Development and application of dCAPs markers associated with carotenoid content in tomato fruit

Abstract

The application discloses a dCAPs marker related to tomato fruit carotenoid and development and application thereof. The application belongs to the technical field of biology and particularly relates to the dCAPs marker related to tomato fruit carotenoid and development and application thereof. The material for detecting the polymorphism or genotype of the SNP site in the tomato genome can be applied to identifying or assisting in identifying the tomato fruit color character and tomato breeding, wherein the SNP site is a site on the first chromosome of the tomato, the nucleotide type is C or T, and is the 60th nucleotide in sequence 1 in the sequence table. When breeding the tomato variety with red fruit color (rich in lycopene), the tomato with the genotype of TT or CT at the SNP1 site is preferably selected as the parent for breeding; when breeding the tomato variety with yellow fruit color (rich in xanthophyll and other yellow carotenoids), the tomato with the genotype of CC at the SNP1 site is preferably selected as the parent for breeding.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to development and application of dCAPs markers related to carotenoid in tomato fruit. BACKGROUND

[0002] Carotenoids play an important role in human health, and have the effects of improving cardiovascular and cerebrovascular diseases, improving immunity, inhibiting tumor cell proliferation, reducing the incidence of senile cataract, protecting nerves and myocardium, etc. However, humans cannot synthesize carotenoids by themselves, and can only obtain carotenoids through diet.

[0003] Tomato fruit is rich in carotenoids, and is one of the important diets for humans to obtain carotenoids. China is one of the major tomato producing and consuming countries in the world, and the sowing area and total output thereof account for about one fifth and one third of the world respectively in recent years, and has been ranked first in the world. Tomato production is one of the pillar industries for farmers to increase income and one of the important ways for export and foreign exchange.

[0004] Carotenoid (especially lycopene) content is one of the important quality traits of tomato, and the types and content of carotenoids not only determine the color of tomato fruit, but also determine the nutritional value. The carotenoids in red fruit are mainly lycopene, and the carotenoids in yellow fruit can be lutein, a-carotene, β-carotene, etc., and different types of carotenoids have different nutritional values. Cultivating a variety with high carotenoid content helps to promote the improvement of tomato fruit quality and enhance the international competitiveness of tomato varieties, and is one of the main breeding objectives of China's tomato.

[0005] There are many studies on carotenoid biosynthesis and metabolism, and not only the related genes are cloned, but also the regulation mechanism and network thereof are deeply analyzed, but so far it is still impossible to completely directionally breed tomato varieties with specific carotenoid components. Exploring mutants related to carotenoid accumulation in tomato fruit and developing molecular markers that can be used for screening mutants can promote the identification and cultivation of tomato varieties with specific carotenoid composition. SUMMARY

[0006] The problem to be solved by the present application is how to identify or assist in identifying the color of tomato fruit and quickly breed tomato varieties with high carotenoid content.

[0007] In order to solve the above technical problems, the present application first provides an application of a substance for detecting the polymorphism or genotype of SNP in the genome of tomato in any one of the following:

[0008] (1) identifying or assisting in identifying the color trait of tomato fruit;

[0009] (2) screening or breeding tomato plants or strains or lines or varieties with yellow fruit color;

[0010] (3) screening or selecting tomato single plant or strain or line or variety with red fruit color;

[0011] (4) tomato breeding;

[0012] (5) preparing a product for identifying or assisting in identifying tomato fruit color trait;

[0013] (6) preparing a product for screening or selecting tomato single plant or strain or line or variety with yellow fruit color;

[0014] (7) preparing a product for screening or selecting tomato single plant or strain or line or variety with red fruit color;

[0015] (8) preparing a product for tomato breeding;

[0016] With the tomato genomic sequence of cultivated tomato Heinz 1706 as the reference genome (http: / / solgenomics.net / organism / Solanum_lycopersicum / genome), the SNP is a site on the chromosome 1 of tomato, and the specific position is 83792012bp, and the nucleotide type is C or T, which is the 60th nucleotide of sequence 1 in the sequence table.

