Engineering bacteria for degradable plastics, degradable living plastics, and their preparation methods and applications

Abstract

The present invention provides an engineered bacterium for degrading plastics, a degradable living plastic, and a preparation method and application thereof. The present invention first provides an engineered bacterium for degrading plastics, which contains a plastic-degrading enzyme gene. The present invention also provides a living plastic material, which contains the above-mentioned engineered bacterium and / or the spores produced by it. The degradation conditions of the present invention are relatively simple, the cost is relatively low, and it is fast and efficient.

Description

Technical Field

[0001] The present invention relates to an engineered bacterium capable of degrading plastics, a degradable living plastic, and a preparation method and application thereof. Background Art

[0002] Plastic pollution is a huge problem and challenge faced by human society at the present stage. Due to the excellent physical and chemical properties of plastics themselves, the popularization of plastics has brought great convenience to human life. However, with the development of society, the demand for plastic products is increasing day by day. At the same time, plastic waste and its pollution generated in human daily life have also become problems that cannot be ignored by the natural environment and human society.

[0003] At the present stage, the main treatment methods for plastic waste are incineration treatment relying on waste incineration plants and landfill treatment using compost degradation of garbage. Since plastic itself is a polymer material, the burned plastic is prone to generate toxic gases such as dioxins after combustion, and the incineration of plastics often generates gases such as carbon monoxide due to incomplete combustion. If not properly treated, it will seriously endanger the air environmental quality around the incineration plant and the physical health of the surrounding residents. The landfill treatment method, due to the slow degradation of the polymer material itself, requires a large amount of land area, and the centralized landfill treatment method is prone to cause serious chemical pollution to the soil itself. Therefore, the main treatment methods for plastic waste at the present stage do not conform to the concept of sustainable development of human society in terms of treatment time and cost. Summary of the Invention

[0004] One object of the present invention is to provide an engineered bacterium capable of degrading plastics.

[0005] Another object of the present invention is to provide a degradable living plastic.

[0006] Another object of the present invention is to provide a preparation method of a degradable living plastic.

[0007] Another object of the present invention is to provide related applications of the degradable living plastic.

[0008] To achieve the above objects, the present invention is mainly based on methods such as materials science, synthetic biology, genetic engineering, and metabolic engineering, combined with the green and environmental protection characteristics of microorganisms in degrading plastics, to provide new solutions and ideas for the plastic pollution problem in the prior art.

[0009] On the one hand, the present invention provides an engineered bacterium capable of degrading plastics, which contains a plastic-degrading enzyme gene. Specifically, the engineered bacterium described in the present invention is prepared by introducing a plastic-degrading enzyme gene into a bacterium.

[0010] According to a specific embodiment of the present invention, the bacterium is Bacillus subtilis or any other strain that can tolerate plastic processing conditions.

[0011] According to a specific embodiment of the present invention, the plastic-degrading enzyme includes, but is not limited to, Burkholderia cepacia lipase (BC enzyme) and other enzymes that can degrade plastics, such as PETase for degrading PET, etc.

[0012] According to a specific embodiment of the present invention, the plastic is polycaprolactone (PCL) or other plastics (such as PLA, PET, etc.).

[0013] On the other hand, the present invention also provides an expression plasmid vector carrying the gene sequence of BC enzyme, which can be used to construct the engineering bacterium.

[0014] According to a specific embodiment of the present invention, the plasmid is pMK4 plasmid.

[0015] According to a specific embodiment of the present invention, the process of using the expression plasmid vector to construct the engineering bacterium includes: adding a xylose solution to the LB medium, with the final concentration of xylose preferably being 0.5 - 2%, most preferably 1%, inoculating a single colony, culturing to make competent cells; mixing the plasmid or DNA fragment with the competent cells, culturing, and coating a solid LB plate with the corresponding resistance, and continuing to culture to obtain the engineering bacterium.

[0016] On the other hand, the present invention also provides a spore produced by the engineering bacterium.

