7 below:

[0190] Table 7

[0191]

[0192] The results in Table 7 show that the sample recovery rates of mRNA 2'-O-methyltransferase at various concentrations are in the range of 80% to 120%, and RSD is ≤10%, and the experimental results meet the standards.

[0193] 2. Intermediate precision

[0194] In order to investigate the similarity of the results obtained by different analysts at different times for the same sample under the same experimental conditions, the same mRNA cap 2'-O-methyltransferase activity was tested by experimenter 2 at different times according to the established method, and the test was repeated 6 times. The results of the repeated measurements by experimenter 1 and experimenter 2 were calculated, and the RSD (n = 12) values ​​of the mRNA cap 2'-O-methyltransferase activity were calculated for 12 times. The test results are shown in Table 8:

[0195] Table 8

[0196]

[0197] The test results shown in Table 8 show that the RSD (n=12) of the mRNAcap2'-O-methyltransferase detection activity is ≤10.0%. The experimental results all meet the standards.

[0198] 3. Linear

[0199] Since the amount of substrate in the enzymatic reaction is fixed, the enzyme activity concentration of the added enzyme solution must be within the linear range of the assay. The RNA methyltransferase standard was diluted and a gradient solution (25, 20, 15, 10, 5, 0 U / µl) was prepared for assay. The peak area measured by HPLC was used as a representation of the amount of SAH generated. The linearity between the enzyme concentration and the SAH peak area was observed, and the R value of the standard curve was calculated. 2 The results are shown in Table 9 and Figure 3 shown.

[0200] Table 9

[0201]

[0202] Table 9 and Figure 3 The results show that the enzyme activity of RNA methyltransferase has a good linear relationship in the range of 0-25 U / µl (R 2 =0.9965).

[0203] 4. Substrate compatibility

[0204] In order to select a suitable substrate, the present invention tested both long fragment and short fragment RNA substrates.

[0205] Taking 807nt ssRNA as an example, the chromatographic peak stability of long-fragment Cap 0 mRNA in the reaction system was tested. The specific steps are: design the primers shown below, where T7-F carries the T7 promoter sequence:

[0206] IVT-807-F:GCTAATACGACTCACTATAGGGAGACCTCTCGCCAAAGGAATGCA (SEQ ID NO.4);

[0207] IVT-807-R:TTCAGCTCGATGCGGTTCAC (SEQ ID NO.5); a DNA fragment containing the target gene was amplified from the plasmid (as shown in SEQ ID NO.6); an in vitro RNA transcription reaction was performed, and 2U DNase I was added after the reaction was completed, and the reaction was incubated at 37°C for 30 minutes. After purification by magnetic beads, a long ssRNA with a length of 807 nt was obtained; the ssRNA with a length of 807 nt was capped by vaccinia virus capping enzyme, and the long Cap 0 mRNA substrate for the test was obtained after purification.

[0208] Taking 22 nt ssRNA as an example, the chromatographic peak stability of short-fragment Cap 0 mRNA in the reaction system was tested. The specific steps are as shown in Example 1: designing primers, wherein T7-F carries a T7 promoter sequence;

[0209] IVT-Probe-F: GCTAATACGACTCACTATAGGGAATTCCACCACGTTCCCGT (SEQ ID NO.1);

[0210] IVT-Probe-R: ACGGGAACGTGGTGGAATTCCC (SEQ ID NO.2); a DNA fragment containing the target gene was obtained by primer annealing; an in vitro RNA transcription reaction was performed, and 2U DNase I was added after the reaction was completed, and the reaction was incubated at 37°C for 30min. A short ssRNA fragment with a length of 22nt was obtained after magnetic bead purification (SEQ ID NO.3); the ssRNA with a length of 22nt was capped by vaccinia virus capping enzyme, and the short fragment Cap 0 mRNA substrate for the test was obtained after purification.

[0211] The two substrates were reacted according to the activity detection reaction system and then detected by HPLC.

[0212] The results are as follows Figure 4 As shown, it was found that the long fragment Cap 0 mRNA substrate was unstable in the chromatographic test, with unexplained double peaks, which made it impossible to effectively and accurately quantify SAH, such as Figure 4 As shown in the dashed box;

[0213] The short-fragment Cap 0 mRNA substrate with a length of 22 nt performed well, the SAH peak position was not disturbed, no double peaks appeared, and SAH could be effectively and accurately quantified. Figure 4 shown.

