A rice male semi-sterile mutant

By editing the rice OsFATB gene using the CRISPR/Cas9 system, a male semi-sterile mutant osfatb was obtained, solving the problem of unclear mechanisms of male fertility regulation in rice. This resulted in a partially fruiting mutant, promoting research in rice breeding and yield improvement.

CN118703519BActive Publication Date: 2026-02-27GUANGXI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410761911.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-13
Publication Date
2026-02-27
Estimated Expiration
2044-06-13

AI Technical Summary

Technical Problem

In the current technology, the regulatory mechanism of male fertility in rice is not fully understood, which affects the efficiency and yield improvement of hybrid rice breeding.

Method used

The OsFATB gene in rice was edited using the CRISPR/Cas9 system to obtain the homozygous OsFATB gene deletion mutant osfatb. The gene was then edited using the CRISPR/Cas9 system to construct a knockout vector, which was then transformed into Agrobacterium and used to infect rice callus tissue to obtain a male semi-sterile mutant.

Benefits of technology

The obtained osfatb mutant exhibits semi-absent pollen grains with partial seed setting, which has significant research value, helps to study the regulatory mechanism of male fertility in rice, and has the potential to increase rice yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118703519B_ABST
    Figure CN118703519B_ABST
Patent Text Reader

Abstract

The application discloses a rice male semi-sterile mutant and relates to the technical field of genetic engineering.The nucleotide sequence of the mutant is shown as SEQ ID NO.1.The gene involved in the application is named as OsFATB, the nucleotide sequence of OsFATB is shown as SEQ ID NO.2, and the rice male semi-sterile osfatb mutant is obtained by knocking out the OsFATB gene through gene editing.The application obtains a rice male semi-sterile osfatb mutant, the osfatb mutant has the phenomenon of pollen grain semi-sterility and decreased seed setting rate, and plays an important role in perfecting the regulation mechanism of rice male fertility.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a rice male semi-sterile mutant. BACKGROUND

[0002] Rice is the main economic food crop in China, and one-third of the world's population eats rice, so the increase of rice yield is related to the world food security. Male sterile mutants are mainly used in hybrid breeding, so it is of great significance to study and understand the development mechanism of rice anther, the male reproductive organ, to improve the yield of rice through genetic improvement. At present, the development of hybrid rice has traditional three-line method and two-line method as well as ordinary nuclear sterile line. Ordinary cytoplasmic male sterility (SGMS) refers to male sterility controlled by recessive nuclear genes and not affected by external environment. The study of rice male fertility has important value for the utilization of hybrid rice advantage. The growth and development of rice male organs is a continuous and complex physiological activity process. Reproductive development is a very important process in plant development, involving a series of biological processes such as pollen meiosis, tapetum degradation, pollen wall formation, anther dehiscence, pollen tube elongation, double fertilization, etc. Studies have shown that there are many nuclear genes causing male sterility.

[0003] Genes related to the regulation of rice male fertility have been discovered and reported by researchers. Currently, TDR, UDT1, EAT1, PTC1 and other genes are found to regulate rice male fertility by affecting the development of rice anther tapetum. Mutants of these genes will cause different degrees of delayed degradation of tapetum, and further cause male sterility of rice plants. For example, TDR is mainly expressed in the anther tapetum, especially at the microspore stage, and TDR regulates rice anther development by regulating the expression of OsADF. The structure and development of rice anther and pollen grain wall are also important factors affecting male fertility.

[0004] CYP704B2 regulates the growth and development of rice anther wall and pollen wall; DPW3 gene encodes a lipid transport protein, which affects the deposition of sporopollenin in pollen exine, the accumulation of starch in pollen grains, and further affects the fertility of pollen. The lipid acyl carrier protein reductase encoded by DPW is involved in the synthesis of cutin monomers, cutin wax and other substances in anther, and DPW is involved in the synthesis of anther and pollen exine. Genes such as Wda1, CYP703A3 and OsLTRG47 also regulate the formation of sporopollenin and pollen wall; more and more genes regulating the growth and development of rice male organs have been reported. Mutant osnp2 is a new DPW allelic mutant of rice male sterile gene, and according to related research, both can be used as test materials for the third generation of intelligent sterility.

