Primer-probe set for specifically detecting Fusarium graminearum and its application
By designing specific primer probe sets and optimizing PCR amplification program, the problem of insufficient detection sensitivity of Fusarium grazing in soil was solved, and high-sensitivity detection of Fusarium grazing in soil was achieved, which improved the prediction and prevention and control capabilities of wheat gibberellia.
Patent Information
- Application Number
- CN202410817340.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-24
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2044-06-24
AI Technical Summary
The prior art has insufficient sensitivity to detecting Fusarium grazing in soil, making it difficult to accurately detect trace nucleic acids, which affects the prediction and prevention of wheat gibberellia.
Design a specific primer probe set, including multiple probes to label fluorescence and quench groups, build a highly sensitive TaqMan real-time fluorescence quantitative PCR system, optimize the PCR amplification program, and improve the sensitivity of detecting Fusarium grazing in soil.
High sensitivity detection of Fusarium gracia is achieved, and the detection concentration can reach 102 copies/g soil, which significantly improves the accuracy and sensitivity of the detection.
Smart Images

Figure CN118703670B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of detection of Fusarium graminearum, and particularly relates to a primer-probe set for specifically detecting Fusarium graminearum and its application. Background Art
[0002] Fusarium head blight of wheat is caused by Fusarium graminearum, which can occur from the seedling stage to the ear stage, showing seedling blight, basal rot of stem, stalk rot and ear rot, and the ear rot is the most harmful. After infecting wheat, the disease not only causes serious yield losses, but also produces a large amount of toxins in the wheat grains. Consumption of the residual toxins can cause harm to the human body. This disease is one of the most serious diseases in wheat production.
[0003] Fusarium graminearum overwinters in crop residues in the soil in different forms. When the conditions are suitable, Fusarium graminearum releases ascospores and spreads through air currents, wind and rain, thereby infecting spikelets. After a few days, a large amount of pink mold layer is produced and causes reinfection through wind and rain. Therefore, the detection of the pathogen content of Fusarium graminearum in the soil is crucial for disease prediction.
[0004] At present, there are many detection methods for Fusarium graminearum, such as plate detection method, bioassay method, conventional PCR detection and quantitative PCR (qPCR) detection technology, etc. Among them, the qPCR technology has become the most important detection technology for pathogen detection due to its characteristics of rapid detection, high sensitivity, strong specificity and absolute quantification. Researchers at home and abroad have also reported a variety of qPCR methods to detect the content of Fusarium graminearum in inoculum in soil or residues. However, detection sensitivity is very important for the accurate detection of Fusarium graminearum in soil. There are many factors affecting the detection sensitivity of TaqMan fluorescence quantitative PCR, including the type of enzyme, primer sequence, probe sequence, component ratio, PCR amplification parameters, etc. How to improve the sensitivity of trace nucleic acid detection methods has always been the direction of efforts of scientific researchers. Summary of the Invention
[0005] The purpose of the present invention is to provide a primer-probe set for specifically detecting Fusarium graminearum.
[0006] Another purpose of the present invention is to provide the application of the above primer-probe set.
[0007] Another purpose of the present invention is to provide a kit for detecting Fusarium graminearum.
[0008] Another purpose of the present invention is to provide a detection method for Fusarium graminearum.
[0009] The primer-probe set for specifically detecting Fusarium graminearum according to the specific embodiment of the present invention includes the following primers:
[0010] SEQ ID NO.1: ATAGACCTGTCCCCGCCT;
[0011] SEQ ID NO.2: CGCTGCATAAAGGTAGAGGTCAT;
[0012] It further includes at least one of the following probes:
[0013] SEQ ID NO.3: ACCAACCGCCGACCGCATTC;
[0014] SEQ ID NO.4: AGCCCGAATACGAAC;
[0015] SEQ ID NO.5: TGCAACTGCATGATAAC。
[0016] The primer-probe set for specifically detecting Fusarium graminearum according to the specific embodiments of the present invention, wherein the 5'-end of the probe is labeled with a fluorescent group and the 3'-end is labeled with a quenching group.
