KASP technology-based development of a core set of snp molecular markers for rhododendron, primer set and application
By developing a set of core SNP molecular markers and primers for rhododendrons based on KASP technology, the problems of low efficiency and poor representativeness in rhododendron variety identification have been solved, enabling rapid and accurate germplasm identification and resource management, and supporting molecular marker-assisted breeding.
Patent Information
- Application Number
- CN202410817018.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-24
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2044-06-24
AI Technical Summary
Existing technologies for rhododendron variety identification suffer from long working cycles, susceptibility to cultivation practices and environmental influences, difficulty in achieving efficient and automated variety identification and resource utilization, limited SSR marker detection sites, and poor result representativeness, failing to meet the needs of large-scale, high-throughput detection.
We developed a core SNP molecular marker set for rhododendrons based on KASP technology, including 31 SNP markers and corresponding KASP primer sets, for rapid, high-throughput identification of rhododendron germplasm and varieties, and to construct an SNP fingerprint library and perform genetic diversity analysis.
It enables rapid and accurate identification of rhododendron germplasm and varieties, solves the problems of resource redundancy and intellectual property disputes, supports molecular marker-assisted breeding, and improves identification efficiency and accuracy.
Smart Images

Figure CN118703669B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology and plant molecular breeding technology, specifically involving the development of a rhododendron core SNP molecular marker set, primer set and their application based on KASP technology. Background Technology
[0002] Azaleas are world-renowned ornamental flowers and one of my country's ten traditional famous flowers. With the continuous advancement of azalea germplasm resource conservation and the increasing number of azalea varieties bred in my country, a series of problems have arisen, including how to distinguish similar varieties and how to identify counterfeit varieties. Currently, the sorting of phylogenetic relationships among azalea varieties, the classification of cultivar groups, and the breeding and identification of new azalea varieties mainly rely on observing morphological characteristics and agronomic traits. This process is lengthy and easily affected by cultivation practices, environmental conditions, and human factors, becoming one of the bottlenecks in the efficient utilization of germplasm resources and variety identification.
[0003] In recent years, advancements in molecular biology have enabled variety identification to reach the genetic level. Compared to traditional morphological methods and protein electrophoresis, DNA marker technology reveals more polymorphisms and offers advantages such as accuracy, reliability, simplicity, speed, and ease of automation, making it a leading trend in variety identification technology. The International Union for the Protection of New Varieties of Plants (UPOV) published the DNA Molecular Marker Selection and Database Construction Guidelines (BMT Guidelines) in 2010, highlighting SSR and SNP markers as particularly suitable methods for variety identification. SSR markers possess advantages such as high polymorphism and co-dominance, leading to their mature and widespread application in variety identification. However, in practice, they have also revealed insurmountable drawbacks, including a limited number of detection sites, poor result representativeness, and difficulty in data sharing. Although SSR markers have been applied in rhododendron variety resource classification, demonstrating advantages such as high polymorphism and ease of operation, they cannot meet the demands of large-scale, high-throughput, and automated detection.
[0004] SNP markers, as third-generation molecular markers, have the following advantages compared to SSR markers: First, they have higher density and more uniform distribution in the genome; second, they are simpler to identify and can be used for rapid, high-throughput genotyping analysis; third, they are more suitable for database integration and data sharing; and fourth, they have a high correlation with functional genes and even plant phenotypes. Therefore, SNP markers are currently recognized as a molecular marker technology with great application potential. SNP sites can be detected using various platforms such as sequencing, microarrays, and PCR. Among them, KASP (Competitive Allele-Specific PCR) is a fluorescence-based genotyping technique that uses specific matching of primer terminal bases to genotype SNPs. It detects multiple SNP sites using two site-specific probes and two fluorescent probes, thus performing accurate bicelestemization of the target SNP. Compared with other SNP genotyping methods, this technology has advantages such as high stability and accuracy, can be performed in basic molecular laboratories, has high genotype retrieval throughput, and low detection cost. KASP technology is currently mainly used in the typing research of SNP or Indel genes, and has played an important role in DNA fingerprinting, genetic diversity analysis and molecular marker-assisted selection breeding of various crops and horticultural plants.
[0005] There are hundreds of thousands to millions of SNP sites associated with rhododendron characteristics, but so far no set of SNP molecular markers based on KASP technology has been found to identify rhododendron germplasm or varieties. Summary of the Invention
[0006] To overcome the shortcomings of the existing technology, this invention proposes a core SNP molecular marker set for rhododendrons developed based on KASP technology. Based on the above SNP molecular marker set, rapid and high-throughput identification and evaluation of rhododendron germplasm and varieties can be achieved.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0008] First, this application provides a set of core SNP molecular markers for rhododendrons developed based on KASP technology. The set of core SNP molecular markers for rhododendrons includes 31 SNP markers, which are numbered SNP1 to 31 (SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31).