[0005] In 2010, Deng Xingwang et al. successfully mass propagated the common nuclear sterile line for the first time by constructing a ternary linkage expression vector. The vector mainly uses the recessive nuclear sterile mutant ms26 / ms26 (Wuyunj 7), and is composed of the wild-type male fertile gene MS26, the pollen inactivation gene ZM-aa1 and the screening marker gene DsRed2 through genetic transformation. At present, the utilization of hybrid advantage of rice is also a key part. The growth and development of rice male organs involve the precise regulation and interaction of numerous genes, so the related genes regulating the male fertility of rice still need to be continuously explored, and thus the regulation mechanism of the male fertility of rice can be further explored. SUMMARY

[0006] In view of the above problems, the present application provides a rice male semi-sterile mutant, and the specific technical solutions are as follows:

[0007] By knocking out the related genes of waxy lipid synthesis and metabolism of rice and Arabidopsis, a mutant with reduced fertility phenotype is screened, and a mutant with reduced fertility phenotype is obtained. The mutant is a gene editing of rice OsFATB gene (OsFATB gene encodes a fatty acyl thioesterase which can hydrolyze acyl-ACP compounds to form free fatty acids), which is named osfatb mutant. The nucleotide sequence of the mutant osfatb is shown in SEQ ID No. 1. The gene editing is carried out by CRISPR / Cas9 system. The nucleotide sequence of the rice OsFATB gene is shown in SEQ ID No. 2. The nucleotide sequence of the target sequence used in the gene editing is shown in SEQ ID No. 3 and SEQ ID No. 4.

[0008] The present application also provides a knockout vector for knocking out OsFATB gene. The nucleotide sequences of the OsU6a and OsU6b promoters of the knockout vector are shown in SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11 and SEQ ID No. 12, respectively. The knockout expression vector is used for gene knockout to obtain a knockout OsFATB gene deletion homozygous mutant.

[0009] The present application also provides a CRISPR / Cas9-sgRNA expression plasmid containing the target sequence.

[0010] The present application also provides an E. coli DH5α and Agrobacterium EHA105 containing the knockout expression vector of the target sequence.

[0011] The present application also provides a preparation method of a male semi-sterile rice mutant, comprising the following steps:

[0012] (1) Construct a CRISPR / Cas9 system knockout expression vector containing the target sequence as described in claim 3;

[0013] (2) Transform the knockout expression vector into Agrobacterium EHA105;

[0014] (3) Infiltrate the rice callus with the Agrobacterium EHA105, induce the rice callus to obtain regenerated seedlings;

[0015] (4) Screen and identify the transgenic homozygous line, i.e. the male semi-sterile rice mutant.

[0016] Compared with the prior art, the beneficial effects of the present application are:

[0017] The present application edits the OsFATB gene through the CRISPR / Cas9 system, and obtains a positive mutant single plant by genetically transforming the wild type Zhonghua 11 rice variety, and analyzes and identifies the mutant single plant by sequencing method. Through the method, an important rice male semi-sterile osfatb mutant is obtained, and compared with the wild type Nipponbare, the obtained osfatb mutant has the same growth as the wild type in the vegetative stage, normal development of the pistil in the mature stage, semi-sterile pollen grains, and partial setting. The present application has important value for studying the regulation mechanism of rice male fertility. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiment description.

[0019] Figure 1 For the target point mutation of the male semi-sterile mutant osfatb of the present application;

[0020] Figure 2 For the comparison chart of the potassium iodide staining of mature pollen grains of the wild type Zhonghua 11 and the male semi-sterile mutant osfatb of the present application;

[0021] Figures 3-4 For the comparison chart of the phenotype of the mature stage of the wild type Zhonghua 11 and the male semi-sterile mutant osfatb of the present application, wherein Figure 3 For the comparison chart of the ear type of the wild type Zhonghua 11 (left) and the osfatb of the present application (right) at the mature stage, Figure 4 For the comparison chart of the plant type of the wild type Zhonghua 11 and the male semi-sterile mutant osfatb of the present application at the mature stage;

[0022] Figure 5 For the setting chart of the rice mutant osfatb of the present application after saturated pollination;

[0023] Figure 6The seed setting rate of wild type Zhonghua 11 and the male semi-sterile mutant osfatb of the application. DETAILED DESCRIPTION

[0024] The specific embodiments of the application are described in detail below, but it should be understood that the scope of protection of the application is not limited by the specific embodiments.