[0017] The application further provides a method for identifying or assisting in identifying tomato fruit color trait, comprising detecting the genotype of the SNP in the genome of the to-be-tested tomato, and identifying or assisting in identifying the tomato fruit color trait according to the genotype, wherein the SNP is a site on the chromosome 1 of tomato, and the nucleotide type is C or T, which is the 60th nucleotide of sequence 1 in the sequence table.

[0018] In the above application or method, the genotype of the SNP is CC or TT, the CC is the homozygous type of the SNP site being C, the TT is the homozygous type of the SNP site being T, and the CT genotype is the heterozygous type of the SNP being C and T.

[0019] In the above application or method, the identification or assistance in identifying the tomato fruit color trait according to the genotype of the SNP is any of the following modes:

[0020] 1) the to-be-tested tomato with the genotype CC of the SNP is or is a candidate for the tomato with yellow fruit color;

[0021] 2) the to-be-tested tomato with the genotype TT or CT of the SNP is or is a candidate for the tomato with red fruit color.

[0022] As an embodiment, the method for identifying or assisting in identifying the fruit color trait of tomato can comprise the following steps:

[0023] (1) Using genomic DNA of the tomato to be tested as a template, PCR amplification is performed using the following primer combination; the primer combination consists of primer dCAPs-BamH I-F and primer dCAPs-BamH I-R;

[0024] The primer dCAPs-BamH I-F is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 2 in the sequence listing;

[0025] The primer dCAPs-BamH I-R is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 3 in the sequence listing.

[0026] (2) After step (1) is completed, the PCR product is digested with restriction enzyme BamH I, and then the digested product is subjected to gel electrophoresis to determine the genotype of the SNP of the tomato to be tested;

[0027] (3) According to the genotype result, the fruit color trait of the tomato to be tested is identified: the tomato to be tested with the genotype CC (the size of the digested product is two fragments of 122 bp and 59 bp) has yellow fruit color, and the tomato to be tested with the genotype TT (only containing a fragment with a size of 181 bp, i.e., not being digested by BamH I) or CT (the size of the digested product is three fragments of 181 bp, 122 bp and 59 bp) is or is a candidate for tomato with red fruit color.

[0028] The application of the above-mentioned method for identifying or assisting in identifying the fruit color trait of tomato in tomato breeding also belongs to the protection scope of the present application.

[0029] The present application also provides a method for tomato breeding.

[0030] The method for tomato breeding provided by the present application can be M1 or M2:

[0031] M1, the method comprises detecting the genotype of the SNP described above in the genome of the tomato, selecting the tomato with the genotype CC of the SNP as the parent for breeding, the CC is the homozygous type of C of the SNP, and the breeding purpose of the method includes breeding the tomato with yellow fruit color;

[0032] M2, the method comprises detecting the genotype of the SNP described above in the genome of the tomato, selecting the tomato with the genotype TT or CT of the SNP as the parent for breeding, the TT is the homozygous type of T of the SNP site, and the CT genotype is the heterozygous type of C and T of the SNP; the breeding purpose of the method includes breeding the tomato with red fruit color.

[0033] The present application also provides products containing substances for detecting the polymorphism or genotype of the SNP site in the tomato genome, which can be any one of the following,

[0034] C1) products for detecting the single nucleotide polymorphism or genotype related to the fruit color trait of tomato;

[0035] C2) products for identifying or assisting in identifying the fruit color trait of tomato;

[0036] C3) products for tomato breeding;

[0037] C4) products for screening or selecting tomato single plants or lines or strains or varieties with yellow fruit color;

[0038] C5) products for screening or selecting tomato single plants or lines or strains or varieties with red fruit color.