[0009] The SNP1 is marked with the base C / A and is located on chromosome 1 of Rhododendron subgenus Rhododendron, at position 43229715 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0010] The SNP2 is labeled with the base G / T and is located on chromosome 1 of Rhododendron subgenus Rhododendron, at position 46014657 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0011] The SNP3 is labeled with the base C / A and is located on chromosome 2 of Rhododendron subgenus Rhododendron, at position 12166301 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0012] The SNP4 is labeled with the base A / T and is located on chromosome 2 of Rhododendron subgenus Rhododendron, at position 33907816 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0013] The SNP5 is labeled with the base G / A and is located on chromosome 2 of Rhododendron subgenus Rhododendron, at position 34113381 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0014] The SNP6 is labeled with base A / G and is located on chromosome 2 of Rhododendron subgenus Rhododendron, at position 39213730 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0015] The SNP7 is labeled with the base C / A and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 11204455 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0016] The SNP8 is labeled with the base C / T and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 12590717 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0017] The SNP9 is labeled with the base C / T and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 14864773 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0018] The SNP10 is labeled with the base T / A and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 15859937 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0019] The SNP11 is labeled with the base C / T and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 20040775 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0020] The SNP12 is marked with the base T / C and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 20624365 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0021] The SNP13 is labeled with base A / G and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 20637059 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0022] The SNP14 is labeled with base A / G and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 23321340 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0023] The SNP15 is labeled with the base C / T and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 23398629 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0024] The SNP16 is marked with the base T / C and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 23933405 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0025] The SNP17 is labeled with the base G / T and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 36725782 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0026] The SNP18 is labeled with the base C / T and is located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 61370 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0027] The SNP19 is labeled with the base C / G and is located on chromosome 4 of Rhododendron subgenus Rhododendron, at position 34996743 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0028] The SNP20 is marked with the base T / G and is located on chromosome 5 of Rhododendron subgenus Rhododendron, at position 22571961 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0029] The SNP21 is marked with the base T / C and is located on chromosome 5 of Rhododendron subgenus Rhododendron, at position 27906010 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0030] The SNP22 is labeled with the base G / T and is located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 10648788 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0031] The SNP23 is labeled with the base T / A and is located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 16412984 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0032] The SNP24 is marked with the base T / C and is located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 18007550 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0033] The SNP25 is labeled with the base G / A and is located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 28274862 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0034] The SNP26 is labeled with the base G / A and is located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 5119595 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0035] The SNP27 is labeled with base A / G and is located on chromosome 9 of Rhododendron subgenus Rhododendron, at position 12789904 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0036] The SNP28 is labeled with the base G / T and is located on chromosome 9 of Rhododendron subgenus Rhododendron, at position 15197698 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0037] The SNP29 is labeled with the base G / C and is located on chromosome 9 of Rhododendron subgenus Rhododendron, at position 18195438 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0038] The SNP30 is labeled with the base G / A and is located on chromosome 11 of Rhododendron subgenus Rhododendron, at position 26381988 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0039] The SNP31 is labeled with the base T / A and is located on chromosome 12 of Rhododendron simsii, at position 12868899 of the whole genome sequence of Rhododendron simsii.
[0040] The physical locations of the above SNPs were determined based on the whole genome sequence of Rhododendron simsii (https: / / www.ncbi.nlm.nih.gov / genome / ?term=txid118357[orgn]).
[0041] These 31 SNP markers are used as an example to screen and identify 527 varieties using 200 markers. The final selection can effectively distinguish rhododendron varieties.
[0042] Secondly, this application also provides a set of KASP primers for amplifying the above-mentioned core SNP molecular marker set of Rhododendron. The primer set contains 31 KASP primer sets, each KASP primer set is used to detect the corresponding SNP marker. Each KASP primer set consists of two forward allele primers F1 and F2 with different terminal bases and one reverse primer R. The 5' end of these forward primers F1 is added with a FAM fluorescent tag with a nucleotide sequence as shown in SEQ ID NO.94; the 5' end of the forward primer F2 is added with a HEX fluorescent tag with a nucleotide sequence as shown in SEQ ID NO.95.