[0017] Preferably, the 5'-end of the probe is labeled with a fluorescent group and the 3'-end is labeled with a quenching group. Among them, the fluorescent group can be selected from FAM, HEX, JOE, TET, CY3, CY5, ROX, Texas, etc. The preferred option in the present invention is FAM; the quenching group can be selected from TAMRA, BHQ (BHQ1, BHQ2, BHQ3), MGB, etc. The preferred option in the present invention is MGB.
[0018] The kit for specifically detecting Fusarium graminearum according to the specific embodiments of the present invention includes the following primers:
[0019] SEQ ID NO.1: ATAGACCTGTCCCCGCCT;
[0020] SEQ ID NO.2: CGCTGCATAAAGGTAGAGGTCAT;
[0021] It further includes at least one of the following probes:
[0022] SEQ ID NO.3: ACCAACCGCCGACCGCATTC;
[0023] SEQ ID NO.4: AGCCCGAATACGAAC;
[0024] SEQ ID NO.5: TGCAACTGCATGATAAC。
[0025] Preferably, the kit includes the following primers:
[0026] SEQ ID NO.1: ATAGACCTGTCCCCGCCT;
[0027] SEQ ID NO.2: CGCTGCATAAAGGTAGAGGTCAT;
[0028] It also includes the following probes:
[0029] SEQ ID NO.3: ACCAACCGCCGACCGCATTC;
[0030] SEQ ID NO.4: AGCCCGAATACGAAC;
[0031] SEQ ID NO.5: TGCAACTGCATGATAAC。
[0032] Preferably, the 5'-end of the probe is labeled with a fluorescent group and the 3'-end is labeled with a quenching group. Among them, the fluorescent group can be selected from FAM, HEX, JOE, TET, CY3, CY5, ROX, Texas, etc., and the preferred option in the present invention is FAM; the quenching group can be selected from TAMRA, BHQ (BHQ1, BHQ2, BHQ3), MGB, etc., and the preferred option in the present invention is TAMRA.
[0033] The detection method of Fusarium graminearum according to the specific embodiment of the present invention, which uses the above primer-probe group for the PCR step.
[0034] The detection method of Fusarium graminearum according to the specific embodiment of the present invention, the PCR amplification system includes 10 μL of TaqMan Fast qPCR Master Mix, 0.5 μL of each primer, 0.3 μL of each probe, 1 μL of DNA template, and ddH2O is added to make up to 20 μL.
[0035] The detection method of Fusarium graminearum according to the specific embodiment of the present invention, the PCR amplification program is pre-denaturation at 94°C for 3 min, denaturation at 94°C for 10 s, annealing / extension / data collection at 58°C for 35 S, and 40 cycles of denaturation and annealing.
[0036] The beneficial effects of the present invention:
[0037] The present invention designs specific primer-probes for the specific fragments in the genome of Fusarium graminearum, and the designed primer-probe group has good specificity for filamentous fungi with similar genera. In terms of sensitivity, using the primer-probe group of the present invention for detection, the obtained Ct values are 28.402 - 27.071, showing good detection sensitivity.
[0038] The present invention constructs a highly sensitive TaqMan real-time fluorescence quantitative PCR system to detect the content of Fusarium graminearum in soil, and obtains a standard curve equation of y = -3.322x + 38.17. Among them, the logarithm of the copy number of each gradient plasmid is used as the abscissa, and the cycle threshold Ct value is used as the ordinate to establish the standard curve. By using the method of the present invention to detect the content of Fusarium graminearum in soil, the detection concentration can reach 10 2 copys / g soil. Description of the Drawings
[0039] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0040] Figure 1 Comparison results of the detection sensitivities of single probe, double probe and triple probe;
[0041] Figure 2 Standard curve for detecting Fusarium graminearum by the method of the present invention. Detailed Embodiments
[0042] To make the purpose, technical solutions and advantages of the present invention clearer, the following will describe the technical solutions of the present invention in detail. Obviously, the described embodiments are only some embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope protected by the present invention.
