A method for creating cotton compact plant type material using gene editing technology

Abstract

The application discloses a method for creating cotton compact plant type material by using a gene editing technology, that is, cloning a GhGRF2 gene from Gossypium hirsutum, designing a gene editing site, constructing a gene editing vector, performing genetic transformation by using a cotton agrobacterium mediation method, obtaining a transgenic regenerated plant, performing positive identification on the transgenic plant, analyzing mutation of the editing site, observing a phenotype of the gene editing mutant plant, and further obtaining compact germplasm material which can be used for cotton plant type breeding. The application belongs to the technical field of plant biotechnology, and specifically relates to a method for creating cotton compact plant type material by using a gene editing technology, wherein a cotton GhGRF2 gene is knocked out by using a CRISPR-Cas9 gene editing technology, and cotton compact plant type material is obtained, so that the problem that it is difficult to improve cotton plant type by using a traditional breeding method is solved.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology, and in particular relates to a method for creating compact cotton plant material using gene editing technology. Background Technology

[0002] Plant type is an important agronomic trait of cotton. It determines the adaptability of cotton to cultivation, the harvest index and potential yield, and directly affects the plant's light energy utilization efficiency and yield. It also affects the cost of mechanized harvesting and planting. At present, manual topping and spraying of chlormequat chloride are commonly used in production to control the excessive growth of cotton, which requires a lot of manpower and management input, increasing the cost of cotton planting.

[0003] Currently, large-scale mechanized sowing and harvesting have been achieved in the cotton-growing areas of Northwest China. In addition to continuously improving the level of mechanization and exploring and promoting simplified cultivation models and technologies suitable for different cotton-growing areas, it is even more important to cultivate new cotton varieties suitable for mechanized planting and harvesting. Compact cotton varieties (lines) with shorter fruiting branches and nodes, larger gaps between cotton leaves, less shading, and good ventilation and light penetration are suitable for dense planting and mechanized harvesting, reducing labor input costs and improving cotton planting efficiency.

[0004] Plant type traits are related to other traits such as yield, quality, and early maturity. It is very difficult to improve cotton plant type using traditional breeding methods, and it is difficult to simultaneously aggregate excellent traits in a short period of time. With the development of biotechnology, molecular marker-assisted breeding has become an effective method to break through the bottleneck of traditional breeding. Discovering genes related to plant type development and creating compact cotton plant type materials through genetic engineering technology is the most practical and effective way to accelerate cotton plant type breeding. Summary of the Invention

[0005] The technical problem this invention aims to solve is that traditional breeding methods are quite difficult to use for improving cotton plant architecture. To address this issue, this invention utilizes CRISPR-Cas9 gene editing technology to knock out and mutate the cotton GhGRF2 gene, obtaining compact cotton plant architecture materials, thus providing a new gene, a new method, and new materials for cotton plant architecture breeding.

[0006] The technical solution adopted in this invention is as follows:

[0007] A method for creating compact cotton plants using gene editing technology, which involves mutating the cotton GhGRF2 gene through gene editing to obtain compact cotton plants, includes at least the following steps.

[0008] S1. Cloning the cotton GhGRF2 gene;

[0009] S2. Two sgRNAs were designed in the exon region of the GhGRF2 gene to construct a gene editing vector;

[0010] S3. Perform cotton conversion;

[0011] S4. Conduct positive identification of transgenic plants;

[0012] S5. Detect mutations at editing sites in transgenic positive plants;

[0013] S6. Phenotypic observation and analysis of the GhGRF2 gene editing mutant.

[0014] Further: In S1: The GhGRF2 gene was isolated from the leaves of tetraploid upland cotton R15, the nucleotide sequence of which is shown in SEQ ID NO: 3, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO: 4.

[0015] Further: In S2, two sgRNA sequences were fused with a tRNA sequence, and the fused sequence was inserted into the BsaⅠ site of the pRGEB32-GhU6.7-NPTII vector to construct the GhGRF2 gene editing vector GhU6.7-GhCRF2, wherein:

[0016] The sgRNA1 sequence is 5'-ATAACACTGACCCAGAGCCA-3';

[0017] The sgRNA2 sequence is 5'-GCACTTAACCTCATGACAGA-3'.

