Lilium regale chalcone isomerase gene LrCHI1 and application

Abstract

The application discloses a chalcone isomerase gene of Lilium regale LrCHI1 The nucleotide sequence is shown as SEQ ID NO:1, and the protein encoded by the amino acid sequence shown as SEQ ID NO:2. LrCHI1 The application proves that the gene has the function of improving the plant resistance to fungi through reverse genetics technology research. LrCHI1 The gene is constructed into a plant expression vector and is introduced into tobacco to be overexpressed, and the transgenic tobacco plant has strong anti-invasion ability to fungi, and experimental results show that the transgenic tobacco with overexpression has high-level resistance to the invasion of Phoma exigua and Alternaria solani. LrCHI1 ​

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology and genetic engineering, and particularly relates to a Chalcone Isomerase gene of Lilium regale with improved fungal infection resistance of plants LrCHI1 and application. BACKGROUND

[0002] Plants grow in specific ecological environments, and their growth process often faces challenges from biological and non-biological factors. Biological stress, especially diseases caused by pathogenic fungi, poses a significant threat to plant growth and development, and such diseases account for 70-80% of all plant diseases (Gao F, Guo HS. The battle and pathogenic intervention between plant and soilborne pathogens. Chinese Journal of Nature, 2020, 42(6): 499-504.). At present, the prevention and control of fungal diseases mainly relies on chemical methods, that is, the use of pesticides to control the occurrence and spread of diseases. However, although chemical control can effectively control diseases in the short term, its effect is not ideal for crops with a long growth cycle. In addition, pesticide residues also affect the quality and yield of agricultural products, and the accumulation of pesticides in the soil also has a negative impact on soil health, which is contrary to the goal of sustainable development of agriculture (Gao YH, Zheng ZH, Zhang Y, et al. Mechanism of rhizosphere microecology in preventing and controlling soil-borne fungal diseases of crops. Journal of China Agricultural University, 2021, 26(6): 14.). With the continuous progress of genetic engineering, cultivating disease-resistant plant varieties through transgenic technology and enhancing the plant's own defense mechanism, such as increasing the synthesis of secondary metabolites, provides a new way to overcome the limitations of chemical control. This method not only can reduce the dependence on chemical pesticides and reduce the risk of pesticide residues, but also helps to protect good soil health and promote the long-term sustainable development of agriculture.

[0003] Secondary metabolites are important substances produced by plants in response to environmental changes. Many studies have shown that terpenes, alkaloids, and flavonoids play an important role in the process of plant resistance to fungal diseases (Wu J, Lv S, Zhao L, et al. Advances in the study of the function and mechanism of the action of flavonoids in plants under environmental stresses. Planta, 2023, 257(6): 108.). Flavonoids can be divided into 12 subgroups, including chalcones, stilbenes, flavanones, flavones, isoflavones, dihydroflavonols, flavonols, and anthocyanins (Zhuang WB, Li YH, Shu XC, et al. The classification, molecular structure and biological biosynthesis of flavonoids, and their roles in biotic and abiotic stresses. Molecules, 2023, 28(8): 3599.). They mainly destroy the plasma membrane, cause mitochondrial dysfunction, inhibit cell wall formation, cell division, RNA and protein synthesis, and efflux-mediated pumping systems, thereby inhibiting fungal growth (Chen S, Wang X, Cheng Y, et al. A review of classification, biosynthesis, biological activities and potential applications of flavonoids. Molecules, 2023, 28(13): 4982.). Cherry treated with luteolin (Liu X, Cui X, Ji D, et al. Luteolin-induced activation of the phenylpropanoid metabolic pathway contributes to quality maintenance and disease resistance of sweet cherry. Food Chemistry, 2021, 342: 128309.) has increased resistance to Botrytis cinerea and Penicillium expansum. Cerasus pseudocerasus