[0043] The strains and reagents used in the present invention are as follows:
[0044] Fusarium graminearum PH-1 strain: obtained from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences;
[0045] DNA Gel Extraction Kit (Bio-Teke);
[0046] Mini Plasmid Kit (OMEGA);
[0047] Fungal Genomic DNA Extraction Kit (BioFlux);
[0048] Quick DNA Product Purification Kit (ComWin Biotech);
[0049] Plant Total RNA Extraction Kit (Huayueyang);
[0050] PCR reagents: Taq enzyme (Thermo), FastPfu enzyme (TransGen Biotech), restriction endonuclease (Fermentas).
[0051] Example 1 Design of detection primers and probes
[0052] By searching the Fusarium graminearum genome, a species-specific fragment SEQ ID No.6 was screened out:
[0053] atgatgttga gctttgaatt accctctgaa cttaaccaca agatgagcct atccttatct
[0054] gtacctcaat atgccaagca gtacatagac ctgtccccgc ctcaaaaatg gttacacaag
[0055] cccgaatacg aacatctatg caactgcatg ataacatatg acctctacct ttatgcagcg
[0056] gctaagttag actctaccat tggctggatc aagtggtatg tagctccgaa gagcaatact
[0057] gataaatgtg atacagaata tcatgtctta ttagagcgga taaaacagat tcagatatca
[0058] actgatatca tagaaagtac atga
[0059] By screening and comparison, the following primer and probe sequences were determined:
[0060] Fg38Taq-QF: 5'ATAGACCTGTCCCCGCCT 3';
[0061] Fg38Taq-QR: 5'CGCTGCATAAAGGTAGAGGTCAT 3';
[0062] Fg38-Probe1: 5'ACCAACCGCCGACCGCATTC 3';
[0063] Fg38-Probe2: 5'AGCCCGAATACGAAC 3';
[0064] Fg38 - Probe3: 5'TGCAACTGCATGATAAC 3';
[0065] The 5'-end of the probe is labeled with FAM fluorescent dye, and the 3'-end is labeled with the quenching group MGB.
[0066] Optimize the fluorescence quantitative PCR system and program adapted to the above primers and probes, and determine a 20 μL reaction system:
[0067] TaqMan Fast qPCR Master Mix 10 μL;
[0068] Primer Fg38Taq - QF 0.5 μL;
[0069] Primer Fg38Taq - QR 0.5 μL;
[0070] Probe Fg38 - Probe1 0.3 μL;
[0071] Probe Fg38 - Probe2 0.3 μL;
[0072] Probe Fg38 - Probe3 0.3 μL;
[0073] Template 1 μL;
[0074] Make up to 20 μL with sterilized dd H2O.
[0075] Use Applied Biosystems QuantStudio TM 6Flex amplification program: Pre - denaturation at 94°C for 3 min, denaturation at 94°C for 10 s, annealing / extension / data collection at 58°C for 35 s, 40 cycles of denaturation and annealing.
[0076] For primer specificity detection, filamentous fungi with similar species were selected for primer specificity detection, including: Fusarium graminearum, F. pseudograminearum, Rhizoctonia graminis, F. moniliforme, F. subglutinans, Curvularia lunata, Bipolaris maydis, B. sorokiniana, F. sinensis, F. equiseti, F. negundis, F. acuminatum, F. tricinctum, F. culmorum, F. proliferum, F. flocciferum, F. oxysporum, F. solani. DNA of each strain was extracted, and Fg38Taq-QF / Fg38Taq-QR was used as primers.
[0077] DNA of all strains was extracted and detected according to the system and procedure determined above. The results are shown in Table 1:
[0078] Table 1 Results of primer and probe specificity detection
[0079]
[0080] Note: NA indicates no amplification signal.
[0081] As shown in Table 1, the primers and probes of the present invention only have amplification curves for Fusarium graminearum DNA, but no amplification curves for other similar species, indicating that the primers and probes of the present invention have good specificity for Fusarium graminearum.