[0039] In the above-mentioned applications, methods and products, the substances can be reagents and / or instruments required for determining the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction enzyme digestion fragment color polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography and SNP chip. Among them, the SNP chip includes chips based on nucleic acid hybridization reaction, chips based on single base extension reaction, chips based on allele-specific primer extension reaction, chips based on "one-step" reaction, chips based on primer ligation reaction, chips based on restriction enzyme reaction, chips based on protein DNA binding reaction, and chips based on fluorescent molecule DNA binding reaction.

[0040] Alternatively, the substances can be D1), D2) or D3) as follows:

[0041] D1) a primer composition containing amplified fragments of the tomato genomic DNA including the SNP site;

[0042] D2) PCR reagents containing the primer composition of D1);

[0043] D3) a kit containing the primer composition of D1) or the PCR reagents of D2).

[0044] Alternatively, the amplification can be PCR amplification. The primer composition consists of the dCAPs-BamH I-F and primer dCAPs-BamH I-R.

[0045] In the above applications, methods and products, the primer composition can or can not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as 32 P; binding moieties such as biotin; haptens such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with a nucleic acid or protein sequence, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., the sequence is directly read).

[0046] In the above applications, methods or products, the primer composition can specifically consist of primer dCAPs-BamH I-F and primer dCAPs-BamH I-R; the primer dCAPs-BamH I-F is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 2; and the primer dCAPs-BamH I-R is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 3.

[0047] The present application also provides a DNA molecule, the nucleotide sequence of which is shown in SEQ ID NO: 1, wherein y represents C or T.

[0048] The above DNA molecule also falls within the scope of protection of the present application. The application of the above DNA molecule can specifically be the application in any one of the following:

[0049] (1) identifying or assisting in identifying the fruit color trait of tomato;

[0050] (2) screening or breeding tomato plants or strains or lines or varieties with yellow fruit color of tomato;

[0051] (3) screening or breeding tomato plants or strains or lines or varieties with red fruit color of tomato;

[0052] (4) tomato breeding;

[0053] (5) preparing products for identifying or assisting in identifying the fruit color trait of tomato;

[0054] (6) preparing products for screening or breeding tomato plants or strains or lines or varieties with yellow fruit color of tomato;

[0055] (7) products for preparing a tomato single plant or strain or line or variety with red fruit color;

[0056] (8) products for tomato breeding.

[0057] Optionally, in the above-mentioned applications, the DNA molecule is used as a detection target.

[0058] The substance for detecting the polymorphism and genotype of the SNP site can be combined with other substances (such as a substance for detecting a single nucleotide polymorphism or genotype of another molecular marker associated with the tomato fruit color trait) to prepare a product for identifying the tomato fruit color trait.

[0059] The present application obtains a mutant yfm with changed carotenoid composition in the fruit through tissue culture, and the fruit color of the mutant yfm changes from red to yellow or orange. Genetic analysis and gene mapping results show that the mutation is controlled by a gene different from all known yellow fruit mutants. According to the sequence difference between the original material and the mutant based on the YFM gene sequence, the present application develops a dCAPs marker and verifies the practicability of the marker, which provides a reliable molecular marker for cultivating new tomato varieties containing specific carotenoids by using marker-assisted selection.

[0060] DEPOSIT DESCRIPTION

[0061] Seed name: tomato

[0062] Latin name: Solanum lycopersicum

[0063] Reference biological material (strain): yfm

[0064] Preservation agency: China General Microbiological Culture Collection Center

[0065] Abbreviation of the preservation agency: CGMCC

[0066] Address: No. 3, Beichen West Road, Beijing City, China

[0067] Preservation date: May 23, 2024

[0068] Preservation center registration number: CGMCC No. 46081. BRIEF DESCRIPTION OF DRAWINGS

[0069] Figure 1The amplification results of the primers dCAPs-BamH I-F and dCAPs-BamH I-R in the F2(a) population using the molecular marker dCAPs-BamH I. 1: yellow fruit color, high carotenoid content (two bands of 122 bp and 59 bp of enzyme digestion products); 2: red fruit color (one band of 181 bp); 3: red fruit color (three bands of 181 bp, 122 bp, and 59 bp of enzyme digestion products).