[0018] Furthermore, in S3-S5, gene-edited positive plants were obtained through conventional cotton genetic transformation methods and PCR testing. Mutants with simultaneous base deletion / insertion / mutation at both sgRNA1 and sgRNA2 editing sites were screened by DNA sequencing.

[0019] Furthermore, in S6, the compact plant type material of the GhGRF2 gene-edited mutant is characterized by shorter internodes, fruiting branches, and fruiting nodes on the main stem of cotton compared to the recipient material.

[0020] After adopting the above method, the beneficial effects of the present invention are as follows:

[0021] (1) The cotton GhGRF2 gene was cloned from upland cotton, gene editing sites were designed, gene editing vectors were constructed, and gene-edited cotton regenerated plants were obtained through Agrobacterium-mediated cotton genetic transformation technology. By positive identification of transgenic lines, analysis of mutation at editing sites, and observation of gene-edited plant phenotypes, compact germplasm materials that can be used for cotton plant type breeding were obtained.

[0022] (2) The GhGRF2 gene belongs to the plant growth regulator (GRF) gene family. This family of genes are plant-specific transcription factors that play an important role in plant growth and development.

[0023] (3) The cotton GhGRF2 gene was knocked out by CRISPR-Cas9 gene editing technology, resulting in shorter internodes, fruit branches and fruit nodes on the main stem compared with the recipient material, and the cotton plant type was compact, which can be used for cotton bio-breeding. Attached Figure Description

[0024] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the embodiments of the invention to explain the invention and do not constitute a limitation thereof.

[0025] Figure 1 The structure of the GhGRF2 gene and the editing sites of the two genes, sgRNA1 and sgRNA2, are shown in the diagram.

[0026] Figure 2 The structure diagram of the gene editing vector pRGEB32-GhU6.7-NPTII;

[0027] Figure 3 The image shows the PCR detection results of transgenic T0 generation plants (M: DNA molecular weight standard; 1~17: different T0 generation regenerated plants; +: plasmid template positive control; -: blank negative control).

[0028] Figure 4 A diagram showing the mutation status of editing sites in transgenic T0 generation positive plants (yellow marks indicate base insertions, red marks indicate base mutations, and dashes indicate base deletions).

[0029] Figure 5 Sequencing peak diagrams for editing sites in different T2 strains (underlined lines indicate sgRNA1 or sgRNA2 positions, and arrows indicate mutation sites);

[0030] Figure 6 Phenotypic diagrams of different generations of GhGRF2 gene-edited lines (the top image shows the phenotype of the T2 generation at the bud stage, with red lines representing the internodes of the main stem and yellow lines representing the distance from the first node of the fruiting branch to the main stem; the bottom left image shows the phenotype of the T3 generation at the fruiting branch stage, where the fruiting branches and nodes of the gene-edited plants are significantly shorter; the bottom right image shows the phenotype of the T3 generation at the boll-opening stage, where the gene-edited plants are significantly more compact than the control). Detailed Implementation

[0031] The technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention.

[0032] The reagents required for this invention are conventional experimental reagents, purchased from commercially available channels; the experimental methods not mentioned are conventional experimental methods, and will not be described in detail here.

[0033] 1. Cloning the cotton GhGRF2 gene;

[0034] Based on the published GhGRF2 gene sequence in the tetraploid upland cotton genome, primers were designed to isolate the gDNA sequence of this gene from leaves of the recipient variety, upland cotton R15. Sequencing and sequence alignment showed that the obtained sequence was 100% homologous to sequences in the genome database. Cotton is an allotetraploid, and the GhGRF2 gene is located on chromosome 5 of upland cotton. The GhGRF2 gene contains 4 exons and 3 introns (…). Figure 1 The sequence in genome A is Gh_A05G1848; the nucleotide sequence is shown in SEQ ID NO: 1, and the full length is 3422 bp; the sequence in genome D is Gh_D05G2044; the nucleotide sequence is shown in SEQ ID NO: 2, and the full length is 3421 bp; the full length of the GhGRF2 gene cDNA is 1833 bp, encoding 610 amino acids, and the nucleotide sequence is shown in SEQ ID NO: 3, and the encoded amino acid sequence is shown in SEQ ID NO: 4.