[0082] Meanwhile, single-probe combinations and double-probe combinations were obtained by combining primers with single probes and double probes, and primer specificity detection was carried out on the above-mentioned filamentous fungi with similar species. The single probes were Fg38-Probe1, Fg38-Probe2 and Fg38-Probe3 respectively, and the double probes were the groups of Fg38-Probe1 and Fg38-Probe2, Fg38-Probe1 and Fg38-Probe3, Fg38-Probe2 and Fg38-Probe3. After reducing the number of probes in the system, the remaining volume was made up with sterilized dd H2O.
[0083] The results showed that only the single-probe combination and the double-probe combination had amplification curves for the DNA of Fusarium graminearum, but no amplification curves for other related species, indicating that the single-probe combination and the double-probe combination had good specificity for Fusarium graminearum.
[0084] Example 2 examined the detection sensitivity of the primer-probe set of the present invention.
[0085] The sensitivities of the three-probe, two-probe, and one-probe were compared. The three-probe system referred to Example 1. Among them, the one-probe was selected as Fg38-Probe1, the two-probe was selected as Fg38-Probe1 and Fg38-Probe2. After reducing the number of probes in the system, the remaining volume was made up with sterilized dd H2O, and the PCR program was the same as that in Example 1.
[0086] The experimental results were as Figure 1 shown. The Ct values corresponding to different numbers of probes were different. The Ct value of the single-probe was 28.402, the Ct value of the two-probe was 28.100, and the average Ct value of the three-probe was 27.071. The average value of the three-probe was 1.331 smaller than that of the single-probe, and the two-probe was 0.302 smaller than the one-probe. Therefore, compared with the single-probe, the three-probe detection system could shift the detection Ct value forward by 1.331 cycles, and the detection sensitivity was increased by 2.5 times, which could be applied to the detection of Fusarium graminearum.
[0087] Thus, the present invention designed multiple probes for the genes of Fusarium graminearum and compared the effects of different numbers of probes and the combinations between probes on the detection sensitivity, so as to determine the primer-probes that could effectively improve the sensitivity of the TaqMan real-time fluorescence quantitative PCR detection method.
[0088] Example 3 established a standard curve.
[0089] 1. Amplification of the detection fragment
[0090] Extract the DNA of Fusarium graminearum and perform PCR amplification of the target fragment using the specific primers Fg38Taq-QF / Fg38Taq-QR.
[0091] PCR reaction system: 1.0 μL of template, 1 μL of each upstream and downstream primer, 25 μL of PCR Master Mix, and made up to 50 μL with dd H2O.
[0092] Reaction procedure: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 50 s, annealing at 56°C for 35 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 7 min.
[0093] The PCR amplification product was detected by 1% agarose gel electrophoresis and recovered by cutting the gel.
[0094] 2. Recovery of the PCR product
[0095] Cut the gel containing the PCR product with a single target DNA band under long-wave ultraviolet light and place it in a 1.5 mL centrifuge tube. Add 600 μL of Buffer B2 to the gel block, place the centrifuge tube in a 50 °C water bath for 5 - 10 min and mix intermittently until the gel block is completely melted. Transfer all the melted solution into the adsorption column, centrifuge at 8000 rpm for 30 s, pour out the waste liquid in the collection tube, and put the adsorption column into the same collection tube. Pour out the waste liquid in the collection tube and put the adsorption column into the same collection tube. Add 300 μL of Buffer B2 to the adsorption column, centrifuge at 9000 rpm for 30 s, pour out the waste liquid in the collection tube, and put the adsorption column into the same collection tube. Add 500 μL of Wash Solution to the adsorption column, centrifuge at 9000 rpm for 30 s, pour out the waste liquid in the collection tube, and put the adsorption column into the same collection tube. Then add 500 μL of Wash Solution to the adsorption column again, centrifuge at 9000 rpm for 30 s, pour out the waste liquid in the collection tube, and put the adsorption column into the same collection tube. Place the adsorption column and the collection tube in the centrifuge and centrifuge at 9000 rpm for 1 min. Put the adsorption column into a clean centrifuge tube, add 50 μL of filter-sterilized ultrapure water, let it stand at room temperature for 1 - 2 min, and centrifuge at 9000 rpm for 1 min. Store the obtained DNA solution at -20 °C or use it for subsequent experiments.
