Application of ZmA3A1 gene and InDel molecular marker in regulating corn leaf length

By applying the ZmA3A1 gene and the InDel molecular marker, the length of maize leaves was regulated, which solved the problem of overlapping leaves and improved light energy utilization and maize yield.

CN118703524BActive Publication Date: 2026-01-20HENAN AGRICULTURAL UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410847029.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-27
Publication Date
2026-01-20
Estimated Expiration
2044-06-27

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control the length of corn leaves, leading to overlapping leaves in high-density planting, which affects light capture and corn yield.

Method used

Using the ZmA3A1 gene and InDel molecular marker, maize leaf length was regulated by overexpressing or silencing the ZmA3A1 gene. Specific primers were designed for PCR amplification and sequencing to identify leaf length.

Benefits of technology

It enables precise control of corn leaf length, reduces the shading effect, improves light energy utilization, and promotes corn yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118703524B_ABST
    Figure CN118703524B_ABST
Patent Text Reader

Abstract

The application belongs to the field of crop genetic breeding, and relates to regulation of corn leaf length, in particular to ZmA3A1 Application of a gene and an InDel molecular marker in regulation of corn leaf length. ZmA3A1 The gene Zm00001d007139 (Zm007139) involved in the regulation factor encodes an AAA-type ATPase related protein with 853 amino acids, and the molecular biological function of the protein has not been reported in corn. The application studies the molecular biological function of the gene in regulation of corn leaf length, and provides a potential new gene resource for breeding of a new excellent high-yield corn variety with suitable leaf length.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of crop genetic breeding, and relates to the regulation of corn leaf length, in particular to ZmA3A1 The application of genes and InDel molecular markers in regulating corn leaf length. BACKGROUND

[0002] Corn is one of the most important grain crops in the world, and increasing yield per unit area has been one of the most important goals of breeders in cultivating new corn varieties and the most important goal of corn production. In the past few decades, yield per unit area has also been significantly improved under high-density planting. Through a retrospective analysis of corn varieties, it is clear that corn plant type plays a very important role in yield per unit area under high-density planting. Among the many agronomic traits related to plant type, such as leaf length, it has played a leading role in adapting to the historical increase in corn planting density since 1950. With the gradual reduction of arable land, planting density is likely to continue to be one of the main goals of corn breeding in the coming years. Therefore, breeding corn with an optimized plant structure is considered one of the most important goals for improving corn yield.

[0003] With years of practice and exploration, people have constantly summarized and concluded the ideal plant type, and finally reached a consensus that the leaves above the ear are upwashed and relatively narrow and short, which is beneficial to improve the light distribution of the population; the leaf angle of the leaves below the ear is relatively large and slightly large (slightly wide, slightly long), which can effectively intercept light energy. Therefore, breeders usually select and breed according to leaf type, root type, stem type, and ear type, etc. because these traits are relatively easier to observe directly with the naked eye, thereby improving the efficiency of breeding. In corn, the size and shape of the leaves affect the synthesis of organic matter by affecting the canopy structure of the corn population, and thus become an important part of regulating plant type. In a corn field, if the spacing between corn plants is small, their leaves will overlap and crowd together, which will result in the leaves below the ear receiving almost no sunlight, and even the leaves above the ear cannot completely intercept sunlight, thus easily inducing shade avoidance syndrome, which can cause significant yield reduction in corn. Changes in leaf length affect changes in leaf type, and the shading effect between individuals can be reduced by selecting a suitable leaf length of plant type.

[0004] Leaf length is a complex quantitative trait controlled by multiple genes. To date, numerous quantitative trait loci (QTLs) associated with leaf length have been identified using different genetic populations. Simultaneously, some genes and mutants related to maize leaf length have been identified. For example, studies have found that ZmPLA1 stimulates the duration of leaf elongation and thus increases leaf length by maintaining dividing cells in a proliferating, undifferentiated state for a longer period. Therefore, by exploring genes regulating maize leaf length and cultivating superior germplasm with suitable leaf length, reliable and superior germplasm can be provided for breeding new maize varieties with ideal plant architectures. Summary of the Invention

[0005] To further explore genes related to maize leaf length, this invention proposes a... ZmA3A1 Application of genes and InDel molecular markers in regulating maize leaf length.

[0006] The technical solution of this invention is implemented as follows:

[0007] ZmA3A1 The application of genes in regulating maize leaf length, the ZmA3A1 The gene encodes a protein associated with AAA-type ATPase, which is a negative regulator of maize leaf length.

[0008] The above ZmA3A1 The gene has a nucleotide sequence that is more than 90% similar to the coding region of SEQ ID No. 1, from 109 to 3282 bp.

[0009] The coding region sequence of the ZmA3A1 gene is shown as 109-3282bp in SEQ ID No. 1.