[0017] According to a specific embodiment of the present invention, the process of the engineering bacterium producing spores includes: preparing an agar medium supplemented with Mn 2+ where the final concentration of Mn 2+ is 20 - 100 mg / L, preferably 50 mg / L, inoculating the engineering bacterium onto the agar medium, and culturing until spores are produced.

[0018] On the other hand, the present invention also provides the application of the engineering bacterium, the vector or the spore in degrading plastics.

[0019] According to a specific embodiment of the present invention, the process of applying for degrading plastics includes: adding the plastic to be degraded into a culture solution containing Candida antarctica lipase B (CA enzyme), and mixing and culturing in the presence of the engineering bacterium or the spore to carry out plastic degradation.

[0020] On the other hand, the present invention also provides the application of the engineering bacterium, the vector or the spore in preparing living plastic materials.

[0021] According to specific embodiments of the present invention, the present invention prepares a living material by blending the engineered bacteria and / or their spores with traditional plastics. Preferably, the process of preparing the living plastic material includes: mixing plastic raw material particles with the engineered bacteria and / or spores evenly to prepare the living plastic material. More specifically, the preparation methods include but are not limited to melt extrusion methods, solvent evaporation methods, twin-screw, single-screw extrusion methods, etc. According to specific embodiments of the present invention, a 3D printer can be used for melting the mixed materials. The melting temperature can be determined according to the melting temperature of the plastic raw material particles. Preferably, the melting temperature is not higher than 130 °C to ensure the activity of the engineered bacteria spores. In some specific embodiments of the present invention, the engineered bacteria is Bacillus subtilis, the plastic is PCL, and the melting is carried out at 120 °C.

[0022] On the other hand, the present invention also provides a living plastic material containing the engineered bacteria and / or their spores of the present invention. Preferably, the living plastic material is prepared by adding the engineered bacteria and / or the spores into a plastic base material (plastic raw material particles).

[0023] On the other hand, the present invention also provides a method for degrading the living plastic material, and the method includes:

[0024] Co-culturing Candida antarctica lipase B (CA enzyme) with the living plastic material, adding a xylose solution for co-culturing after the solution becomes turbid until the living PCL material degrades.

[0025] According to specific embodiments of the present invention, the method for degrading the living plastic material includes: dissolving Candida antarctica lipase B (CA enzyme) in deionized water, adding the CA enzyme solution into a pre-prepared LB culture medium so that the final concentration of the CA enzyme in the LB culture medium is 0.05 - 0.2 mg / mL, adding the living plastic material, culturing until the culture medium becomes turbid, adding a xylose solution with a concentration of 20 - 200 g / 100 mL to the turbid culture medium, and the addition ratio of the xylose solution to the LB culture medium is 0.1 - 10:100, and continuing to culture until the living plastic material degrades and disappears.

[0026] In some specific embodiments of the present invention, the present invention constructs a genetically engineered Bacillus subtilis that can secrete an enzyme for degrading PCL, and further combines traditional polycaprolactone (PCL) plastic with the spores of the genetically engineered Bacillus subtilis by a method of heating and melting to prepare a living PCL material that can autonomously degrade under certain environmental conditions.

[0027] Compared with the mainstream method of PCL degradation at present, i.e., soil composting degradation method, the engineered bacteria of the present invention can continuously secrete BC enzyme during the PCL plastic degradation process and thus have significant advantages. The degradation conditions of the present invention do not require a soil environment, the degradation conditions are relatively simple, the cost is relatively low, and it is faster and more efficient than soil degradation, and can completely degrade the PCL material within just a few days.

[0028] The present invention has been proven by multiple laboratory-scale tests with good results, demonstrating that the design concept and technical method of the present invention are both feasible.

[0029] In summary, the present invention provides an engineered bacteria for degradable plastics, a degradable living plastic, and its preparation method and application. The degradation conditions of the present invention are relatively simple, the cost is relatively low, and it is fast and efficient. Brief Description of the Drawings

[0030] Figure 1 It is a schematic diagram of the complete steps of the production technology of the living PCL material of the present invention.