[0096] 3. Ligation with T-vector
[0097] 1 μL of PMD19-T vector, 2 μL of target fragment, 5 μL of Solution Ⅰ, 2 μL of H2O, ligate at 16 °C for 2 - 4 h or overnight at 4 °C.
[0098] 4. Transformation of competent Escherichia coli
[0099] Mix 50 μL of DH5α competent cells and 10 μL of ligation product, incubate on ice for 30 min, heat shock in a 42 °C water bath for 90 s, incubate on ice for 2 min, add 800 μL of LB liquid medium, culture at 37 °C with 180 rpm for 1 h, centrifuge at 3000 rpm for 1 min, aspirate 600 μL of the supernatant, resuspend the remaining liquid and spread it on a solid LB plate containing ampicillin, incubate inverted at 37 °C overnight. After overnight culture, randomly pick a single colony, inoculate it into a 15 mL centrifuge tube containing LB liquid medium with ampicillin, shake the bacteria at 30 °C with 180 rpm, and perform plasmid extraction.
[0100] 5. Plasmid extraction
[0101] Take 1 - 5 mL of bacterial culture, centrifuge at 12,000 rpm for 1 min, and aspirate the supernatant as much as possible. Add 250 μL of Solution I to the centrifuge tube with the bacterial cell pellet and resuspend, then let it stand for 1 min. Add 250 μL of Solution II to the centrifuge tube with the bacterial cell pellet, gently invert the tube 6 - 8 times to fully lyse the bacteria. Add 350 μL of Solution III to the centrifuge tube, immediately gently invert the tube 6 - 8 times to mix well, and at this time, a white flocculent precipitate will appear. Centrifuge at 12,000 rpm for 10 min, carefully transfer the supernatant to another clean centrifuge tube with a pipette, try not to aspirate the precipitate. Add the supernatant obtained in the previous step to the adsorption column, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the adsorption column into the collection tube. Add 500 μL of wash buffer to the adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the adsorption column into the collection tube. Centrifuge at 12,000 rpm for 2 min, leave the adsorption column open at room temperature for several minutes, place the adsorption column into a clean centrifuge tube, add 50 μL of sterilized water at 65 °C water bath, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min.
[0102] 6. Plotting the standard curve of real - time fluorescence quantitative PCR
[0103] Dilute the extracted plasmid DNA by 10 -1 -, 10 -2 -, 10 -3 -, 10 -4 -, 10 -5 -, 10 -6 -, 10 -7 -, 10 -8 - fold serial dilutions, and use them as templates for real - time fluorescence PCR reactions. Each gradient standard is set with 3 replicates. The reaction system and program of real - time fluorescence quantitative PCR are carried out according to Example 1.
[0104] The conversion formula for plasmid concentration and plasmid copy number is as follows:
[0105] Plasmid copies / μL = (plasmid concentration × 10 -9 ) × (6.02 × 10 23 ) / (plasmid base number * 660);
[0106] Plasmid base number = vector length + conventional target fragment length = 2692 BP (PMD - 19T) + conventional target fragment length.
[0107] The plasmid copy number of a plasmid with a concentration of 201.1 ng / μL is 5.99x10 10 , and after dilution, a series of gradient plasmid standards are obtained respectively (the corresponding copy numbers are 5.99 × 10 9 , 5.99 × 10 8, 5.99×10 7 , 5.99×10 6 , 5.99×10 5 , 5.99×10 4 , 5.99x10 3 , 5.99×10 2 , 5.99×10 1 ).
[0108] Taking the logarithm of the copy number of each gradient plasmid as the abscissa and the cycle threshold Ct value as the ordinate to establish a standard curve. The standard curve equation is y = -3.322x + 38.17, and the correlation coefficient R 2 = 0.9990. Calculate the amplification efficiency according to the slope (a) of the standard curve. The amplification efficiency E = 10 -1 / a -1. The amplification efficiency E = 99.9%, and the detection sensitivity can reach 10 copies / uL DNA, indicating that the established standard curve meets the requirements.