[0035] 2. Two sgRNAs were designed in the exon region of the GhGRF2 gene to construct a gene editing vector;

[0036] Gene editing sites were designed targeting the GhGRF2 gene sequence; the designed sgRNA (small guide RNA, sgRNA) sequence is located in the exon region and contains an NGG sequence at the 3' end; the two sgRNA sequences are located in the 3rd and 4th exon regions of GhGRF2, respectively.

[0037] The sgRNA1 sequence is 5'-ATAACACTGACCCAGAGCCA-3'; the sgRNA2 sequence is 5'-GCACTTAACCTCATGACAGA-3'.

[0038] Two sgRNA sequences were fused with a tRNA sequence, and the fused sequence was inserted into the pRGEB32-GhU6.7-NPTII vector. Figure 2 Using the BsaⅠ site (a kind gift from Professor Zhang Xianlong's laboratory at Huazhong Agricultural University), the GhGRF2 gene editing vector GhU6.7-GhCRF2 was constructed; the vector plasmid was then transferred into Agrobacterium strain LBA4404 using the freeze-thaw method for cotton transformation.

[0039] 3. Perform cotton conversion;

[0040] The recipient variety used for cotton transformation was R15, a commonly used recipient variety for cotton gene transformation bred in our laboratory. Using hypocotyls of 5-7 day old sterile R15 cotton seedlings as explants, gene transformation was carried out using Agrobacterium-mediated transformation. The transformation process involved four stages: resistance callus induction, callus proliferation culture, embryogenic callus induction, and embryo differentiation and regeneration, lasting approximately 10-12 months, resulting in T0 transgenic cotton plantlets. When the resistant plantlets developed 3-4 true leaves, they were transplanted into soil for further transgenic positive identification and phenotypic analysis. A total of 17 T0 generation regenerated plants were obtained through vector transformation.

[0041] 4. Perform positive identification on transgenic plants;

[0042] DNA was extracted from cotton leaves using the CTAB method. Positive identification of T0 generation transgenic plants was based on the Cas9 gene in the vector. Specific PCR primers, Cas9-787-F and Cas9-1550-R, were designed based on the Cas9 gene sequence, amplifying a fragment of approximately 750 bp.

[0043] PCR reaction system: 2×Hieff fm PCR Master Mix 10 μL, 2 primers 1 μL each, DNA template 1 μL, add water to bring the total volume to 20 μL.

[0044] The test samples contained 17 different T0 generation gene-edited lines, and the transformed plasmid (GhU6.7-Gh GRF2) was used as a positive control for PCR detection.

[0045] PCR detection primer sequences:

[0046] Cas9-787-F:AATCTGATCGCCCAGCTGCCC;

[0047] Cas9-1550-R:GAAGTTTCCAGGGGGTGATGGT.

[0048] Seventeen T0 strains were analyzed by Cas9 gene PCR, and 10 positive strains were obtained. Figure 3 The numbers are: 3, 4, 5, 6, 7, 8, 10, 13, 14, 16.

[0049] 5. Detect mutations at the editing sites in transgenic positive plants;

[0050] Based on the gDNA sequence of the GhGRF2 gene, primers CRGRF2-F and CRGRF2-R were designed at 200 bp upstream and downstream of two gRNA sites, respectively. Using gDNA from leaves of gene-edited plants from different generations as templates, the target fragment was amplified. After agarose gel electrophoresis, the PCR products were recovered, ligated, transformed, and plated. After single colonies grew on the plates, different single colonies were selected for colony PCR identification. Five to eight positive single colonies from each transformant were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequences were analyzed using DNAstar and Chromas software or ClutalW software.

[0051] Sequencing primer sequences:

[0052] CRGRF2-F:CAATGGTAAAACCTGAAAGCTC;

[0053] CRGRF2-R: TCAAGAAGCAGGCAGAGAGGA.