[0070] Figure 2 The amplification results of the primers dCAPs-BamH I-F and dCAPs-BamH I-R in the F2(b) population using the molecular marker dCAPs-BamH I. A: yellow fruit parent yfm; B: red fruit parent PI 128216; C: red fruit parent OH88119. DETAILED DESCRIPTION

[0071] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0072] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0073] The red fruit tomato materials OH 88119 and PI 128216 used in the following examples have been described in Li N, Zhang X, Yang W. Marker-assisted development and characterization of near-isogenic lines carrying the Rx4 gene for hypersensitive resistance to Xanthomonas euvesicatoria pv. perforans race T3 in tomato. Molecular Breeding, 2019, 39(12): 172. The biological materials can be obtained from the applicant, and can only be used for repeating the experiments of the application, and cannot be used for other purposes.

[0074] Example 1. Obtaining of dCAPs marker related to carotenoid in tomato fruit

[0075] 1. Construction of segregating population

[0076] In previous work, a tissue culture mutant material yfm of red fruit tomato material OH 88119 was obtained in the laboratory, and the fruit color of the material is yellow. A F2 generation segregating population F2(a) was constructed by using red fruit tomato material PI 128216 and yellow fruit tomato material yfm, and a total of 436 plants were obtained. According to the statistics of the fruit color trait in the segregating population, it was found that there were 338 red fruit single plants and 98 yellow fruit single plants in F2(a).

[0077] 2. Development of molecular markers

[0078] Firstly, the whole genome InDel marker developed by using the reference genome of Lycopersicon pimpinellifolium material LA 1589 (https: / / solgenomics.net / organism / Solanum_pimpinellifolium / genome) and the genome information of material OH 88119 was used for preliminary positioning, and it was determined that the gene causing the mutant phenotype was located on chromosome 1 of tomato. Then, whole genome resequencing was performed on tomato materials OH 88119 and mutant yfm, and molecular markers were developed according to the difference sites obtained from the resequencing data in the preliminary positioning interval, and the correlation between the molecular markers and the fruit color phenotype was verified. A molecular marker dCAPs-BamH I related to the carotenoid-related gene in tomato fruit color was obtained, which was located at a SNP site (referred to as SNP1) on chromosome 1 of tomato with a two-allele polymorphism, located at 83792012 bp of Heinz 1706 genome SL4.0 (http: / / solgenomics.net / organism / Solanum_lycopersicum / genome), which was the 60th nucleotide of sequence 1 in the sequence table, and the nucleotide type was C or T. The genotypes of the SNP1 site are as follows: CC or TT or TC. Among them, CC is the homozygous type of SNP1 site for C, TT is the homozygous type of SNP1 site for T, and CT is the heterozygous type of SNP1 site for C and T. The fruit color of tomato with genotype CT or TT of SNP1 is red phenotype, and the fruit color of tomato with genotype CC of SNP1 is yellow phenotype. In sequence 1, y represents C or T.

[0079] The identification primer group of dCAPs marker dCAPs-BamH I was designed according to the molecular marker of SNP site (SNP1) at position 83792012 of chromosome 1 of tomato, and the following primer was designed by selecting the enzyme cutting site of BamH I: dCAPs-BamH I-F: CGTCAATATATTCAAATGTTGTTATGATATGCAGGTTACAACGCCTGATGATTTG GA TC (SEQ ID No. 2)

[0080] dCAPs-BamH I-R: GGAAGGTTAACTTCACCTATTCAGA (SEQ ID No. 3)

[0081] (underlined is the introduced enzyme cutting site)

[0082] 3. Correlation analysis of molecular markers and high content of carotenoids (tomato fruit color)

[0083] The genomic DNA of F2(a) was extracted by the improved CTAB method, and PCR amplification was performed by using the molecular marker dCAPs-BamH I.