[0004] ​Chalcone isomerase is the first known enzyme related to the synthesis of flavonoids and is also one of the key enzymes in the flavonoid metabolic pathway. Chalcone isomerase and chalcone synthase together constitute the rate-limiting enzyme in the biosynthesis of flavonoids (Xu Chaoyang, Zhang Keke, Wang Chenchen, et al. Cloning of lettuce chalcone isomerase gene and determination of in vitro enzyme activity. Acta Physiologica Sinica, 2023, 59(11):2135-2143.). It catalyzes the intramolecular isomerization of naringenin chalcone to form naringenin, which is then converted into various types of flavonoids (Ni R, Zhu TT, Zhang XS, et al. Identification and evolutionary analysis of chalcone isomerase-fold proteins in ferns. Journal of Experimental Botany, 2020, 71(1): 290-304.). In Arabidopsis thaliana ( Amorphochlora amoebiformis Overexpression of Rhododendron simsii ( Rhododendron delavayi ) CHI1 Afterwards, it exhibits higher resistance to sodium chloride and mannitol stress (Sun Wei, Sun Shiyu, Chen Yiran, et al. Cloning and functional analysis of RdCHI1 chalcone isomerase gene in Rhododendron simsii. Journal of Horticulture, 2022, 49(11): 2407-2418). In cotton ( Gossypium barbadense ) silence CHI01 / 05 / 06 / 09 Subsequently, the expression levels of flavonoid synthesis-related genes decreased, the total flavonoid content decreased, the content of salicylic acid and jasmonic acid decreased, and the reactive oxygen species scavenging ability weakened, thus affecting Fusarium oxysporum (… Fusarium oxysporum ) are more susceptible to disease (Zu Q, Deng X, Qu Y, et al. Genetic channelization mechanism of four chalcone isomerase homologous genes forsynergistic resistance to Fusarium wilt in Gossypium barbadense L. InternationalJournal of Molecular Sciences, 2023, 24(19): 14775.).

[0005] Lilies belong to the genus *Lilium* of the family Liliaceae. Lilium A perennial herbaceous plant with underground bulbs, it is a world-renowned ornamental flower and an important plant used for both food and medicine (Zhou J, An R, Huang X. Genus). Lilium: Areview on traditional uses, phytochemistry and pharmacology. Journal ofEthnopharmacology, 2023, 270: 113852.). Lily wilt, also known as lily root rot or stem rot, is a serious soil-borne disease in lily production and has become one of the important factors hindering the development of the lily industry. Minjiang lily ( Lilium regale *Lilium simonii*, also known as the King Lily or Thousand-Leaf Lily, is distributed in the arid river valleys of the Minjiang River basin in Sichuan, my country, at altitudes of 760–2200 m where climate change is drastic. It exhibits high resistance to Fusarium wilt, making it an important breeding parent. Researching the molecular mechanisms of *Lilium simonii*'s resistance to Fusarium wilt is of great significance for improving the resistance of *Lilium* species to Fusarium wilt (Wang Z, Deng J, Liang T, et al.). Lilium regale Wilson WRKY3 modulates an antimicrobial peptidegene, LrDef1 , during response to Fusarium oxysporum . BMC Plant Biology, 2022,24, 22(1): 257.). Summary of the Invention

[0006] This invention provides a chalcone isomerase gene from Minjiang lily. LrCHI1 And its effect on improving the resistance of tobacco to mold growth on grass stems ( Phoma herbarum ) and Alternaria solanacearum ( Alternaria solani Applications in resistance.

[0007] This invention cloned the chalcone isomerase gene from *Lilium minjiangense*. LrCHI1 , LrCHI1 The nucleotide sequence is shown in SEQ ID NO:1. The full-length cDNA sequence of this gene is 977 bp, containing a 702 bp open reading frame, a 61 bp 5' untranslated region, and a 214 bp 3' untranslated region, encoding a protein with the amino acid sequence shown in SEQ ID NO:2.

[0008] In this invention LrCHI1 The coding region of the gene is the nucleotide sequence shown in positions 62-763 of SEQ ID NO:1.

[0009] This invention isolates and clones a chalcone isomerase gene from Lilium minjiangense. LrCHI1 The complete cDNA fragment was obtained using Agrobacterium tumefaciens (Gastrointestinal rust) Agrobacterium tumefaciensThe inventors mediated the transfer of the target gene into recipient plants and overexpressed it. Further experiments were conducted to verify whether the gene could enhance the plant's antifungal activity, laying the foundation for future applications in improving the resistance of tobacco and other plants to fungal diseases. The gene was named... LrCHI1 .