[0043] Specifically, the KASP primer set used to detect the corresponding SNP markers is as follows: the KASP primer set for detecting SNP1 is shown in the nucleotide sequences of SEQ ID NO. 1-3; the KASP primer set for detecting SNP2 is shown in the nucleotide sequences of SEQ ID NO. 4-6; the KASP primer set for detecting SNP3 is shown in the nucleotide sequences of SEQ ID NO. 7-9; the KASP primer set for detecting SNP4 is shown in the nucleotide sequences of SEQ ID NO. 10-12; the KASP primer set for detecting SNP5 is shown in the nucleotide sequences of SEQ ID NO. 13-15; the KASP primer set for detecting SNP6 is shown in the nucleotide sequences of SEQ ID NO. 16-18; the KASP primer set for detecting SNP7 is shown in the nucleotide sequences of SEQ ID NO. 19-21; the KASP primer set for detecting SNP8 is shown in the nucleotide sequences of SEQ ID NO. 22-24; and the KASP primer set for detecting SNP9 is shown in the SEQ ID NO. 10-12. The nucleotide sequences of SEQ ID NO. 25–27 are shown. The KASP primer sets for detecting SNP10 are shown in the nucleotide sequences of SEQ ID NO. 28–30, SNP11 are shown in the nucleotide sequences of SEQ ID NO. 31–33, SNP12 are shown in the nucleotide sequences of SEQ ID NO. 34–36, SNP13 are shown in the nucleotide sequences of SEQ ID NO. 37–39, SNP14 are shown in the nucleotide sequences of SEQ ID NO. 40–42, SNP15 are shown in the nucleotide sequences of SEQ ID NO. 43–45, SNP16 are shown in the nucleotide sequences of SEQ ID NO. 46–48, SNP17 are shown in the nucleotide sequences of SEQ ID NO. 49–51, and SNP18 are shown in the nucleotide sequences of SEQ ID NO. 28–30. The nucleotide sequences of SEQ ID NO. 52–54 are shown. The KASP primer set for detecting the SNP19 marker is shown in the nucleotide sequences of SEQ ID NO. 55–57. The KASP primer set for detecting the SNP20 marker is shown in the nucleotide sequences of SEQ ID NO. 58–60. The KASP primer set for detecting the SNP21 marker is shown in the nucleotide sequences of SEQ ID NO. 61–63. The KASP primer set for detecting the SNP22 marker is shown in SEQ ID NO.The nucleotide sequences of SNP23 are shown in SEQ ID NO. 64–66. The KASP primer sets for detecting SNP23 are shown in SEQ ID NO. 77–69; the KASP primer sets for detecting SNP24 are shown in SEQ ID NO. 70–72; the KASP primer sets for detecting SNP25 are shown in SEQ ID NO. 73–75; the KASP primer sets for detecting SNP26 are shown in SEQ ID NO. 76–78; the KASP primer sets for detecting SNP27 are shown in SEQ ID NO. 79–81; the KASP primer sets for detecting SNP28 are shown in SEQ ID NO. 82–84; the KASP primer sets for detecting SNP29 are shown in SEQ ID NO. 85–87; the KASP primer sets for detecting SNP30 are shown in SEQ ID NO. 88–90; and the KASP primer sets for detecting SNP31 are shown in SEQ ID NO. 64–69. The nucleotide sequences of numbers 91 to 93 are shown below.
[0044] Third, this application also provides a kit and a chip containing the above-mentioned KASP primer set.
[0045] Fourth, this application also provides the application of the above-mentioned rhododendron core SNP molecular marker set, the above-mentioned KASP primer set, or the above-mentioned detection product in any of the following aspects:
[0046] (1) Identification of azalea germplasm resources or varieties;
[0047] (2) Purity testing of rhododendron germplasm resources or varieties;
[0048] (3) Analysis of genetic diversity in azaleas;
[0049] (4) Construction of the Rhododendron SNP fingerprint database;
[0050] (5) Construction of genetic map and genotyping of azalea;
[0051] (6) Molecular marker-assisted breeding of rhododendrons.
[0052] Preferably, the specific method for the above application includes the following steps:
[0053] S1. Extract genomic DNA from rhododendron leaf samples; the specific steps are as follows:
[0054] S.1.1 Take 0.2g of fresh rhododendron leaves, cut them into small pieces and put them into a 2mL centrifuge tube. Add a clean steel ball, freeze in liquid nitrogen, and shake at 1100rpm for 40s to obtain powder. Add 600μL of modified 2% CTAB extraction buffer (2% PVP and 1% mercaptoethanol were added to the 2% CTAB extraction buffer by mass percentage) to each corresponding tube, shake well to mix thoroughly, and then place in a 65℃ water bath for 30min, shaking once every 10min. Then let stand and cool naturally to room temperature.