[0025] The application provides a rice OsFATB gene deletion mutant osfatb, and the nucleotide sequence of the mutant osfatb is shown as SEQ ID No. 1.

[0026] The application provides a nucleotide sequence of a rice OsFATB gene, and the nucleotide sequence of the gene is shown as SEQ ID No. 2.

[0027] The OsFATB gene is located on the 11th chromosome of rice, encodes a fatty acyl-ACP thioester, and the locus is LOC_Os11g43820.

[0028] The application uses a CRISPR / CAS9 system to edit the OsFATB gene, and the primer sequences used in the experiment are as follows:

[0029] Target sequence one: TAGGCTTTGCGACAATGCCA (SEQ ID No. 3);

[0030] Target sequence two: GAAGACCAGCAGTCCTCACA (SEQ ID No. 4);

[0031] Sequencing primer: SP-L1: GCGGTGTCATCTATGTTACTAG (SEQ ID No. 5);

[0032] SP-R: TGCAATAACTTCGTATAGGCT (SEQ ID No. 6);

[0033] Universal primer for constructing a complete sgRNA expression box:

[0034] U-F: CTCCGTTTTACCTGTGGAATCG (SEQ ID No. 7);

[0035] gR-R: CGGAGGAAAATTCCATCCAC (SEQ ID No. 8);

[0036] gRT1: TAGGCTTTGCGACAATGCCAgttttagagctagaaat (SEQ ID No. 9);

[0037] OsU6aT1 : TGGCATTGTCGCAAAGCCTAC ggca gccaagccagca (SEQ ID No. 10);

[0038] gRT2: AAGACCAGCAGTCCTCACA gtTTTtagagctagaaat (SEQ ID No. 11);

[0039] OsU6bT2: TGTGAGGACTGCTGGTCTTC aaca caagcggcagc (SEQ ID No. 12);

[0040] Pps-R: TTCAGAGGTCTCTACCGACTAGTCACGCGTATGGAATCGGCAGCAAA (SEQ ID No. 13);

[0041] Pgs-2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC (SEQ ID No. 14);

[0042] Pps-2: TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG (SEQ ID No. 15);

[0043] Pgs-L: AGCGTGGGTCTCGCTCGACGCGTATCCATCCACTCCAAGC (SEQ ID No. 16).

[0044] Example 1

[0045] OsFATB gene CRISPR / CAS9 (gene knockout) experiment.

[0046] The present application takes Zhonghua 11 rice variety as the genetic transformation background, takes the OsFATB gene coding nucleotide sequence as the template to design two target sequences, and the target nucleotide sequences are shown in (SEQ ID No. 3) and (SEQ ID No. 4). The primer design is completed on the website (http: / / skl.scau.edu.cn / ), and the design method refers to the method of Zeng Dongchang et al. The pYLCRISPR / Cas9Pubi-H is used as the transformation vector, the promoters OsU6a and OsU6b are selected as the promoters of sgRNA, the PUC18 vector loaded with sgRNA is used as the intermediate vector of the expression cassette, and the two promoter nucleotide sequences are SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11 and SEQ ID No. 12. The sgRNA expression cassette is constructed by the overlapping method, and the sgRNA expression cassette is cloned into the pYLCRISPR / Cas9 vector by the method of cutting and connecting.

[0047] 1. The pYLCRISPR / Cas9 vector containing the OsFATB gene target sequence is transformed into E. coli, and the steps are as follows:

[0048] (1) A prepared E. coli competent cell is taken out from the-80℃ refrigerator and placed on ice to melt.

[0049] (2) The above-mentioned ligation product is added to the melted 100 μL competent cell suspension, mixed and placed on ice for 30 min.

[0050] (3) 42℃ heat shock for 30 s, and immediately placed on ice for 2 min.

[0051] (4) 500 μL of LB liquid medium without antibiotics is added, and cultured at 37℃, 200 rpm for 1 hour to obtain the activated bacteria solution.