[0214] The possible reason is that the secondary structure of the long RNA fragment has a certain influence on the peak. However, the short Cap 0 mRNA is less affected by the secondary structure, and the DNA template is based on the annealing of chemically synthesized primers, the DNA template has fewer impurities and high transcription stability. Therefore, the short Cap 0 ssRNA was selected as the substrate of the final activity detection system.

[0215] Example 4: Applicability of other RNA methyltransferase activity assays

[0216] Taking the vaccinia virus capping enzyme as an example, the vaccinia virus capping enzyme has RNA methyltransferase activity that depends on SAM as a donor, and the enzyme activity is detected according to the HPLC scheme of the present invention.

[0217] 1. Sample and material preparation

[0218] a. Materials, reagents and instruments: RNase Inhibitor, Novoprotein (Near Shore Protein Technology Co., Ltd.), catalog number: E125; 10× capping reaction buffer, Novoprotein (Near Shore Protein Technology Co., Ltd.), catalog number: E131; SAM, Novoprotein (Near Shore Protein Technology Co., Ltd.); DEPC-H2O, water sterilized after treatment with diethyl pyrocarbonate; SAH standard, Sinopharm; 0.2 ml EP tube, PCR instrument, Qubit nucleic acid detector, etc.

[0219] b. Sample: 22nt ssRNA (sequence as shown in SEQ ID NO.3), standard vaccinia virus capping enzyme with known activity.

[0220] 2. For the Cap0 capping reaction, place the substrate ssRNA in a PCR instrument at 65°C for 5 minutes. Immediately place on ice for 5 minutes after the reaction is completed. Dilute the vaccinia virus capping enzyme standard enzyme to 10 U, 8 U, 6 U, 4 U, 2 U, and 0 U in 20 µl of dilution system. Perform the capping reaction in sequence according to the RNA capping reaction system (see Table 10 below). Add the following configuration reaction system:

[0221] Table 10

[0222]

[0223] After the above reaction system reacts at 37℃ for 1h (temperature controlled by PCR instrument), add 1µl 50mM EDTA and mix well. Centrifuge at 12,000 for 3-5min and aspirate 40µl of the supernatant into a sample injection bottle for HPLC analysis; or store at -20℃ for future use.

[0224] 3. HPLC detection

[0225] Take 10 μl of the test solution and inject it into the liquid chromatograph for determination. The HPLC chromatographic conditions are as follows:

[0226] Mobile phase: 3%-6% methanol (containing 0.1%-0.3% glacial acetic acid).

[0227] Gradient elution program:

[0228] First, flush with 100% methanol at a flow rate of 1.0 ml / min for 30 minutes (this step can be omitted if the chromatographic column is not replaced later), and then flush with the above mobile phase at a flow rate of 1.0 ml / min until the baseline is stable. Inject according to the set program, flow rate 1.0 ml / min, column temperature 26℃, maximum pressure limit 400 bar, injection volume 10μl.

[0229] Obtain the SAH chromatographic peak intensity data of the corresponding quantitative signal of each standard enzyme concentration gradient. Draw a standard curve with each standard enzyme concentration gradient as the horizontal axis and SAH peak area as the vertical axis, such as Figure 5 Substitute the average SAH peak area of ​​the sample to be tested into the linear equation of the standard curve for calculation to obtain the enzyme activity of the sample to be tested.

[0230] Figure 5 The results showed that the standard curve was drawn with the enzyme amount (U / µl) as the horizontal axis and the SAH peak area (mAU) as the vertical axis. The vertical intercept was calibrated to 0, and the standard curve y=ax, a=4.9442, R 2 =0.9985.

[0231] The results of the enzyme activity test are shown in Table 11:

[0232] Table 11

[0233]

[0234] Substitute the average value into the standard curve y = 4.9442x to calculate the enzyme activity when the original enzyme concentration is 2 mg / ml (for example, the enzyme activity when the original enzyme concentration is diluted 80 times to 0.025 mg / ml = 47.884 / 4.9442 = 9.685 U / µl, then the enzyme activity when the original enzyme concentration is 2 mg / ml = 9.685*dilution factor (80) = 774.8 U / µl). The results are shown in Table 12 below:

[0235] Table 12

[0236]

[0237] Test results:

[0238] Figure 5The standard curve is plotted with enzyme amount (U / µl) as the horizontal axis and SAH peak area (mAU) as the vertical axis. 2 =0.9985,. The negative control group should have no SAH generated, and the test group has SAH generated, which proves that the test enzyme is active. The mean SAH peak area of ​​the test enzyme is substituted into the standard curve y=4.9442x, and the original enzyme activity (i.e., the total enzyme activity when the original enzyme concentration is 2 mg / ml) as shown in Table 12 is calculated to be 774.800 U / µl. This shows that the scheme of the present invention is also applicable to the detection of the enzymatic activity of the vaccinia virus capping enzyme. This scheme is universal and suitable for the activity detection of RNA methyltransferases that rely on SAM as a donor.