[0084] The PCR reaction system (total volume 20 μL) was as follows: genomic DNA of F2(a) 1 μL, 10×Buffer buffer 2 μL, dNTPs 0.8 μL, DNA polymerase 0.4 μL, primers dCAPs-BamH I-F and dCAPs-BamH I-R each 0.2 μL (10 μM / L), and ddH2O was added to 20 μL. The 10×Buffer buffer, dNTPs, and DNA polymerase used in the experiment were products of Novagen Company, and the item number was P115-02.

[0085] The PCR reaction program was as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 53°C annealing for 15 s, 72°C extension for 30 s, 35 cycles; and 72°C extension for 5 min.

[0086] The obtained PCR product was cut by using the restriction endonuclease BamH I, and the enzyme cutting system was as follows: PCR product 10 μL, 0.2 μL BamH I, 1 μL CutSmart Buffer, and 37°C enzyme cutting for more than 5 h. The BamH I endonuclease and CutSmart Buffer used in the experiment were products of NEBio labs Company, and the item number was R0136T. The obtained enzyme cutting product was electrophoresed by using agarose gel, and photographed in the gel imaging instrument.

[0087] The experimental results show that the length of the amplified product is polymorphic after the amplified product is amplified by using primers dCAPs-BamH I-F and dCAPs-BamH I-R and then is subjected to enzyme digestion. In the F2 generation population, there are three band types (1) a band near 200 bp; (2) a band near 100 bp; and (3) a band near 50 bp. Figure 1

[0088] The analysis of the relationship between the color of tomato fruit and the enzyme digestion product shows that the enzyme digestion product of yellow fruit tomato contains two bands of 122 bp and 59 bp (i.e., the genotype of SNP1 is CC); the enzyme digestion product of red fruit tomato contains two types, one of which is only one band of 181 bp (i.e., the genotype of SNP1 is TT), and the other of which contains three bands of 181 bp, 122 bp and 59 bp (i.e., the genotype of SNP1 is CT).

[0089] In the F2(a) population, the 98 single plants with two bands of 122 bp and 59 bp are all yellow, the 108 single plants with one band of 181 bp are all red, and the 230 single plants with three bands of 181 bp, 122 bp and 59 bp are all red. The enzyme digestion product of the PCR amplified fragment is consistent with the expected size, which confirms the effectiveness of the molecular marker.

[0090] In the breeding of red fruit tomato, the tomato with the genotype of TT or CT of SNP1 can be selected as the parent for breeding; in the breeding of yellow fruit tomato, the tomato with the genotype of CC of SNP1 can be selected as the parent for breeding.

[0091] Example 2, Application of the dCAPs Marker Related to Carotenoid of Tomato Fruit

[0092] 1. Experimental materials

[0093] The F2 generation separation population F2(b) is constructed by using red fruit tomato material OH 88119 and yellow fruit tomato material yfm, and the total number of the population is 234.

[0094] According to the statistics of the color trait of the fruit in the separation population, the results are shown in Table 1 and Figure 2 In the F2(b), the number of single plants with red fruit is 185, and the number of single plants with yellow fruit is 49.

[0095] 2. Genotype identification of the samples in the separation population F2(b) by using the molecular marker dCAPs-BamH I

[0096] ​According to the method of step 3 in Example 1, the DNA of the experimental material F2(b) above was subjected to PCR amplification using the molecular marker dCAPs-BamH I and its identification primer set dCAPs-BamH I-F and dCAPs-BamH I-R, and was subjected to enzyme digestion using BamH I, and the PCR reaction conditions, procedure and enzyme digestion system were all the same as above.

[0097] The results are shown in Table 1, in which 49 single plants with enzyme digestion products of two bands of 122 bp and 59 bp (genotype CC) were all yellow, 63 single plants with enzyme digestion product of one band of 181 bp (genotype TT) were all red, and 122 single plants with enzyme digestion products of three bands of 181 bp, 122 bp and 59 bp (genotype CT) were all red.