[0055] S.1.2 Centrifuge at 12000 rpm for 10 min at 4℃, and transfer the supernatant to a new 2 mL centrifuge tube;
[0056] S.1.3 Add an equal volume of chloroform / isoamyl alcohol mixture (obtained by mixing chloroform and isoamyl alcohol at a volume ratio of 24:1) to the supernatant obtained in step S.1.2, invert to mix, let stand for 3-5 minutes, centrifuge at 12000 rpm for 10 minutes at 4℃, and transfer the supernatant to a new 1.5 mL centrifuge tube.
[0057] S.1.4 Repeat step S.1.3 once;
[0058] S.1.5 Add an equal volume of isopropanol (pre-cooled at -20°C) to the supernatant obtained in step S.1.4, mix slowly, invert slowly 20 times, and incubate at -20°C for 30 min.
[0059] S.1.6 Centrifuge at 12000 rpm for 10 min at 4℃, take the precipitate and wash it twice with 800 μL of 75% (w / w) and 95% (w / w) alcohol respectively, discard the supernatant, and air dry the precipitate in a fume hood at room temperature; then add an appropriate amount of sterile water to dissolve it to obtain the genomic DNA of the rhododendron sample; store at 4℃ for later use;
[0060] S2. Using the rhododendron sample genomic DNA from step S1 as a template, PCR amplification was performed using the KASP primer sets corresponding to the SNP markers mentioned above. The PCR amplification products were then placed on a Bio-RadCFX Connect™ real-time fluorescence quantitative PCR instrument to obtain the corresponding product fluorescence signal values and complete the genotyping.
[0061] S3. The experimental results of step S2 were analyzed using the data analysis software Bio-Rad CFXManager 3.1 to obtain the genotyping information of the azalea samples.
[0062] Furthermore, the PCR amplification reaction system was 6 μL, including 2.75 μL of template DNA at 3 ng / μL, 0.25 μL of KASP primer set corresponding to the SNP marker (0.05 μL each of forward F1 primer (10 μM) and forward F2 primer (10 μM), and 0.15 μL of reverse R primer (10 μM), and 3 μL of 2×KASPMastermix.
[0063] Furthermore, the PCR amplification reaction conditions were as follows: 95℃ for 10 min; 95℃ for 20 sec, 61℃~55℃ for 1 min, with a decrease of 0.6℃ per cycle, for a total of 10 cycles; 95℃ for 20 sec, 55℃ for 1 min, for a total of 35 cycles; the fluorescence signal reading conditions were 25℃ for 30 sec.
[0064] Compared with the prior art, the beneficial effects of the present invention are as follows: The rhododendron SNP core molecular marker set / primer set developed and screened based on KASP technology can quickly, accurately and effectively identify and evaluate rhododendron resources or varieties, and detect their purity. It can solve the problems of resource redundancy, inconvenient preservation and management, and intellectual property disputes caused by the accumulation of a large amount of germplasm. At the same time, it can be used for the construction of rhododendron SNP fingerprint library, rhododendron genetic diversity analysis, and rhododendron molecular marker-assisted breeding. Attached Figure Description
[0065] Figure 1 Genotyping diagram for KASP detection of 250 rhododendron germplasm resources using the primer set corresponding to the SNP site 3.
[0066] Figure 2 Genotyping diagram for KASP detection of 292 rhododendron germplasm resources using the primer set corresponding to the SNP site 4.
[0067] Figure 3 Genetic distance clustering diagram of 45 rhododendron germplasm resources based on KASP markers.
[0068] Figure 4 SNP fingerprint of the rhododendron cultivar 'Da Yuanyangjin' constructed using 31 KASP markers. Detailed Implementation
[0069] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0070] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.
[0071] Example 1: Development of core SNP molecular markers for rhododendrons based on KASP technology
[0072] 1. KASP primer design
[0073] Forty-five important rhododendron germplasm accessions with significant differences in geographical origin and phenotypic characteristics were collected, and genomic DNA was extracted from their leaves. The names of the 45 rhododendron germplasm accessions distributed worldwide are shown in Table 1.
[0074] Table 145 Details of Rhododendron Germplasm Resources
[0075]
[0076]
[0077]
[0078] Genomic DNA from 45 rhododendron germplasms was resequencing using the Illumina NovaSeq 6000 sequencing platform. The resequencing results were compared with the rhododendron genome (https: / / www.ncbi.nlm.nih.gov / genome / ?term=txid118357[orgn]). 200 SNP sites with good polymorphism, uniform distribution on chromosomes, and no other variations within 50 bp before and after the site were selected. Primers were then designed to convert these 200 SNP sites into KASP markers.