[0031] Figure 2 It is the display and growth state characterization of the engineered Bacillus subtilis and its spores in a specific embodiment of the present invention. Among them, in picture a, the stained Bacillus subtilis and spores are observed under an inverted fluorescence microscope. In picture b, the spores are observed to revive and grow into Bacillus subtilis under the stimulation of external nutrient elements under an inverted fluorescence microscope. In picture c, the revival growth curves of the spores treated under different heating temperature conditions. In picture d, the corresponding colony-forming units are measured after the spores treated under different heating temperature conditions revive into Bacillus subtilis. In picture e, the revival growth curves of the spores treated with toluene for different times.

[0032] Figure 3 It is the gene expression test of the engineered Bacillus subtilis and its spores in a specific embodiment of the present invention. Among them, in picture a, wild-type Bacillus subtilis and engineered Bacillus subtilis carrying the green fluorescent protein gene. In picture b, the gene expression level of the spores carrying the green fluorescent protein gene is measured by a flow cytometer under the condition of heating at 120 °C for 20 minutes. In picture c, the gene expression level of the spores carrying the green fluorescent protein gene is measured by a flow cytometer in a toluene environment for 48 hours. In picture d, polyacrylamide gel electrophoresis is used to verify that the spores carrying the BC enzyme gene express BC enzyme after revival. In picture e, the degradation effect diagrams of PCL materials by wild-type Bacillus subtilis and engineered Bacillus subtilis carrying the BC enzyme gene. In picture f, the surface image of the PCL material degraded by Bacillus subtilis carrying the BC enzyme gene is taken by a scanning electron microscope.

[0033] Figure 4Preparation and property characterization of thin-film living PCL material of a specific embodiment of the present invention. Among them, Picture a, traditional PCL thin-film material (left) and living PCL thin-film material (right). Picture b, traditional PCL thin-film material (left) and living PCL thin-film material (right) observed under an inverted fluorescence microscope. Picture c, tensile properties of traditional PCL material and living PCL material. Picture d, schematic diagram of the complete degradation process of living PCL thin-film material. Picture e, traditional PCL thin-film material (left) and living PCL thin-film material (right) before degradation. Picture f, traditional PCL thin-film material (left) and living PCL thin-film material (right) after degradation. Picture g, mass change curves of traditional PCL thin-film material and living PCL thin-film material before and after degradation.

[0034] Figure 5 Preparation and property characterization of melt-extruded living PCL material of a specific embodiment of the present invention. Among them, Picture a, living PCL material (left) and traditional PCL material (right) prepared by melt extrusion. Picture b, gel permeation chromatography (GPC) spectra of living PCL material before and after degradation. Picture c, gel permeation chromatography (GPC) spectra of PCL material degraded by Bacillus subtilis carrying BC enzyme gene. Picture d, traditional PCL material (left) and living PCL material (right) before degradation. Picture e, traditional PCL material (left) and living PCL material (right) after degradation. Picture f, mass change curves of PCL materials with different treatment methods before and after degradation. PCL+WT refers to PCL degraded by Bacillus subtilis without genetic engineering, PCL+EB refers to PCL degraded by Bacillus subtilis carrying BC enzyme gene, ELMs(-) refers to the degradation ability of traditional PCL material under the method of this patent, and ELMs(+) refers to the degradation ability of living PCL material under the method of this patent. Detailed implementation manners

[0035] For a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solutions of the present invention will now be described in detail. It should be understood that these descriptions are not intended to limit the scope of the present invention.

[0036] In the embodiments, all original reagent materials are commercially available. The experimental methods without specific conditions are conventional methods and conventional conditions well-known in the art, or the conditions recommended by the instrument manufacturers.

[0037] The technical sources of Bacillus subtilis and pMK4 expression vector used in the examples can be referred to the following documents: Ji, M. et al. Enzyme and Microbial Technology A wheat bran inducible expression system for the efficient production of α-L-arabinofuranosidase in Bacillus subtilis. Enzyme Microb. Technol. 144, 109726 (2021); Ji, M. et al. Development of an inducible T7 expression system in Bacillus subtilis ATCC 6051a for production of α-L-arabinofuranosidase. Res. Sq. 1–26 (2020); Ji, M. et al. Engineering Bacillus subtilis ATCC 6051a for the production of recombinant catalases. J. Ind. Microbiol. Biotechnol. 48, (2021).