[0010] The amino acid sequence of the AAA-type ATPase-related protein is shown in SEQ ID No. 2.

[0011] The aforementioned application specifically refers to: overexpression in maize plants. ZmA3A1 The function of the gene is to produce corn plants with shorter leaves; silencing the gene in corn plants. ZmA3A1 The function of the gene is to produce a corn plant with longer leaves.

[0012] InDel molecular markers associated with maize leaf length are located on maize chromosome 2. ZmA3A1 The 9th intron of the gene (Zm00001d007139 V5 second version), specifically the 6614th base C / - downstream of the start codon.

[0013] The primer pairs used to identify the aforementioned InDel molecular markers have sequences shown in SEQ ID No. 3 and SEQ ID No. 4.

[0014] The method for identifying maize leaf length using the above primer pairs includes the following steps:

[0015] (1) Using the genomic DNA of the sample to be tested as a template and the above primer pairs as primers, PCR amplification was performed;

[0016] (2) Sequencing the PCR amplification product from step (1) and comparing it with the nucleotide sequence shown in SEQ ID No. 5 (Yu1122 reference sequence) is used to identify the length of corn leaves.

[0017] If the PCR amplification product of the sample to be tested is consistent with the nucleotide sequence shown in SEQ ID No. 5, it is a short-leaf maize plant; otherwise, it is a long-leaf maize plant.

[0018] The present invention has the following beneficial effects:

[0019] 1. The regulatory factor involved in this application is gene Zm00001d007139 ( ZmA3A1 This gene encodes an 853-amino acid AAA-type ATPase-related protein, the molecular biological function of which has not yet been reported in maize. This invention investigates the molecular biological function of this gene in regulating maize leaf length and provides a potential new gene resource for breeding superior, high-yielding maize varieties with suitable leaf lengths.

[0020] 2. The purpose of this invention is to provide a gene for controlling the length of maize leaves. ZmA3A1 The candidate gene was accurately isolated using genome-wide association analysis. This gene possesses the DNA fragment shown in SEQ ID No. 1. Increased mRNA accumulation of this gene leads to shorter maize leaves; therefore, cloning this gene will contribute to understanding the molecular mechanisms underlying maize leaf length.

[0021] 3. This invention will be based on Figure 1 The InDel primers designed based on the sequences shown, such as SEQ ID No. 3 and SEQ ID No. 4, can be applied to the identification of maize leaf length. This can predict the leaf length of different germplasm materials and has important practical application significance for maize breeding. Attached Figure Description

[0022] In order to make the technical solutions of the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments or prior art description will be briefly introduced. Obviously, the accompanying drawings in the following description only need to be some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort.

[0023] Figure 1 For ZmA3A1 The proof of regulating the length of corn leaves. (A) Population structure analysis of 385 inbred lines in the association population; (B) The whole genome association analysis proves a key region on the 2nd chromosome related to the length of leaves; (C) The association analysis of candidate genes proves that an InDel is significantly related to the length of leaves; (D) ZmA3A1 Haplotype analysis of the InDel. The top graph shows the haplotype distribution of the InDel in the 9th intron region; the lower left graph compares the length of leaves of different haplotype corn inbred lines; the lower right graph compares the expression level of ZmA3A1 in the haplotype 1 (Hap1) inbred line and the haplotype 2 (Hap2) inbred line. ZmA3A1 A significantly related InDel in the 9th intron region; the lower left graph compares the length of leaves of different haplotype corn inbred lines; the lower right graph compares the expression level of ZmA3A1 in the haplotype 1 (Hap1) inbred line and the haplotype 2 (Hap2) inbred line. ZmA3A1 The sequence analysis of the representative inbred line of short leaves (Hap1) Y1122 and the representative inbred line of long leaves (Hap2) DH60.

[0024] Figure 2 For ZmA3A1 The expression analysis of the representative inbred line of haplotype I Y1122 and the representative inbred line of haplotype II NH60. (A) The length of leaves of the representative inbred line of haplotype I Y1122 and the representative inbred line of haplotype II NH60; (B) ZmA3A1 The expression level of the representative inbred line of haplotype I Y1122 and the representative inbred line of haplotype II NH60.

[0025] Figure 3 The phenotype identification results of the EMS mutant line and the wild type Zheng58 show that the leaves of the mutant are longer than the wild type leaves. (A) The splicing site of the 25th intron of ZmA3A1 is mutated from G to A; (B) The leaves of the mutant are longer than the wild type Zheng58 leaves (the top three leaves above the ear); (C) The expression level of ZmA3A1 in the mutant is significantly lower than that in the wild type. DETAILED DESCRIPTION

[0026] The technical solutions of the present application will be described clearly and completely in combination with the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without any creative effort belong to the scope of protection of the present application.