[0079] The primer design method is as follows: based on the SNP site and flanking sequence, KASP marker primers were designed for the differential sites using the primer design method introduced by Awais et al. (Awais R, Wen WE, Gao FM, Zhai SN, Jin H, Liu JD, Guo Q, Zhang Y J, Dreisigacker S, Xia XC, He ZH. Development and validation of KASP assays for genes underpinning key economic traits in breadwheat. Theoretical and Applied Genetics, 2016, 129(10): 1843-1860), and KASP molecular markers were developed. Each marker was designed with two forward SNP-specific primers (F1 / F2) and one universal reverse primer (R). The F1 primer had a tail containing the specific sequence 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO. 94) that binds to FAM fluorescence, and the F2 primer had a tail containing the specific sequence 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO. 95) that binds to HEX fluorescence. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0080] 2. KASP primer screening
[0081] (1) 527 rhododendron germplasm resources were collected to form a natural rhododendron population. For details, please refer to Table 2. All rhododendron varieties in Table 2 are reported varieties or commercial products, provided by the National Rhododendron Germplasm Resource Bank of Jiangsu Academy of Agricultural Sciences.
[0082] Table 2527 details of rhododendron germplasm resources
[0083]
[0084]
[0085]
[0086]
[0087] (2) Extraction of rhododendron DNA:
[0088] ① Take about 0.2g of fresh tender leaves of azalea, cut them into small pieces and put them into a 2mL centrifuge tube. Add a clean steel ball, freeze in liquid nitrogen, and then place the tube on a 2000 GENO / GRINDER sampler to make powder (vibrate at 1100rpm for 40s). Open the cap of the centrifuge tube and quickly add 600μL of modified 2% CTAB extraction buffer (add 2% PVP and 1% mercaptoethanol to the 2% CTAB extraction solution). Shake well and mix thoroughly. Then place the tube in a 65℃ water bath for 30min, shaking once every 10min.
[0089] ② After standing to room temperature, centrifuge at 12000 rpm for 10 min at 4℃, and transfer the supernatant to a new 2 mL centrifuge tube;
[0090] ③ Add an equal volume of chloroform / isoamyl alcohol mixture (chloroform and isoamyl alcohol are mixed at a volume ratio of 24:1), invert to mix, let stand for 3-5 minutes, centrifuge at 12000 rpm for 10 minutes at 4℃, and transfer the supernatant to a new 1.5 mL centrifuge tube.
[0091] ④ Repeat step ③ once;
[0092] ⑤ Add an equal volume of isopropanol pre-cooled at -20℃, mix slowly, invert slowly 20 times, and incubate at -20℃ for 30 min;
[0093] ⑥ Centrifuge at 12000 rpm for 10 min at 4℃. After observing the white precipitate at the bottom, discard the supernatant. Wash the precipitate twice with 800 μL of 75% and 95% alcohol respectively. Discard the supernatant and air dry in a fume hood at room temperature.
[0094] Dissolve the DNA of the rhododendron germplasm resource by adding an appropriate amount of sterile water. Store at 4℃ for later use, and store at -20℃ for long-term storage.
[0095] (3) KASP primer screening
[0096] Using 45 rhododendron germplasm accessions from Table 1 as experimental materials, 200 sets of KASP primers were screened. The specific steps were as follows: using genomic DNA from the 45 rhododendron accessions as templates, KASP primers and a universal FASA™ PCR Master Mix (2×) (purchased from Aibotek Biotechnology Co., Ltd.) were added for PCR (polymer chain reaction) amplification. The PCR reaction system consisted of 6 μL of 2.75 μL of DNA (3 ng / μL), 0.25 μL of the molecular marker primers (0.05 μL each of F1 (10 μM) and F2 (10 μM), 0.15 μL of R (10 μM), and 2 μL of 2× KASP Master mix.
[0097] The reaction conditions were: 95℃ for 10 min; 95℃ for 20 sec, 61℃~55℃ for 1 min, with a decrease of 0.6℃ per cycle, for a total of 10 cycles; and 95℃ for 20 sec, 55℃ for 1 min, for a total of 35 cycles.
[0098] The KASP primer set corresponds to 200 SNP sites. The 5' end of each F1 primer is added with a FAM fluorescent tag sequence, and the 5' end of each F2 primer is added with a HEX fluorescent tag sequence.