[0052] (5) The activated bacteria solution is centrifuged at 4000 rpm for 1 min, and part of the supernatant is removed in the clean bench, and the precipitate is mixed and mixed by gently sucking with a pipette. 100 μL of bacteria solution is sucked and coated on the LB plate containing kanamycin, and the plate is cultured in a 37℃ incubator overnight.

[0053] (6) A single colony is picked and colony PCR is performed using primers SP-L1 and SP-R on the vector (pYLCRISPR / Cas9Pubi-H) skeleton. The primer pair is shown in SEQ ID No. 5 and SEQ ID No. 6.

[0054] 2, 1% agarose gel electrophoresis to verify, identify positive single colonies after picking bacteria to 10 mL containing kanamycin LB culture solution, 37°C, 220 rpm incubator overnight culture.

[0055] 3, according to the plasmid extraction instructions to extract E. coli plasmid, the extracted plasmid DNA collected in a clean centrifuge tube, -20°C preservation.

[0056] 4, plasmid sequence determination and sequence analysis: the positive clone plasmid to the company for sequencing. Sequence alignment of the sequencing results, to confirm the correctness of sgRNA sequence, the positive clone plasmid named CRISPR / Cas9-OsFATB.

[0057] Example 2

[0058] Agrobacterium mediated genetic transformation of rice callus:

[0059] After the correct identification of the plasmid sequence, the plasmid is transformed into Agrobacterium, the specific steps are as follows:

[0060] (1) take the-80℃ preserved Agrobacterium competent EHA105 on ice to melt;

[0061] 3 μL plasmid is added to 100 μL competent, slightly mixed, and sequentially placed on ice for 5 min, liquid nitrogen for 5 min, 37°C water bath for 5 min, ice bath for 5 min;

[0062] (2) add 750 μl of YEP / LB medium without antibiotics in the clean bench, 28°C, 200 rpm shaking culture for 2h in the dark;

[0063] (3) using centrifuge for 6000 rpm centrifugation for 1 minute, remove the supernatant, leave about 100 microliters, coated on the YEP medium containing kana and Rif 28°C culture for 2-3 days;

[0064] (4) pick single colony, use hygromycin primer for detection to obtain positive clones and expand culture in 3 mL of liquid K+ / Rif medium, further positive K+ / Rif bacterial liquid to the company for genetic transformation of rice in the background of Zhonghua 11.

[0065] Example 3

[0066] Identification of rice osfatb mutant genotype

[0067] (1) CTAB extraction method (Murray et al. 1980) to extract the genomic DNA of rice osfatb mutant T0 generation plants. The extracted mutant plant genomic DNA was used as a template to amplify the full-length sequence of the knockout target gene in the transgenic plants using FT-1 primer pairs. The PCR product fragment size was 780 bp, and the FT-1 primer pairs were as follows:

[0068] FT-1F: 5' GCCGTGAAGGGAAGTT 3' (SEQ ID NO. 17),

[0069] FT-1R: 5' GTTGCCTGAGTAAGAAT 3' (SEQ ID NO. 18);

[0070] The PCR reaction additive system was as follows:

[0071]

[0072]

[0073] The PCR reaction condition system was as follows:

[0074]

[0075] (2) Recovery and sequencing of PCR products

[0076] 1) The PCR product was subjected to 1% agarose gel electrophoresis, and the PCR product was recovered using the Shengwo PCR recovery and purification kit, and stored. The reaction system and specific operations were as follows:

[0077] ① The gel block containing the target fragment was cut from the agarose gel and weighed.

[0078] ② Add Buffer B2 3-6 times the weight of the gel block, and dissolve the gel at 50°C for 5-10 minutes.

[0079] ③ Transfer the gel solution to the adsorption column and centrifuge at 8000Xg for 30 seconds. Discard the liquid in the collection tube.

[0080] ④ Add 500 μL Wash Solution, centrifuge at 9000Xg for 30 seconds, and discard the liquid in the collection tube.

[0081] ⑤ Repeat step 6 once.

[0082] ⑥ Centrifuge the empty adsorption column at 9000Xg for 1 minute.

[0083] ⑦Put the adsorption column into a clean 1.5 mL centrifuge tube, add 30 μL Elution Buffer to the center of the adsorption membrane, stand for 1 minute at room temperature, and then centrifuge for 1 minute. Store the DNA solution in the tube.