[0038] Unless otherwise specifically defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the relevant art.

[0039] Example 1:

[0040] In this example, first, the plasmid carrying the PCL degrading enzyme (BC enzyme) was fragmented and sutured, and the pMK4 plasmid was introduced into Bacillus subtilis. Among them, the full sequence of the pMK4 carrying the BC enzyme expression vector is shown in SEQ ID NO:1.

[0041] SEQ ID NO:1 (the capital part is the BC enzyme gene sequence):

[0042] gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcg

[0043] ggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtg

[0044] tggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttggctgcaggtggcgagcccgat

[0045] cttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgt

[0046] agaggatcgagatcgatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaa

[0047] taattttgtttaactttaagaaaggaggatataccATGGCCAGATCGATGCGTTCCAGGGTGGTGGCA

[0048] GGGGCAGTGGCATGCGCGATGAGCGTCGCGCCGTTCGCGGGGACGACCGCGGT

[0049] GATGACGCTCGCGACGACGCACGCGGCGATGGCGGCAACCGCGCCCGCCGACG

[0050] ACTACGCGACGACGCGTTATCCGATCATCCTCGTGCACGGGCTCACGGGCACCG

[0051] ACAAGTACGCGGGCGTGCTCGAGTACTGGTACGGCATCCAGGAAGACCTGCAA

[0052] CAGCATGGCGCGACCGTCTACGTCGCGAACCTGTCGGGCTTCCAGAGCGACGA

[0053] CGGCCCGAACGGGCGCGGCGAACAGCTGCTCGCTTACGTGAAGACGGTGCTCG

[0054] CCGCGACGGGCGCGACCAAGGTCAATCTCGTCGGTCACAGCCAGGGCGGGCTC

[0055] ACGTCGCGCTATGTCGCGGCCGTCGCGCCCGATCTCGTCGCGTCGGTGACGACG

[0056] ATCGGCACGCCGCATCGCGGCTCCGAGTTCGCCGACTTCGTGCAGGACGTGCTC

[0057] GCATACGATCCGACCGGGCTTTCGTCGTCGGTGATCGCCGCGTTCGTCAATGTG

[0058] TTCGGGATCCTGACGAGCAGCAGCCACAACACGAACCAGGACGCGCTCGCGTC

[0059] GCTGCAGACGCTGACGACCGCACAGGCCGCCACGTACAACCAGAACTATCCGA

[0060] GCGCGGGCCTCGGCGCGCCGGGCAGTTGCCAGACCGGCGCGCCGACGGAAAC

[0061] CGTCGGCGGCAACACGCATCTGCTGTATTCGTGGGCCGGCACGGCGATCCAGCC

[0062] GACGCTCTCCGTGTTCGGCGTCACGGGGGCGACGGACACGAGCACCGTTCCGC

[0063] TCGTCGATCCGGCGAACGTGCTCGATCTGTCGACGCTCGCGCTGTTCGGCACGG

[0064] GCACGGTGATGATCAACCGCGGTTCGGGCCAGAACGACGGGCTCGTGTCGAAG

[0065] TGCAGCGCGCTGTACGGCAAGGTGCTGAGCACGAGCTACAAGTGGAACCATAT

[0066] CGACGAGATCAACCAGCTGCTCGGCGTGCGCGGCGCGTATGCGGAAGATCCGG

[0067] TCGCGGTGATCCGCACGCATGCGAACCGGCTGAAGCTCGCGGGCGTGCACCAT

[0068] CACCATCACCATTAAgaattcctgctaacaaagcccgaaaggaagctgagttgaattcactggccgtcgttttacaac

[0069] gtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagag

[0070] gcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgcctgatgcggtattttctccttacgcatctgtgc

[0071] ggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacaccc

[0072] gctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcaga

[0073] ggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtt

[0074] tcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcat

[0075] gagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattccctttttt

[0076] gcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggtt

[0077] acatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctg

[0078] ctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagt

[0079] actcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacact

[0080] gcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgcctt

[0081] gatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttg

[0082] cgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacca

[0083] cttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcac

[0084] tggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagat

[0085] cgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcattttta

[0086] atttaaaaggatctaggtgaagatccatatccttctttttctgaaccgacttctcctttttcgcttctttattccaattgctttattgacgttgag