[0098] Table 1, Phenotype and genotype statistics of fruit color of F2 generation separation population F2(b)

[0099]

[0100]

[0101] In summary, the dCAPs marker related to carotenoid of tomato fruit developed in Example 1 was verified in two populations F2(a) and F2(b), and the consistency of the actual phenotype of tomato and the identification result of the molecular marker was 100%, which indicated that the marker dCAPs-BamH I and the primers used could be used for identifying the color of tomato fruit, and further for identifying the content of carotenoid of tomato varieties. When breeding tomato varieties with red fruit color (rich in lycopene), it is best to select tomatoes with genotype TT or CT at SNP1 site as parents for breeding; when breeding tomato varieties with yellow fruit color (rich in xanthophyll and other yellow carotenoids), it is best to select tomatoes with genotype CC at SNP1 site as parents for breeding.

[0102] The above has described the present application in detail. For those skilled in the art, without departing from the spirit and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, the present application is intended to include any changes, uses or improvements of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application.

Claims

1. The application of substances for detecting the genotype of SNP loci in the tomato genome in any of the following: (1) Identify the color characteristics of tomato fruits; (2) Screening or breeding tomato plants, strains, varieties or types with red fruit color; (3) Screening or breeding tomato plants, strains, varieties or types with yellow fruit color; (4) Tomato fruit color breeding; (5) Prepare products for identifying the color characteristics of tomato fruits; (6) Prepare or select products of tomato single plants, strains, varieties or cultivars with red fruit color; (7) Prepare or select products of tomato single plants, strains, varieties or cultivars with yellow fruit color; (8) Prepare products for tomato fruit color breeding; The SNP site is a site on tomato chromosome 1, and its nucleotide type is C or T, which is the 60th nucleotide of sequence 1 in the sequence listing.

2. A method for identifying the color characteristics of tomato fruits, characterized in that, This includes detecting the genotype of SNP sites in the genome of the tomato to be tested, and identifying the color trait of tomato fruit based on the genotype. The SNP site is a site on chromosome 1 of tomato, and its nucleotide type is C or T, which is the 60th nucleotide of sequence 1 in the sequence listing.

3. The application according to claim 1 or the method according to claim 2, characterized in that, The SNP genotype is CC, TT, or CT, where CC is a homozygous genotype of SNP C, TT is a homozygous genotype of SNP T, and CT is a heterozygous genotype of SNPs C and T; the identification of tomato fruit color traits based on the SNP genotype can be performed in any of the following ways: 1) The tomato to be tested with the SNP genotype CC is or a candidate tomato with yellow fruit color; 2) The tomatoes to be tested with the SNP genotype TT or CT are or candidates tomatoes with red fruit color.

4. The application of the method according to claim 2 or 3 in tomato breeding.

5. A method for tomato breeding, characterized in that, The method is M1 or M2. M1. The method includes detecting the genotype of the SNP in claim 1 in the tomato genome, selecting tomatoes with the genotype CC of the SNP as parents for breeding, wherein CC is a homozygous type of the SNP being C, and the purpose of the breeding method is to select tomatoes with yellow fruit color. M2. The method includes detecting the genotype of the SNP in claim 1 in the tomato genome, selecting tomatoes with the genotype of TT or CT of the SNP as parents for breeding, wherein TT is a homozygous type of the SNP with the genotype T, and the CT genotype is a heterozygous type of the SNP with the genotypes C and T. The purpose of the breeding method is to select tomatoes with red fruit color.

6. A product containing the substance of claim 1 for detecting the genotype of SNP sites in the tomato genome.

7. The application according to claim 1 or the product according to claim 6, characterized in that, The substance is either D1), D2), or D3). D1) Primer composition containing tomato genomic DNA fragments that amplify the SNP sites; D2) PCR reagents containing the primer composition described in D1); D3) A kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The application or product according to claim 7, characterized in that, The primer composition consists of primers dCAPs-BamHI-F and dCAPs-BamHI IR; The primer dCAPs-BamH IF is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing; The primer dCAPs-BamH IR is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing.

Images