[0010] The above LrCHI1 Genes can be used to enhance the antifungal properties of tobacco, and the specific operation is as follows:

[0011] (1) Amplification LrCHI1 Specific primers were used to extract total RNA from the roots of *Lilium minjiangense*, and the RNA was amplified by reverse transcription-polymerase chain reaction (RT-PCR). LrCHI1 The full-length coding region was extracted, then ligated into the pGEM-T vector, and clones containing the target gene were obtained by sequencing.

[0012] (2) Using restriction endonucleases Eco RI and Bam HI enzyme digestion of pGEM-T- LrCHI1 The target gene fragment was obtained by gel extraction from the vector. The plant expression vector pCAMBIA2300s was digested with the same restriction enzyme, and the desired large vector fragment was obtained by gel extraction. The obtained fragment was then... LrCHI1 The gene fragment was linked with the pCAMBIA2300s fragment to construct a plant overexpression vector, and then the constructed recombinant vector was transformed into tobacco for expression via Agrobacterium tumefaciens.

[0013] (3) Transformants were screened using the resistance markers on the recombinant vector T-DNA, and positive transgenic plants were obtained by PCR detection. The ability of transgenic plant leaves to resist fungal infection was analyzed, and finally transgenic plants with significantly enhanced resistance to fungi were screened.

[0014] This invention, through genetic engineering, cultivates disease-resistant plants, overcoming the shortcomings of traditional breeding methods. It not only shortens the breeding cycle but also simplifies the process and makes it easier to obtain highly resistant materials. This invention originates from the Minjiang lily. LrCHI1 Genes can enhance plant resistance to fungi. Introducing this gene into tobacco can produce new varieties and materials with fungal resistance. This invention provides a new method for improving plant resistance to fungal diseases. The use of genetic engineering technology to cultivate resistant plant varieties and materials has significant advantages and irreplaceable importance. It not only facilitates large-scale production of crops, medicinal herbs, and horticultural plants, significantly reducing the use of chemical pesticides, but also saves costs in agricultural production and reduces environmental pollution. Therefore, this invention has broad market application prospects. Attached Figure Description

[0015] Figure 1 is the pCAMBIA2300s- LrCHI1 PCR detection results of the liquid of transformed Agrobacterium tumefaciens. In the figure: Marker is DL2000 DNA Marker (Bao Bioengineering Dalian Co., Ltd., China), which is composed of five DNA fragments of 2,000 bp, 1,000 bp, 750 bp, 500 bp and 250 bp; positive control is the PCR product of pGEM-T- LrCHI1 plasmid as the template; negative control is the PCR product of sterile water as the template; serial numbers 1-21 are the PCR products of the plant expression vector pCAMBIA2300s- LrCHI1 transformed into Agrobacterium tumefaciens LBA4404 and the PCR product of the liquid as the template;

[0016] Figure 2 is part of the present application LrCHI1 PCR detection results of the transgenic tobacco genomic DNA. In the figure: Marker is DL2000 DNA Marker (Bao Bioengineering Dalian Co., Ltd., China), which is composed of five DNA fragments of 2,000 bp, 1,000 bp, 750 bp, 500 bp and 250 bp; positive control is the PCR product of pGEM-T- LrCHI1 plasmid as the template; negative control is the PCR product of sterile water as the template; WT is the PCR product of non-transgenic tobacco (wild type) genomic DNA as the template; serial numbers 1-17 are part of the PCR products of the transgenic tobacco genomic DNA as the template; LrCHI1

[0017] Figure 3 is the present application LrCHI1 Antibacterial effect diagram of the 60% methanol extract of the transgenic tobacco; the fungi shown in figures a and b are Phoma herpotrichoides and Alternaria solani, respectively; WT is the 60% methanol extract of wild type tobacco; buffer is a blank control, i.e. 60% methanol solution; C8, C9 and C16 are the 60% methanol extracts of the transgenic tobacco strains, respectively; LrCHI1

[0018] Figure 4 is the present application LrCHI1 Resistance analysis diagram of the transgenic tobacco to pathogenic fungi, in which figure a is the resistance identification of wild type tobacco and P. herbarum transgenic tobacco after inoculation of Phoma herpotrichoides; LrCHI1 figure b is the resistance identification of wild type tobacco and A. solani transgenic tobacco after inoculation of Alternaria solani; LrCHI1 ​​Resistance identification of genetically modified tobacco; WT represents wild-type tobacco; C8, C9, and C16 are different LrCHI1 Transgenic tobacco strains. Detailed Implementation

[0019] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the methods in the embodiments are conventional methods, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.