[0087] cctcggaacccttaacaatcccaaaacttgtcgaatggtcggcttaatagctcacgctatgccgacattcgtctgcaagtttagttaag

[0088] ggttcttctcaacgcacaataaattttctcggcataaatgcgtggtctaatttttatttttaataaccttgatagcaaaaaatgccattccaa

[0089] tacaaaaccacatacctataatcgataaccacataacagtcataaaaccactcctttttaacaaactttatcacaagaaatatttaaatttt

[0090] aaatgcctttattttgaattttaaggggcattttaaagatttaggggtaaatcatatagttttatgcctaaaaacctacagaagcttttaaaa

[0091] agcaaatatgagccaaataaatatattctaattctacaaacaaaaatttgagcaaattcagtgtcgattttttaagacactgcccagttac

[0092] atgcaaattaaaattttcatgattttttatagttcctaacagggttaaaatttgtataacgaaagtataatgtttatataacgttagtataataa

[0093] agcattttaacattatacttttgataatcgtttatcgtcgtcatcacaataacttttaaaatactcgtgcataattcaacagctgacctccca

[0094] ataactacatggtgttatcgggaggtcagctgttagcacttatattttgttattgttcttcctcgatttcgtctatcattttgtgattaatttctct

[0095] tttttcttgttctgttaagtcataaagttcactagctaaatactctttttgtttccaaatataaaaaatttgatagatatattcggttggatcaatt

[0096] tcttttaagtaatctaaatccccattttttaatttctttttagcctctttaaataatcctgaataaactaatacctgtttacctttaagtgatttata

[0097] aaatgcatcaaagactttttgatttattaaataatcactatctttaccagaatacttagccatttcatataattctttattattattttgtcttatttt

[0098] ttgaacttgaacttgtgttatttctgaaatgcccgttacatcacgccataaatctaaccattcttgttggctaatataatatcttttatctgtga

[0099] aatacgatttatttactgcaattaacacatgaaaatgaggattataatcatctctttttttattatatgtaatctctaacttacgaacatatccc

[0100] tttataacactacctactttttttctctttataagttttctaaaagaattattataacgttttatttcattttctaattcatcactcattacattaggtg

[0101] tagtcaaagttaaaaagataaactcctttttctcttgctgcttaatatattgcatcatcaaagataaacccaatgcatcttttctagcttttct

[0102] ccaagcacagacaggacaaaatcgatttttacaagaattagctttatataatttctgtttttctaaagttttatcagctacaaaagacaga

[0103] aatgtattgcaatcttcaactaaatccatttgattctctccaatatgacgtttaataaatttctgaaatacttgatttctttgttttttctcagtat

[0104] acttttccatgttataacacataaaaacaacttagttttcacaaactatgacaataaaaaaagttgctttttcccctttctatgtatgtttttta

[0105] ctagtcatttaaaacgatacattaataggtacgaaaaagcaactttttttgcgcttaaaaccagtcataccaataacttaagggtaacta

[0106] gcctcgccggcaatagttacccttattatcaagataagaaagaaaaggatttttcgctacgctcaaatcctttaaaaaaacacaaaag

[0107] accacattttttaatgtggtcttttattcttcaactaaagcacccattagttcaacaaacgaaaattggataaagtgggatatttttaaaata

[0108] tatatttatgttacagtaatattgacttttaaaaaaggattgattctaatgaagaaagcagacaagtaagcctcctaaattcactttagata

[0109] aaaatttaggaggcatatcaaatgaactttaataaaattgatttagacaattggaagagaaaagagatatttaatcattatttgaaccaa

[0110] caaacgacttttagtataaccacagaaattgatattagtgttttataccgaaacataaaacaagaaggatataaattttaccctgcattta

[0111] ttttcttagtgacaagggtgataaactcaaatacagcttttagaactggttacaatagcgacggagagttaggttattgggataagttag