[0084] The recovered product was sent to Shenguo Bioengineering (Shanghai) Co., Ltd. for sequencing analysis. The measured mutant sequence of OsFATB gene was compared with the wild type Nipponbare sequence, and the results are shown in Figure 1 , from which it can be seen that the mutant genotype osfatb mutant strain can be obtained. Figure 1

[0085] Example 4:

[0086] Phenotypic identification of rice osfatb mutant

[0087] I. Pollen fertility identification

[0088] Rice osfatb mutant and wild type Zhonghua 11 were planted in the rice nursery of Guangxi University at the same time. At the heading and flowering stage, 3-6 glumes of Zhonghua 11 and mutant osfatb to be flowered on the same day were taken at 10 am, and the anthers of the glumes were crushed on a glass slide with tweezers, and 1% I2-KI was added for staining. The staining of pollen grains was observed and recorded, and the results are shown in Figure 2 .

[0089] II. Saturated pollination experiment

[0090] At the heading and flowering stage of rice, the top of the glume of rice mutant osfatb was removed at 8 am, and at 10:30 am when the wild type Zhonghua 11 flower opened, a large amount of pollen was shaken into the mutant glume with the shell cut, to ensure that the pistil of mutant osfatb received sufficient viable pollen grains. As shown in Figure 3 , after saturated pollination, the seed setting rate of mutant osfatb was greatly improved, and the statistical seed setting rate was 75%. This experiment clearly shows that the pistil of rice mutant osfatb develops normally, indicating that the mutant osfatb is a male semi-sterile phenotype.

[0091] III. Observation and statistics of seed setting rate

[0092] Rice osfatb mutant and wild type Zhonghua 11 were planted in the rice nursery of Guangxi University at the same time. At the mature stage, the panicle type and plant type of rice osfatb mutant and wild type Zhonghua 11 were observed, as shown in Figure 4 and Figure 5 ​The wild type Zhonghua 11 and mutant osfatb were selected respectively, 10 strains of each, and the seed setting of 3 ears of each strain was recorded. The average seed setting rate of each strain was calculated. The average seed setting rate of each 10 strains represented the seed setting rate of wild type and mutant. The wild type Zhonghua 11 rice set seeds normally, and the seed setting rate of each strain was 89.49%. The rice osfatb mutant only partially set seeds, and the seed setting rate of each strain was 34.43%. The above results are shown in Table 1. Figure 6

[0093] The foregoing description of specific exemplary embodiments of the application has been presented for the purpose of illustration and description. It is not intended to be exhaustive or to limit the application to the precise forms disclosed, and obviously many modifications and variations are possible in light of the above teaching. Optional combinations of the described embodiments, and optional substitutions of elements from different embodiments of the application, are also possible in a manner apparent to those having skill in this art. The intent is to cover all modifications, equivalents, and alternatives falling within the scope of the application. The scope of the application is defined by the following claims.​

Claims

1. A method for preparing a male-sterile rice mutant, characterized in that, The mutant was created using the CRISPR / Cas9 system in rice. OsFATB Genes are obtained through gene editing, specifically including the following steps: (1) Construct a CRISPR / Cas9 knockout expression vector containing a target sequence; the target sequence is shown in SEQ ID No. 3 and SEQ ID No. 4; (2) Transform the knockout expression vector into Agrobacterium EHA105; (3) Infect rice callus tissue with the Agrobacterium EHA105 and induce the rice callus tissue to obtain regenerated seedlings; (4) Screening and identifying transgenic homozygous lines yields the male semi-sterile rice mutant; the rice OsFATB The nucleotide sequence of the gene is shown in SEQ ID No. 2; OsFATB The nucleotide sequence of the gene after gene editing is shown in SEQ ID No.

1.

2. The method for preparing a male semi-sterile rice mutant according to claim 1, characterized in that, The knockout expression vector contains an OsU6a promoter and an OsU6b promoter, the OsU6a promoter sequence is shown in SEQ ID No. 10, and the OsU6b promoter sequence is shown in SEQ ID No. 12.

Citation Information

Patent Citations

  • Modified cereal grain

    WO2023077199A1