[0099] After the reaction is complete, the PCR amplification products are placed on a Bio-Rad CFX Connect™ real-time quantitative PCR instrument to obtain the corresponding fluorescence signal values, thus completing the genotyping. The fluorescence signal values are read at 25°C for 30 seconds.
[0100] Using the successfully genotyped KASP markers, genotyping was performed on 527 rhododendron germplasm resources, ultimately yielding 31 high-quality KASP markers with clear genotypes. These 31 KASP markers are distributed across the nine chromosomes of rhododendrons, forming the core SNP molecular marker set for rhododendrons. The 31 core SNP loci are:
[0101] SNP1 marker: C / A base, located on chromosome 1 of Rhododendron subgenus Rhododendron, at position 43229715 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0102] SNP2 marker: G / T base, located on chromosome 1 of Rhododendron subgenus Rhododendron, at position 46014657 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0103] SNP3 marker: C / A base, located on chromosome 2 of Rhododendron subgenus Rhododendron, at position 12166301 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0104] SNP4 marker: base A / T, located on chromosome 2 of Rhododendron subgenus Rhododendron, at position 33907816 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0105] SNP5 marker: G / A base, located on chromosome 2 of Rhododendron subgenus Rhododendron, at position 34113381 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0106] SNP6 marker: Base A / G, located on chromosome 2 of Rhododendron subgenus Rhododendron, at position 39213730 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0107] SNP7 marker: C / A, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 11204455 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0108] SNP8 marker: C / T base, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 12590717 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0109] SNP9 marker: C / T base, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 14864773 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0110] SNP10 marker: T / A base, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 15859937 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0111] SNP11 marker: C / T base, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 20040775 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0112] SNP12 marker: T / C base, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 20624365 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0113] SNP13 marker: Base A / G, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 20637059 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0114] SNP14 marker: Base A / G, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 23321340 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0115] SNP15 marker: C / T base, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 23398629 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0116] SNP16 marker: T / C base, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 23933405 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0117] SNP17 marker: G / T base, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 36725782 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0118] SNP18 marker: C / T base, located on chromosome 3 of Rhododendron subgenus Rhododendron, at position 61370 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0119] SNP19 marker: C / G base, located on chromosome 4 of Rhododendron subgenus Rhododendron, at position 34996743 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0120] SNP20 marker: T / G base, located on chromosome 5 of Rhododendron subgenus Rhododendron, at position 22571961 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0121] SNP21 marker: T / C base, located on chromosome 5 of Rhododendron subgenus Rhododendron, at position 27906010 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0122] SNP22 marker: G / T base, located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 10648788 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0123] SNP23 marker: T / A base, located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 16412984 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0124] SNP24 marker: T / C base, located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 18007550 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0125] SNP25 marker: base G / A, located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 28274862 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0126] SNP26 marker: G / A base, located on chromosome 8 of Rhododendron subgenus Rhododendron, at position 5119595 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0127] SNP27 marker: Base A / G, located on chromosome 9 of Rhododendron subgenus Rhododendron, at position 12789904 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0128] SNP28 marker: G / T base, located on chromosome 9 of Rhododendron subgenus Rhododendron, at position 15197698 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0129] SNP29 marker: G / C base, located on chromosome 9 of Rhododendron subgenus Rhododendron, at position 18195438 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0130] SNP30 marker: G / A base, located on chromosome 11 of Rhododendron subgenus Rhododendron, at position 26381988 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0131] SNP31 marker: T / A base, located on chromosome 12 of Rhododendron subgenus Rhododendron, at position 12868899 of the whole genome sequence of Rhododendron subgenus Rhododendron.
[0132] The names of the primer sets and the nucleotide sequences for detecting these 31 core SNP sites are shown in Table 3.
[0133] Allele frequencies and polymorphism information content (PIC) of each marker were calculated using POWERMARKER V3.25 software. The PIC of 31 KASP markers in 527 Rhododendron germplasm resources ranged from 0.0735 to 0.3750, with an average of 0.3368. Loci with PIC values greater than 0.3368 accounted for 77.4% of all loci. The minor allele frequency (MAF) ranged from 0.4927 to 0.0398, with an average of 0.3662. Polymorphism maps of some markers are shown below. Figure 1 and Figure 2 As shown.