[0027] The experimental methods used in the following experimental examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0028] ZmA3A1 The application of the gene in regulating the length of corn leaves, the gene ZmA3A1 The gene is a gene encoding an AAA-type ATPase related protein, which is a negative regulatory factor for regulating the length of corn leaves.

[0029] The above-mentioned ZmA3A1 The above-mentioned gene is a nucleotide sequence with more than 90% similarity with the coding region of 109-3282 bp in SEQ ID No. 1.

[0030] The coding sequence of the above-mentioned ZmA3A1 gene is shown in 109-3282 bp of SEQ ID No. 1.

[0031] The amino acid sequence of the above-mentioned AAA-type ATPase related protein is shown in SEQ ID No. 2.

[0032] The above-mentioned application, specifically refers to: overexpressing ZmA3A1 The function of the gene in corn plants to obtain corn plants with shorter leaves; silencing ZmA3A1 The function of the gene in corn plants to obtain corn plants with longer leaves.

[0033] The InDel molecular marker related to the length of corn leaves, the above-mentioned InDel molecular marker is located at the 9th intron of the gene on chromosome 2, i.e. the 6613th base C / - downstream of the start codon. ZmA3A1

[0034] The primer pair for identifying the above-mentioned InDel molecular marker, the sequences of which are shown in SEQ ID No. 3 and SEQ ID No. 4.

[0035] A3A1 -F1 (SEQ ID No. 3): 5'-CGTTTTATCACTTATGGTTG-3';

[0036] A3A1 -R1 (SEQ ID No. 4): 5'-CCTGATTAGAATAGACTACA-3';

[0037] The function of ZmA3A1 gene and the use of InDel molecular marker in the present application will be demonstrated in the following specific examples:

[0038] Example 1 ​

[0039] Corn leaf length negative regulation sub ZmA3A1 There is a polymorphism between the corn inbred line with shorter leaves, Jiy1122, and the inbred line with longer leaves, NH60, which shows the difference in leaf length. To further verify, the following experiments were carried out:

[0040] A corn association population was constructed using 385 inbred lines with significant differences in leaf length. Illumina sequencing was performed on 385 inbred lines by high-throughput resequencing technology, with an average genome coverage of 7.5 times. By comparing the sequencing data with the B73 reference genome (V_4), a total of 12,987,527 SNPs and 3,763,324 InDels were identified. Based on these SNP and InDel data, we analyzed the genetic structure of the association population, and the 385 inbred lines were divided into four groups, including the Reed group, the Lancaster group, the Tang Sihoutou group and a group of germplasm selected from American hybrids (Zea Mays L.). Figure 1 A).

[0041] The leaf length of 385 inbred lines was identified in Zhengzhou in two seasons, and whole genome association analysis was performed using rMVP. Mixed linear model was used for whole genome association analysis of leaf length, and the candidate region on chromosome 2 was identified with stronger association ( Figure 1 B). In the region, an InDel in the gene region of a gene was identified to be significantly associated with leaf length. Further analysis of the candidate gene showed that the InDel in the gene region of Zm00001d007139 was the strongest ( Figure 1 C).

[0042] The candidate gene in this region was preliminarily determined as Zm00001d007139, which encodes AAA-type ATPase related protein and is located on chromosome 2, and is named ZmA3A1 . The gene consists of 28 exons and 27 introns, and an InDel in the 9th intron region significantly affects the length of corn leaves. The full length of the gene can be searched by gene number Zm00001d007139 on MaizeGDB. The 385 inbred lines were divided into two haplotypes by an InDel, and the difference in leaf length between the two haplotypes reached a significant level ( Figure 1 D); 10 inbred lines were selected from the two haplotypes to analyze the expression of ZmA3A1, and the expression of haplotype I was significantly higher than that of haplotype II ( Figure 1D). The gene was cloned by using the mRNA of the short-leaf inbred line Y1122 (haplotype I) and the long-leaf inbred line NH60 (haplotype II) as templates, and the DNA of the two materials as templates, and the InDel sequence in the 9th intron region of the gene was separated by using A3A1 F1 and A3A1 R1.

[0043] A3A1 F1: 5'-CGTTTTATCACTTATGGTTG-3';

[0044] A3A1 R1: 5'-CCTGATTAGAATAGACTACA-3';

[0045] The reaction system was as follows:

[0046]

[0047] PCR reaction procedure (three-step method):

[0048]

[0049] The sequence difference analysis result shows that the sequence in the 9th intron region of the gene has a significant InDel difference between Y1122 and NH60. Figure 1 E).

[0050] The method for identifying the corn leaf length by using the primer pair is as follows:

[0051] (1) The genomic DNA of the sample to be tested is used as a template, and the primer pair is used as a primer for PCR amplification;

[0052] (2) The PCR amplification product of step (1) is sequenced and compared with the nucleotide sequence of the Y1122 reference sequence (such as SEQ ID No. 5) for identifying the corn leaf length.