[0020] Example 1: LrCHI1 Gene cloning and sequence analysis

[0021] Total RNA was extracted from the roots of *Lilium minjiangense*. The roots, inoculated with *Fusarium oxysporum*, were ground into powder using liquid nitrogen and then transferred to centrifuge tubes. Total RNA was extracted using the guanidine isothiocyanate method. The first strand of cDNA was synthesized using reverse transcriptase M-MLV (promega) as a template. The reaction system and procedure were as follows: 5 μg of total RNA was added, followed by 50 ng oligo (dT), 2 μL dNTP (2.5 mM), and DEPC water, until the reaction volume reached 14.5 μL. After mixing, the mixture was denatured at 70 °C for 5 min and then rapidly cooled on ice for 5 min. Then, 4 μL of 5× First-stand buffer, 0.5 μL of RNasin (200 U), and 1 μL of M-MLV (200 U) were added sequentially. The mixture was mixed and briefly centrifuged, then incubated at 42 °C for 1.5 h. After removal, the mixture was heated at 70 °C for 10 min to terminate the reaction. The synthesized first strand of cDNA was stored at -20 °C for later use.

[0022] Using the synthesized first-strand cDNA as a template, the target gene is amplified. LrCHI1 The upstream and downstream primer sequences used were 5'GAATTCATTCTGAAAGAATGGCA3' and 5'GGATCCCCACATAACTTAATCACACA3', respectively. Advantages were employed. TMThe target gene was amplified using PCR Enzyme (Clontech, USA). PCR reaction conditions: 94℃ for 5 min; 94℃ for 30 s, 52℃ for 30 s, 72℃ for 30 s (32 cycles); 72℃ for 7 min; the reaction system (20 μL) consisted of 0.5 μL cDNA; 2 μL 10×Advantage2 PCR Buffer; 0.4 μL 50×dNTP Mix (10 mM each); 0.4 μL forward primer (10 μM); 0.4 μL reverse primer (10 μM); 0.4 μL Advantage 2 PCR Polymerase Mix; and 15.9 μL PCR-Grade water. After PCR, 5 μL was used for agarose gel electrophoresis to detect the specificity and size of the amplified products.

[0023] The PCR products were TA cloned using the pGEM-T easy Vector System I (Promega, USA). The reaction system and procedure were as follows: 1.5 μL of PCR product was added to 1 μL of pGEM-T Vector (50 ng / μL) and 2.5 μL of 2×Ligation solution I, mixed well, and incubated overnight at 16°C. The ligation product was then transformed into *E. coli* DH5α using the heat shock transformation method. Positive clones were screened using LB solid medium containing ampicillin (Amp), and several single colonies were selected. After shaking, amplification was performed. LrCHI1 Specific primers were used to identify multiple cloning site insertions. LrCHI1 The identified clones were sequenced to obtain the final clones. LrCHI1 The cDNA was 977 bp, and analysis using the NCBI ORF finder (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html) revealed that it contained a 702 bp open reading frame. LrCHI1 It encodes a protein containing 233 amino acids, with a molecular weight of approximately 24.99 kDa and an isoelectric point of approximately 5.04.

[0024] Example 2: Construction of plant overexpression vectors

[0025] Insertion plasmid DNA was extracted using the SanPrep column-based plasmid DNA mini-extraction kit (Sangon Biotech Shanghai Co., Ltd., China). LrCHI1 pGEM-T-E. coli plasmid LrCHI1 The plasmid of the plant expression vector pCAMBIA2300s was also analyzed; 1 μL was used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid. Restriction endonucleases were then used to...Eco RI (TaKaRa, Japan) and Bam HI (TaKaRa, Japan) separately tested plasmid pGEM-T- LrCHI1 Double digestion with pCAMBIA2300s (50 μL system) was performed. The reaction system and operation procedure were as follows: Take 20 μL of pGEM-T- LrCHI1 Add 7.5 μL of 10×K buffer and 2.5 μL of pCAMBIA2300s plasmid sequentially. Eco RI, 2.5μL Bam HI, 17.5 μL ddH2O, mix well, centrifuge briefly, and incubate overnight at 37°C; spot all enzyme digestion products onto an agarose gel for electrophoresis, then... LrCHI1 The fragments and the large fragment of the pCAMBIA2300s vector were recovered by gel electrophoresis. The entire process was carried out using the SanPrep column DNA gel recovery kit (Sangon Biotech Shanghai Co., Ltd., China). 1 μL of the recovered product was taken and the size and concentration of the recovered fragments were detected by agarose gel electrophoresis and stored at -20℃ for later use.