[0134] Figure 1 and Figure 2 Primers corresponding to SNP sites 3 and 4 were used to perform KASP genotyping on 250 and 292 rhododendron germplasm resources from the 527 germplasm resources listed in Table 2, respectively. Based on the analysis of the scanned data, the specific genotypes were determined as follows: Samples clustered near the X-axis (showing red) have alleles linked to the FAM fluorescent tag sequence; samples clustered near the Y-axis (showing blue) have alleles linked to the HEX fluorescent tag sequence; samples in the middle (showing green) have heterozygous alleles; samples showing black squares may not have been clearly genotyped due to poor DNA quality, low concentration, or being a negative control. ×-marked samples are undetermined due to unclear clustering.
[0135] Table 3 Primer information for rhododendron core SNP molecular markers developed based on KASP technology
[0136]
[0137]
[0138]
[0139]
[0140] Example 2: Application of Rhododendron KASP Molecular Markers in Rhododendron Genetic Diversity Analysis
[0141] Genotyping was performed on 45 Rhododendron germplasm resources listed in Table 1 using 31 KASP markers. The genotyping data were then used to construct an AB matrix, and Nei's genetic distances among the various germplasm resources were calculated using GenAIEx V6.51b2 software. The results showed that the Nei's genetic distances of the 45 germplasm resources ranged from 0.0382 to 0.2500, with an average of 0.2189. Furthermore, a phylogenetic tree was constructed based on the distance matrix, and Neighbor-Joining clustering analysis was performed, generating the results shown below. Figure 3 As shown, the 45 rhododendron germplasm resources can be divided into three major groups: one group includes varieties from 'Chuguanxue' to 'Dabei', one group has only one variety, 'Wucaixiajuan', and one group includes varieties from 'Qiuxia' to 'Qilin'.
[0142] Example 3 uses the rhododendron core SNP marker set to detect whether the rhododendron variety to be tested is 'Da Yuanyangjin'.
[0143] Based on a set of 31 core SNP markers for rhododendrons, the SNP fingerprint of the rhododendron variety 'Da Yuanyangjin' was constructed. Since the SNP markers are diallelic, the fingerprint composed of 31 SNP markers will have 62 base pairs. The core SNP fingerprint of the rhododendron variety 'Da Yuanyangjin' is: ACGTAAATCTAGAGGTAGAGATGGAGAGCTAGCTGTGGTTCCAGGTAAAAGGAGGTCGCTAT (SEQ ID NO.96).
[0144] Using an online barcode generator (http: / / barcode.tec-it.com / barcode-generator.aspx), the SNP fingerprint was converted into a QR code to obtain the SNP fingerprint QR code for the azalea variety 'Da Yuanyangjin', as shown below. Figure 4 As shown.
[0145] Randomly selected rhododendron varieties were used for DNA preparation according to the steps in Example 2. Simultaneously, genotyping was performed using KASP primer sets corresponding to 31 core SNP markers to obtain SNP fingerprint profiles. The SNP genotyping steps using the PCR platform were the same as described in Example 2.
[0146] Results Analysis: The SNP fingerprint profile of the tested rhododendron variety was compared with that of the authentic rhododendron variety 'Da Yuanyangjin'. If the two are completely identical, the tested rhododendron variety is 'Da Yuanyangjin'; otherwise, it is not.
[0147] The preferred embodiments of the present invention disclosed above are merely illustrative of the invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the invention to specific implementations. Clearly, many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention. For those skilled in the art, various changes, modifications, substitutions, and variations made to these embodiments without departing from the principles and spirit of the invention still fall within the protection scope of the present invention.