[0053] If the PCR amplification product of the sample to be tested is consistent with the nucleotide sequence of the Y1122 reference sequence (such as SEQ ID No. 5), it is a short-leaf corn plant; otherwise, it is a long-leaf corn plant.

[0054] Example 2

[0055] ZmA3A1 Negative regulation of corn leaf length:

[0056] To further clarify ZmA3A1The expression levels of different types of representative inbred lines were detected by selecting the inbred line Y1122 with shorter leaves from haplotype I and the inbred line NH60 with longer leaves from haplotype II as representatives ZmA3A1 The expression of the gene.

[0057] The qRT-PCR technique (referring to Li Hua-feng, Identification of Ds insertion sites in maize Ac / Ds mutant library and drought resistance function of Ds mutant ZmC2H2-149, Doctoral dissertation of Henan Agricultural University, 2024) was used to detect the expression of the target gene ZmA3A1 Expression level analysis.

[0058] Firstly, a pair of specific primers were obtained by using the software Primer Premier 5.0 according to the CDS sequence of the gene:

[0059] qA3A1-F1: 5'-GTGGAAACAGCTATTGGGTC-3';

[0060] qA3A10-R1: 5'-ATACCATGGCGGGTTAGAAA-3';

[0061] The cDNA was used as a template, and the housekeeping gene GAPDH was used as a control:

[0062] GAPDH-qF: CTGGTTTCTACCGACTTCCTTG;

[0063] GAPDH-qR: CGGCATACACAAGCAGCAAC;

[0064] The reaction system was as follows:

[0065]

[0066] qPCR reaction program (three-step method):

[0067]

[0068] Through the above steps, the Ct value of each sample can be obtained, and the gene expression level of the sample is calculated accordingly. The specific operation includes the following steps: first, calculate the average Ct value of each gene (including the internal reference), then subtract the Ct value of the internal reference from the Ct value of the gene, and obtain the ΔCt value of each sample gene. Further, subtract the ΔCt value of the control group from the ΔCt value of the experimental group to obtain the ΔΔCt value. The specific calculation formula is as follows: ΔΔCt = (Ct (target gene) - Ct (reference gene)) of experimental group - (Ct (target gene) - Ct (reference gene)) of control group. The relative expression level between the experimental group and the control group can be obtained by calculating 2^(-ΔCt).

[0069] The results showed that the leaves at the 9-leaf stage of maize growth and development... ZmA3A1 The expression level of the representative inbred line of haplotype I, Yu1122, was significantly higher than that of the representative inbred line of haplotype II, NH60. Figure 2 Therefore, it is proposed that... ZmZmA3A1 It acts as a negative regulator of maize leaf length.

[0070] Example 3

[0071] ZmA3A1 Verification of gene function in EMS mutants:

[0072] We found a mutant of ZmA3A1 in our maize EMS mutant library, which mutates from G to A at the splicing site of the 25th intron of ZmA3A1. Figure 3 A), which prevents the intron from being cleaved.

[0073] To clarify ZmA3A1 Whether the mutant affects leaf length was investigated by observing the results of two seasons in Zhengzhou. ZmA3A1 Leaf length was determined in mutant and wild-type (WT) lines.

[0074] In this experiment, each plot had 20 plants, with a row length of 5 meters and 3 replicates. Ten plants were measured consecutively in each plot. The length of the three leaves at the top of the ear of each plant was measured. The length of the same leaf on all individual plants in each plot represents the length of the leaves at that part of the ear in that plot.

[0075] The results showed ZmA3A1 The upper leaves of the ear in the mutant are significantly longer than those in the wild type. Figure 3 B), and ZmA3A1 The expression level of [the substance] was significantly lower in the mutant than in the wild type. Figure 3 C), indicating that this gene negatively regulates maize leaf length. This demonstrates the control... ZmA3A1 Gene expression can be used to cultivate inbred lines with varying leaf lengths as basic breeding materials, which can then be used to breed hybrids with suitable leaf lengths for widespread application in production.

[0076] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. silencing or knocking out ZmA3A1 the use of a gene in the elongation of maize leaves, characterized in that: The ZmA3A1 The ZmA3A1 gene is a gene encoding AAA-type ATPase related protein, and the coding region sequence of the ZmA3A1 gene is shown as 109-3282 bp in SEQ ID No. 1.

Citation Information

Patent Citations

  • ZmCLA1 gene capable of controlling sizes of included angles of maize leaves as well as method and application of ZmCLA1 gene in breeding high-density-tolerant maize

    CN104480121A

  • Gene Lfy1 for controlling flowering phase and leaf number on ear of corn and application of gene Lfy1

    CN115747248A