[0026] Using T4 DNA Ligase (TaKaRa, Japan), the recovered DNA was... LrCHI1 The DNA fragment and the pCAMBIA2300s vector fragment were ligated. The reaction system (20 μL) and the operation procedure were as follows: Take 10 μL... LrCHI1 After adding the DNA fragment, 2 μL of pCAMBIA2300s vector DNA, 2 μL of 10×T4 DNA Ligase Buffer, 1 μL of T4 DNA Ligase, and 5 μL of ddH2O were added sequentially. The mixture was then briefly centrifuged and incubated overnight at 16°C. The ligation product was then transformed into *E. coli* DH5α using a heat shock transformation method. Positive clones were screened using solid medium containing 50 mg / L kanamycin (Km). Single colonies were selected and cultured, and the bacterial culture was used as a template for amplification. LrCHI1 PCR was performed using specific primers to select... LrCHI1 Clones that have been successfully ligated to pCAMBIA2300s, if the tested strain is positive, add glycerol and store at -80℃ for later use.

[0027] Extract and purify pCAMBIA2300s- from the above-mentioned Escherichia coli. LrCHI1 Plasmid. The constructed plant expression vector pCAMBIA2300s- was then frozen and thawed in liquid nitrogen. LrCHI1 Transfected into Agrobacterium tumefaciens LBA4404 competent cells. The procedure was as follows: Take 2 μg of pCAMBIA2300s- LrCHI1The plasmid was added to a centrifuge tube containing 200 μL competent cells, mixed gently, and then placed in an ice bath for 5 min. The tube was then frozen in liquid nitrogen for 1 min, and then quickly placed in a 37°C water bath for 5 min. The tube was then immediately placed in an ice bath for 2 min, and then 800 μL of LB liquid medium was added. The mixture was incubated at 28°C for 4 h. The activated Agrobacterium was then spread on LB solid medium containing 50 mg / L Km, and incubated at 28°C. Single colonies were selected and grown in LB liquid medium containing 50 mg / L Km. The bacteria were then used for PCR using specific primers for the pCAMBIA2300s- LrCHI1 vector. The results are shown in Figure 2. Several positive clones were selected, and then stored at -80°C after adding glycerol. LrCHI1 Figure 1 Example 3: Agrobacterium-mediated genetic transformation of plants and selection of transgenic plants

[0028] The transgenic recipient in this experiment was tobacco. The tobacco seeds were soaked in 75% alcohol for 30 s, washed with sterile water, and then soaked in 0.1% HgCl2for 8 min. The seeds were then washed with sterile water several times, and then planted on 1 / 2 MS medium and incubated at 28°C in the dark for 6 d. After germination, the plants were transferred to a light incubator (25°C, 16 h / d light). The plants were subcultured on 1 / 2 MS medium every month thereafter.

[0029] The Agrobacterium LBA4404 strain containing the pCAMBIA2300s- plasmid was taken from the -80°C freezer, and inoculated into 5 mL of LB liquid medium containing 50 mg / L Km and 20 mg / L rifampicin. The medium was incubated at 28°C until the medium became turbid. One mL of the turbid bacterial solution was then spread on LB solid medium containing 50 mg / L Km, and incubated at 28°C for 48 h. The Agrobacterium on the LB solid medium was then scraped and inoculated into MGL liquid medium containing 20 mg / L acetosyringone, and incubated at 28°C for 2-3 h to activate the Agrobacterium.

[0030] LrCHI1 Tobacco seedlings were taken from the -80°C freezer, and the leaves were cut into 1 cm 2 squares. The leaf discs were completely immersed in the MGL liquid medium containing the activated Agrobacterium. The leaf discs were then placed on co-cultivation medium and incubated at room temperature. The co-cultivation medium for tobacco transformation was MS + 0.02 mg / L 6-BA + 2.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar. The co-cultivation was performed in the dark at 22°C for 2 d.