[0054] Analysis of the editing site mutations in 10 T0 generation PCR-positive lines showed that, except for lines 8 and 10, the other 8 lines obtained mutations at both sgRNA1 and sgRNA2 editing sites. Figure 4 Of these eight strains, lines 3, 4, 6, 7, and 13 (a total of 5 lines) received T0 seeds. Subsequent experiments were conducted using these 5 lines. Analysis of the editing site mutations in different T2 generation lines revealed different types of mutations at both the sgRNA1 and sgRNA2 sites in all 5 lines. This indicates that the gene-edited material can be stably inherited.

[0055] 6. Phenotypic observation and analysis of the GhGRF2 gene editing mutant.

[0056] Different mutant progeny were planted in the field, with 2-4 plants per line and R15 material as a control. During the growing season, positive plants of different mutants were identified by kanamycin detection and PCR detection of the Cas9 gene, and the growth of cotton at different stages was observed.

[0057] Phenotypic observations of gene-edited mutants across different generations showed that the GhGRF2 gene-edited mutant exhibited a compact plant type phenotype that was stably inherited and has now been planted up to the T3 generation. The compact plant type material obtained through GhGRF2 gene editing is characterized by shorter internodes, fruiting branches, and fruiting nodes on the cotton main stem compared to the recipient material. Figure 6 This compact plant type material can be used for cotton bio-breeding to cultivate new cotton varieties suitable for dense planting and mechanized harvesting.

[0058] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents. In conclusion, if those skilled in the art, inspired by this description, design similar methods and embodiments without departing from the spirit of the invention, such designs should fall within the scope of protection of this invention.

Claims

1. A method for creating compact cotton plant material using gene editing technology, characterized in that: Obtaining compact cotton material by knocking out the GhGRF2 gene in cotton involves at least the following steps. S1. Cloning the cotton GhGRF2 gene; S2. Two sgRNAs were designed in the exon region of the GhGRF2 gene to construct a gene editing vector; S3. Perform cotton conversion; S4. Conduct positive identification of transgenic plants; S5. Detect mutations at editing sites in transgenic positive plants; S6. Phenotypic observation and analysis of GhGRF2 gene editing mutants; The GhGRF2 gene is located on chromosome 5 of upland cotton. Its sequence in genome A is Gh_A05G1848, and its nucleotide sequence is shown in SEQ ID NO: 1; its sequence in genome D is Gh_D05G2044, and its nucleotide sequence is shown in SEQ ID NO: 2; the cDNA nucleotide sequence of the GhGRF2 gene is shown in SEQ ID NO:

3.

2. The method for creating compact cotton plant material using gene editing technology according to claim 1, characterized in that: In S1: The GhGRF2 gene was isolated from the leaves of tetraploid upland cotton R15, and its nucleotide sequence is shown in SEQ ID NO:

3. The amino acid sequence of the protein it encodes is shown in SEQ ID NO:

4.

3. The method for creating compact cotton plant type materials using gene editing technology according to claim 2, characterized in that: In S2, two sgRNA sequences were fused with a tRNA sequence, and the fused sequence was inserted into the BsaⅠ site of the pRGEB32-GhU6.7-NPTII vector to construct the GhGRF2 gene editing vector GhU6.7-GhCRF2, in which: The sgRNA1 sequence is 5'-ATAACACTGACCCAGAGCCA-3'; The sgRNA2 sequence is 5'-GCACTTAACCTCATGACAGA-3'.

4. The method for creating compact cotton plant material using gene editing technology according to claim 3, characterized in that: In S3-S5, gene-edited positive plants were obtained using conventional cotton genetic transformation methods and PCR testing. Mutants with simultaneous base deletions / insertions / mutations at both sgRNA1 and sgRNA2 editing sites were screened by DNA sequencing.

5. A method for creating compact cotton plant type materials using gene editing technology according to claim 4, characterized in that: In S6, the compact plant type material of the GhGRF2 gene-edited mutant is characterized by shorter internodes, fruiting branches, and fruiting nodes on the main stem of cotton compared to the recipient material.

Images