[0239] The sequence information involved in the present invention is as follows:

[0240] SEQ ID NO.1 (IVT-Probe-F):

[0241] GCTAATACGACTCACTATAGGGAATTCCACCACGTTCCCGT

[0242] SEQ ID NO.2 (IVT-Probe-R):

[0243] ACGGGAACGTGGTGGAATTCCC

[0244] SEQ ID NO.3 (nucleotide sequence of 22nt ssRNA):

[0245] GGGAAUUCCACCACGUUCCCGU

[0246] SEQ ID NO.4 (IVT-807-F):

[0247] GCTAATACGACTCACTATAGGGAGACCTCTCGCCAAAGGAATGCA

[0248] SEQ ID NO.5 (IVT-807-R):

[0249] TTCAGCTCGATGCGGTTCAC

[0250] SEQ ID NO.6 (nucleotide sequence of the DNA fragment of the target gene):

[0251] GGGAGACCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCAC GTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAAA CACGATGATAATATGGCCACAACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCA CCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAA

[0252] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A method for detecting RNA methyltransferase activity, characterized in that: The following steps are involved: (S1) providing Cap0 mRNA with a length of 22 nt as a reaction substrate; the Cap0 mRNA is a single-stranded RNA molecule with a nucleotide sequence as shown in SEQ ID NO.3; (S2) performing the following test reactions on the RNA molecules in (S1), respectively, wherein the test reactions include reactions in a negative test system, a first test system, and a second test system, and the reaction time is t, wherein: In the negative test system, no enzyme is included; In the first test system, a standard enzyme of RNA methyltransferase is included; The second test system includes the RNA methyltransferase to be detected; (S3) detecting the amount of SAH generated in the negative test system, the first test system, and the second test system, which are recorded as A0, A1, and A2, respectively; (S4) obtaining a detection result of the RNA methyltransferase activity to be detected based on the analysis of the SAH generation amounts A0, A1, and A2; The amount of SAH generated in the negative test system is A0; in the first test system, when the amount of the standard enzyme of RNA methyltransferase is C1, the amount of SAH generated is A1; the amount of SAH generated in the second test system is A2; wherein A0 represents the quality control value, i.e., the amount of SAH generated in the negative test system; A1 represents the amount of SAH generated by the standard enzyme of RNA methyltransferase when the enzyme amount is C1; A2 represents the amount of SAH generated by the RNA methyltransferase to be detected; If A0=0, the test system is considered normal; if A0>0, the test is considered failed; If the standard curve is drawn with the amount of standard enzyme as the horizontal axis and the amount of SAH generated as the vertical axis, and the vertical intercept is calibrated to 0, the standard curve y=ax is obtained, and R2≥0.99, then the standard curve is considered to be successfully drawn; If A2>0, the RNA methyltransferase to be tested is considered to have enzymatic activity, activity = A2 / a; If A2 = 0, the RNA methyltransferase to be detected is considered inactive; The test results are quantitative results; The negative test system is completely identical to the first test system in other reaction conditions, except that the first test system contains a standard enzyme of RNA methyltransferase; The other reaction conditions in the first test system and the second test system are exactly the same, the only difference is that the second test system contains the RNA methyltransferase to be detected; Furthermore, in the negative test system, the first test system, and the second test system, SAM, 10× capping reaction buffer, and RNase inhibitor are independently contained; the final concentration of the RNA is independently 150μg / 500μl-350μg / 500μl; the final concentration of the SAM is 0.5 mM-1.0 mM, and the final concentration of the RNase inhibitor is 0.5 U / μl-2 U / μl; the final concentration of the RNA methyltransferase standard enzyme is 0.1U / μl-0.5 U / μl; the final concentration of the RNA methyltransferase to be detected is 0.05mg / ml-0.2 mg / ml; (S1) also includes: (S1.1) Provide a DNA of a target gene; (S1.2) in vitro transcribing the DNA in (S1.1) to obtain mRNA transcribed from the DNA; (S1.3) DNA transcribed mRNA to obtain capped Cap0 mRNA.