[0031]

[0032] ​​The leaf discs after co-cultivation were transferred to MS selection medium with antibiotics for differentiation into seedlings, and transgenic plants were screened at the same time. The tobacco selection medium was MS + 0.5 mg / L 6-BA + 0.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar + 50 mg / L Km + 200 mg / L cefotaxime sodium salt (Cef); during the selection culture, the culture bottles were transferred to a light incubator for culture (25°C, 16 h / d light, 8 h / d darkness), and after the tobacco sprouted, the MS medium containing 50 mg / L Km and 200 mg / L Cef was used for subculture. The tobacco regenerated seedlings were moved to the MS medium containing 50 mg / L Km for rooting, and finally the regenerated seedlings with better rooting were selected for subsequent detection.

[0033] The genomic DNA of the transgenic tobacco plants was extracted by the CTAB method, 1 μL of the extracted genomic DNA was detected by agarose gel electrophoresis for integrity and concentration, and the genomic DNA of the transgenic plants was used as a template for PCR with specific primers of LrCHI1 After the PCR, 8 μL of the product was used for agarose gel electrophoresis to detect positive transgenic plants, and the amplification results of some tobacco transgenic plants are shown in Figure 2 LrCHI1 A total of 29 positive transgenic plants were screened from the transgenic tobacco.

[0034] Example 4: LrCHI1 In vitro antibacterial test of 60% methanol extract of transgenic plants

[0035] The pathogenic fungi preserved in the laboratory were inoculated on PDA solid medium (200 g / L potato, 15 g / L agar, 20 g / L glucose), and cultured at 28°C in the dark until the colonies grew to a diameter of about 2-3 cm. Methanol extract was added to analyze the in vitro antifungal activity of the transgenic plants. To extract the total flavonoids of tobacco, 5 g of transgenic tobacco single plants (numbered C8, C9, C16) and wild type leaves were placed in a mortar, ground into powder with liquid nitrogen, and then 20 mL of 60% methanol solution was added, and an ultrasonic shaker was used for extraction for 45 min. After the extraction was completed, centrifugation was performed at 10,000 g for 10 min, and the supernatant was collected for experiment. 20 μL of 60% methanol solution, wild type tobacco 60% methanol extract, C8 / C9 / C16 transgenic tobacco 60% methanol extract was dropped on sterile filter paper pieces in the fungal culture medium. After 3-5 days of culture at 28°C, the growth of the fungi was observed, and the antibacterial activity of the methanol extract of the transgenic tobacco was evaluated accordingly, and the results are shown in LrCHI1 Figure 3 LrCHI1 ​​​Transgenic tobacco (C8 / C9 / C16) 60% methanol extract had obvious inhibitory effect on the growth of Phoma herbarica and Alternaria solani.

[0036] Example 5: LrCHI1 Analysis of resistance of transgenic tobacco leaves to pathogenic fungi

[0037] The pathogenic fungi preserved in the laboratory were inoculated on PDA solid medium (200 g / L potato, 15 g / L agar, 20 g / L glucose), and after dark culture at 28°C for 7 days, 10 5 spores / mL of spore suspension were prepared. The wild type and transgenic tobacco were inoculated with the spore suspension, and after dark culture at 28°C for 7 days, the disease incidence of the leaves was observed. LrCHI1 The transgenic tobacco (C8 / C9 / C16) was wounded at the upper left corner, and 20 μL of the spore suspension was dropped on the wound of the tobacco leaf. The leaf was placed on filter paper soaked with sterile water for moisture retention, and after dark culture at 28°C for 5-7 days, the leaf was taken out and the disease incidence was observed. The results are shown in Figure 4. LrCHI1 The transgenic tobacco had higher resistance to Phoma herbarica P. herbarum and Alternaria solani A. solani .

Claims

1. A chalcone isomerase gene from Lilium regale LrCHI1 In use for improving tobacco resistance to Phoma exigua Phoma herbarum ) and Alternaria solani Alternaria solani ) characterized in that Nucleotide sequence of the charontenase gene of Lilium regale LrCHI1 is shown as SEQ ID NO: 1.

Images