[0112] agccactttatacaatttttgatggtgtatctaaaacattctctggtatttggactcctgtaaagaatgacttcaaagagttttatgatttata

[0113] cctttctgatgtagagaaatataatggttcggggaaattgtttcccaaaacacctatacctgaaaatgctttttctctttctattattccatg

[0114] gacttcatttactgggtttaacttaaatatcaataataatagtaattaccttctacccattattacagcaggaaaattcattaataaaggtaa

[0115] ttcaatatatttaccgctatctttacaggtacatcattctgtttgtgatggttatcatgcaggattgtttatgaactctattcaggaattgtca

[0116] gataggcctaatgactggcttttataatatgagataatgccgactgtactttttacagtcggttttctaatgtcactaacctgccccgttag

[0117] ttgaagaaggtttttatattacagctccagatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttc

[0118] cactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaa

[0119] accaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagat

[0120] accaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcct

[0121] gttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggt

[0122] cgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctat

[0123] gagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacg

[0124] agggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctc

[0125] gtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttc

[0126] tttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagc

[0127] gcagcgagtcagtgagcgaggaagcggaaga

[0128] The experimental method is as follows:

[0129] Induced transformation of Bacillus subtilis: Prepare 3 mL of LB medium, add 62 μL of 50 g / 100 mL xylose solution to obtain a final xylose concentration of 1%. Inoculate a single colony of Bacillus subtilis into a tube containing 3 mL of liquid LB medium with a sterile inoculation loop, and incubate overnight in a constant temperature shaking incubator at 37 °C and 220 r / min. Transfer 300 μL to a tube containing 3 mL of preheated liquid xylose medium, place it in a constant temperature shaking incubator at 37 °C and 200 r / min, and continue to culture for 3 h to make competent cells. Then, aliquot 500 μL of the medium into 2 mL centrifuge tubes. Add the plasmid or DNA fragment to the centrifuge tube containing the competent cells at a ratio of 100 ng DNA / 1 mL, and mix well in a constant temperature shaking incubator at 37 °C and 200 r / min for 1.5 hours. Coat a solid LB plate with the corresponding resistance and incubate overnight in a constant temperature incubator at 37 °C to obtain genetically engineered Bacillus subtilis.

[0130] Perform expression verification on the above genetically engineered Bacillus subtilis (genetically engineered Bacillus subtilis). The specific operations include: Culturing the genetically engineered Bacillus subtilis overnight in a 4 mL LB culture medium environment at 37 °C and 220 r / min. Add 40 μL of 50 g / 100 mL xylose solution to the overnight bacterial solution, and place it again at 37 °C and 220 r / min for overnight culture. The obtained bacterial solution is centrifuged at 4000 r / min for 10 minutes at 4 °C. After washing the obtained bacterial pellet, add Coomassie Brilliant Blue for heat cell disruption treatment, and identify the BC enzyme using polyacrylamide gel electrophoresis. The identification results are shown in Figure 2 .

[0131] The above-mentioned engineered Bacillus subtilis is subjected to sporulation treatment. The specific method includes: picking a single colony of the engineered Bacillus subtilis, inoculating it on the 0th day, and preparing an overnight bacterial solution at 37 °C and an oscillation speed of 220 r / min. By adding Mn 2+ to the agar solution to prepare the agar for spore production, and the final concentration of Mn 2+ in the agar is 50 mg / L. Streak the overnight bacterial solution on the spore agar plate, and place them in an incubator at 37 °C and incubate for 7 days. Take out the spore agar plate from the incubator, elute the spores from the surface of the agar plate with deionized water, and then transfer the spore solution to a 2 mL small culture tube. Centrifuge the spore solution at 4 °C and 7000 r / min for 15 minutes. Discard the supernatant, and resuspend the precipitate 5 times with deionized water. Finally, suspend the spores in deionized water and store them at 4 °C.