2. The method according to claim 1, characterized in that providing a first buffer system for a test reaction; Take out one portion as the negative test system; divide the remaining first buffer system into at least two portions, which are recorded as A and B buffer systems, wherein: Adding a standard enzyme of RNA methyltransferase to the A buffer system as the first test system; Adding the RNA methyltransferase to be detected into the buffer system B as the second test system; In the negative test system, the first test system, and the second test system, the final concentration of the RNA is independently 250 μg / 500 μl.

3. The method according to claim 1, characterized in that The step (S1) comprises: (S1a) DNA with a purity of 200-1500 ng / μl is synthesized by chemical method; the length of the DNA is 22 nt; (S1b) the DNA is transcribed to obtain ssRNA, wherein the ssRNA has a length of 22 nt; (S1c) The ssRNA is subjected to a Cap0 capping reaction to obtain Cap0 ssRNA as a reaction substrate.

4. The method according to claim 1, characterized in that The non-interfering matching structure of the single-stranded RNA molecule; (S3), comprising: (S3.1) Setting chromatographic conditions suitable for SAH separation; (S3.2) Drawing a standard curve for RNA methyltransferase: Gradually dilute the RNA methyltransferase standard enzyme in the second test system into RNA methyltransferase standard enzyme solutions with different enzyme amounts, and draw a standard curve y=ax under the chromatographic conditions of (S3.1), based on the SAH peak area in the liquid chromatography, with the enzyme amount of the RNA methyltransferase standard enzyme as the abscissa and the SAH peak area as the ordinate, and calibrate the ordinate intercept to 0; (S3.3) Calculate the content of SAH: Under the chromatographic conditions described in (S3.1), respectively detect the first test system, the second test system and the negative control group, obtain the corresponding SAH peak areas, substitute them into the standard curves in (S3.2) for calculation, and obtain the corresponding RNA methyltransferase enzyme amounts in the first test system, the second test system and the negative control group.

5. The method according to claim 1, characterized in that The analysis described in step (S4) is to convert the known concentration of the RNA methyltransferase standard enzyme to obtain the RNA methyltransferase activity to be detected.

6. A kit for detecting RNA methyltransferase activity, characterized in that: The kit comprises: (a) a first container, and a negative test system located in the first container; (b) a second container, and a first test system located in the second container; (c) a third container, and a second test system located in the third container; (d) a fourth container, and a reaction substrate in the fourth container; the reaction substrate is Cap0 mRNA with a length of 22 nt; the nucleotide sequence of the Cap0 mRNA is shown in SEQ ID NO.3; wherein, The negative test system does not contain an enzyme; the first test system contains an RNA methyltransferase standard enzyme; the second test system contains an RNA methyltransferase to be detected; the final concentration of the RNA methyltransferase standard enzyme is 0.1 U / μl-0.5 U / μl.

7. The kit for detecting RNA methyltransferase activity according to claim 6, wherein The RNA methyltransferase standard enzyme is used to draw a standard curve of RNA methyltransferase.

8. A detection device for RNA methyltransferase activity, characterized in that: The device comprises: (d1) a reaction module, wherein the reaction module comprises a negative control chamber, a first reaction chamber, and a second reaction chamber, wherein: The negative control chamber contains the negative test system and reaction substrate; The first reaction chamber comprises a first reaction module, wherein the first reaction module comprises a first test system and a reaction substrate; The second reaction chamber comprises a second reaction module, and the second reaction module comprises a second test system and a reaction substrate; Wherein, the negative test system does not contain an enzyme; the first test system contains a standard enzyme of RNA methyltransferase; the second test system contains an RNA methyltransferase to be detected; the reaction substrate is Cap0 mRNA with a length of 22 nt; the Cap0 mRNA is a single-stranded RNA molecule with a nucleotide sequence as shown in SEQ ID NO.3; (d2) a data acquisition module, wherein the data acquisition module is configured to collect data on the SAH peak area in each reaction chamber in the reaction module; (d3) an analysis module, wherein the analysis module is configured to analyze the SAH peak area from the data acquisition module through a "peak area-enzyme amount" standard curve of RNA methyltransferase to obtain an analysis result of the RNA methyltransferase activity to be screened; (d4) an output module, wherein the output module outputs the analysis result of the screening analysis module; the final concentration of the standard enzyme of the RNA methyltransferase is 0.1 U / μl-0.5 U / μl.

Images