[0109] Example 4 Detection of the content of Fusarium graminearum in soil samples using the multi-probe co-target method of the present invention
[0110] 1. Collect soil samples from different wheat-growing areas in Hebei Province, extract DNA from the soil using a soil DNA extraction kit (Qiagen), detect the content of soil DNA using the real-time quantitative PCR method of Example 1, compare the Ct values of the triple probe and the single probe (single probe primers Fg38Taq-QF / Fg38Taq-QR, probe Fg38-Probe1), and calculate the content of pathogenic bacteria in the soil according to the measurement results of the triple probe. The results are shown in Table 2.
[0111] Table 2 Content of soil pathogenic bacteria in different wheat-growing areas of Hebei Province
[0112]
[0113] As shown in Table 2, among the 12 soil samples, 11 were detected by the triple-probe real-time fluorescence quantitative PCR method, while 8 were detected by the single-probe real-time fluorescence quantitative PCR method. There were 3 samples that could be detected as positive by the triple-probe real-time fluorescence quantitative PCR method, while the single-probe real-time fluorescence quantitative PCR method failed to detect the results. The detection rate of the triple probe was about 25% higher than that of the single probe, indicating that in soil detection, the triple-probe method can significantly improve the detection sensitivity, and the detection concentration can reach 10 2 copys / g soil.
[0114] As described above, it is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention can easily think of changes or substitutions, which should all be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims described above.
Claims
1. A primer-probe set for specifically detecting Fusarium graminearum, characterized in that, It includes the following primers: SEQ ID NO.1: ATAGACCTGTCCCCGCCT; SEQ ID NO.2: CGCTGCATAAAGGTAGAGGTCAT; It also includes the following probes: SEQ ID NO.3: ACCAACCGCCGACCGCATTC; SEQ ID NO.4: AGCCCGAATACGAAC; SEQ ID NO.5: TGCAACTGCATGATAAC.
2. The primer-probe set for specifically detecting Fusarium graminearum according to claim 1, wherein The 5'-end of the said probe is labeled with a fluorophore, and the 3'-end is labeled with a quencher.
3. The primer-probe set for specifically detecting Fusarium graminearum according to claim 2, wherein The fluorophore is one of FAM, HEX, JOE, TET, CY3, CY5, ROX or Texas; the quencher is one of TAMRA, BHQ or MGB.
4. A kit for specifically detecting Fusarium graminearum, characterized in that, It includes the following primers: SEQ ID NO.1: ATAGACCTGTCCCCGCCT; SEQ ID NO.2: CGCTGCATAAAGGTAGAGGTCAT; It also includes the following probes: SEQ ID NO.3: ACCAACCGCCGACCGCATTC; SEQ ID NO.4: AGCCCGAATACGAAC; SEQ ID NO.5: TGCAACTGCATGATAAC.
5. The kit for specifically detecting Fusarium graminearum according to claim 4, wherein The 5'-end of the said probe is labeled with a fluorophore, and the 3'-end is labeled with a quencher.
6. The kit for specifically detecting Fusarium graminearum according to claim 5, characterized in that, The fluorophore is one of FAM, HEX, JOE, TET, CY3, CY5, ROX or Texas; the quencher is one of TAMRA, BHQ or MGB.
7. Detection method for Fusarium graminearum, characterized in that, The said detection method includes the step of performing PCR on the DNA of the analyte using the primer-probe set described in claim 1.
8. The detection method of Fusarium graminearum according to claim 7, characterized in that, The PCR amplification system includes 10 μL of TaqMan Fast qPCR MasterMix, 0.5 μL of each primer, 0.3 μL of each probe, 1 μL of DNA template, and ddH2O is added to make up to 20 μL.
9. The detection method of Fusarium graminearum according to claim 7, characterized in that, The PCR amplification program is pre-denaturation at 94°C for 3 min, denaturation at 94°C for 10 s, annealing / extension / data collection at 58°C for 35 S, and 40 cycles of denaturation and annealing.
Citation Information
Patent Citations
Primer probe composition, kit and detection method for detecting fusarium graminearum
CN112852995A