[0132] The living PCL material is prepared by the melt extrusion method (for the process, see Figure 1 ). The specific method includes: mixing 5 g of PCL particles with 1 mL of the suspension of engineered Bacillus subtilis spores (the concentration of the spore suspension can be determined according to the detection by a microplate reader, and the OD600 should be between 15 and 20), vigorously shaking the mixture to make it evenly mixed, adding the mixture to a 3D printer, melting it at 120 °C and keeping it warm for 10 minutes, setting the cooling temperature of the extrusion platform at 22 °C, and the extrusion speed at 3 mm / s, and starting to prepare the living PCL material by melt extrusion. The living PCL prepared by the present invention is almost identical to traditional PCL in terms of physical properties, and its appearance is a white translucent solid ( Figure 3 ), the stress limit of the material is about 15 - 18 MPa ( Figure 4 ), and the melting point temperature is about 55 - 60 °C ( Figure 5 ).

[0133] The whole degradation process of the living PCL material. The specific method includes: dissolving Candida antarctica lipase B (CA enzyme) in deionized water, and adding the CA enzyme solution to the pre-prepared LB culture medium, so that the final concentration of the CA enzyme in the LB culture medium is 0.1 mg / mL. Add the living PCL material prepared in step 4, and culture it at 37 °C and 220 r / min for 2 - 3 days until the culture medium becomes turbid. Add a xylose solution with a concentration of 50 g / 100 mL to the turbid culture medium, and the addition ratio is xylose solution:LB culture medium = 1:100. Put the culture medium back into the incubator and culture it at 37 °C and 220 r / min for several days until the living PCL material is completely degraded and disappears. Experiments show that in this example, the living PCL material can be completely degraded and disappear after being cultured at 37 °C and 220 r / min for 3 - 7 days.

[0134] The above embodiments have been tested through multiple experiments and all achieved good experimental results. For details, please refer to Figure 5 the curve of the weight change of the material degradation process over time as shown.

Claims

1. A method for preparing a living plastic material, the method comprising the following steps: Preparing an engineered Bacillus subtilis expressing Burkholderia cepacia lipase; Culturing the engineered Bacillus subtilis to produce spores; Mixing polycaprolactone particles uniformly with the spores, and preparing the living plastic material by melt extrusion, wherein the melting is carried out under the condition of not higher than 130°C.

2. The method for preparing the living plastic material according to claim 1, wherein The step of preparing the engineered Bacillus subtilis expressing Burkholderia cepacia lipase comprises: Adding a xylose solution to an LB medium, with the final concentration of xylose being 0.5 - 2%, inoculating a single colony, culturing to make competent cells; mixing an expression plasmid carrying the gene sequence of Burkholderia cepacia lipase with the competent cells, culturing, and coating a solid LB plate with corresponding resistance, and continuing to culture to obtain the engineered Bacillus subtilis.

3. The method for preparing the living plastic material according to claim 2, wherein, The plasmid is pMK4 plasmid.

4. The method for preparing a living plastic material according to claim 1, wherein, The steps for culturing the engineered Bacillus subtilis to produce spores include: preparing an agar medium supplemented with Mn 2+ , wherein the final concentration of Mn 2+ is 20-100 mg / L, inoculating the engineered Bacillus subtilis onto the agar medium, and culturing until spores are produced.

5. A living plastic material, the living plastic material being prepared by the method according to any one of claims 1 - 4.

6. A method for degrading the living plastic material according to claim 5, the method comprising the following steps: Adding the living plastic material according to claim 5 to a culture solution containing Candida antarctica lipase B, culturing until the culture solution becomes turbid, adding a xylose solution and continuing to culture until the living plastic material is degraded.

7. According to the method of claim 6, the method comprises the following steps: Dissolving Candida antarctica lipase B in deionized water, and adding the Candida antarctica lipase B solution to a pre-prepared LB culture solution, so that the final concentration of Candida antarctica lipase B in the LB culture solution is 0.05 - 0.2 mg / mL, adding the living plastic material according to claim 5, culturing until the culture solution becomes turbid, adding a xylose solution with a concentration of 20 - 200 g / 100 mL to the turbid culture solution, with the addition ratio of the xylose solution to the LB culture solution being 0.1 - 10:100, and continuing to culture until the living plastic material degrades and disappears.

Images