Claims
1. A primer set for detecting a set of rhododendron core SNP molecular markers, characterized in that, The primer set is composed of 31 KASP primer groups, numbered KASP primer group 1 to KASP primer group 31 in turn, each KASP primer group is used for detecting a corresponding SNP marker, and each KASP primer group is composed of two allele forward primers F1 and F2 with different terminal bases and one reverse primer R; The KASP primer set 1 is shown as the nucleotide sequence of SEQ ID NO. 1-3, the KASP primer set 2 is shown as the nucleotide sequence of SEQ ID NO. 4-6, the KASP primer set 3 is shown as the nucleotide sequence of SEQ ID NO. 7-9, the KASP primer set 4 is shown as the nucleotide sequence of SEQ ID NO. 10-12, the KASP primer set 5 is shown as the nucleotide sequence of SEQ ID NO. 13-15, the KASP primer set 6 is shown as the nucleotide sequence of SEQ ID NO. 16-18, the KASP primer set 7 is shown as the nucleotide sequence of SEQ ID NO. 19-21, the KASP primer set 8 is shown as the nucleotide sequence of SEQ ID NO. 22-24, the KASP primer set 9 is shown as the nucleotide sequence of SEQ ID NO. 25-27, the KASP primer set 10 is shown as the nucleotide sequence of SEQ ID NO. 28-30, the KASP primer set 11 is shown as the nucleotide sequence of SEQ ID NO. 31-33, the KASP primer set 12 is shown as the nucleotide sequence of SEQ ID NO. 34-36, the KASP primer set 13 is shown as the nucleotide sequence of SEQ ID NO. 37-39, the KASP primer set 14 is shown as the nucleotide sequence of SEQ ID NO. 40-42, the KASP primer set 15 is shown as the nucleotide sequence of SEQ ID NO. 43-45, the KASP primer set 16 is shown as the nucleotide sequence of SEQ ID NO. 46-48, the KASP primer set 17 is shown as the nucleotide sequence of SEQ ID NO. 49-51, the KASP primer set 18 is shown as the nucleotide sequence of SEQ ID NO. 52-54, the KASP primer set 19 is shown as the nucleotide sequence of SEQ ID NO. 55-57, the KASP primer set 20 is shown as the nucleotide sequence of SEQ ID NO. 58-60, the KASP primer set 21 is shown as the nucleotide sequence of SEQ ID NO. 61-63, the KASP primer set 22 is shown as the nucleotide sequence of SEQ ID NO. 64-66, the KASP primer set 23 is shown as the nucleotide sequence of SEQ ID NO. 67-69, the KASP primer set 24 is shown as the nucleotide sequence of SEQ ID NO. 70-72, the KASP primer set 25 is shown as the nucleotide sequence of SEQ ID NO. 73-75, the KASP primer set 26 is shown as the nucleotide sequence of SEQ ID NO. 76-78, the KASP primer set 27 is shown as the nucleotide sequence of SEQ ID NO. 79-81, the KASP primer set 28 is shown as the nucleotide sequence of SEQ ID NO. 82-84, the KASP primer set 29 is shown as the nucleotide sequence of SEQ ID NO. 85-87, the KASP primer set 30 is shown as the nucleotide sequence of SEQ ID NO.KASP primer set 31 as set forth in the nucleotide sequence of SEQ ID NO. 91-93.
2. The set of primers according to claim 1, characterized in that, The 5' end of the forward primer F1 is added with a FAM fluorescent tag; and the 5' end of the forward primer F2 is added with a HEX fluorescent tag.
3. A chip or a detection kit containing the primer set of claim 1 or 2.
4. Application of the primer set of claim 1 or 2 in any of the following: (1) identification of Rhododendron germplasm resources or varieties; (2) purity detection of Rhododendron germplasm resources or varieties; (3) genetic diversity analysis of Rhododendron; (4) construction of Rhododendron SNP fingerprint library; (5) genetic map construction and genotyping of Rhododendron; (6) molecular marker assisted breeding of Rhododendron.
5. Application of the chip or the detection kit of claim 3 in any of the following: (1) identification of Rhododendron germplasm resources or varieties; (2) purity detection of Rhododendron germplasm resources or varieties; (3) genetic diversity analysis of Rhododendron; (4) construction of Rhododendron SNP fingerprint library; (5) genetic map construction and genotyping of Rhododendron; (6) molecular marker assisted breeding of Rhododendron.
6. Use according to claim 4, characterized in that, The specific steps are as follows: S1, extracting genomic DNA of Rhododendron sample; S2, using the KASP primer set of claim 1 or 2 to perform PCR amplification with the genomic DNA in step S1 as a template, and obtaining a fluorescence signal value of the PCR amplification product, to complete genotyping; S3, analyzing the experimental results of step S2.
7. Use according to claim 6, characterized in that, The reaction system of the PCR amplification is 6 μL, including 3 ng / μL of DNA template 2.75 μL, corresponding KASP primer group 0.25 μL, 2×KASP Master mix 3 μL; the corresponding KASP primer group includes corresponding forward primer F1 0.05 μL, corresponding forward primer F2 0.05 μL, and corresponding reverse primer R 0.15 μL; the concentrations of the forward primer F1, the forward primer F2 and the reverse primer R are all 10 μM; The reaction conditions of the PCR amplification are: 95℃, 10min; 95℃, 20sec, 61℃-55℃, 1min, 10 cycles of decreasing 0.6℃ each time; 95℃, 20sec, 55℃, 1min, 35 cycles; and the reading conditions of the fluorescence signal value are 25℃, 30sec.
Citation Information
Patent Citations
Bottle gourd core molecular marker set developed on basis of KASP technology and application thereof
CN110923357A
Molecular marker primer combination for rapidly identifying fruit type and size of blueberry and application of molecular marker primer combination
CN115181814A