Role of SEC14L3 in copper death of hepatocellular carcinoma cells
By studying the role of SEC14L3 in liver cancer cells, it was found that it promotes FDX1 expression through the ERK1/2-YY1 signaling axis and induces copper death, thereby inhibiting the occurrence and development of HCC, solving the problem of poor prognosis of HCC treatment and providing new therapeutic strategies and targets.
Patent Information
- Application Number
- CN202410778073.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-17
- Publication Date
- 2025-05-16
- Estimated Expiration
- 2044-06-17
AI Technical Summary
In the prior art, the pathogenesis of HCC is complex, difficult to clarify, the prognosis of treatment is poor, and there is a lack of effective biomarkers and drug targets.
By deeply studying the role of SEC14L3 in liver cancer cells, it was found that SEC14L3 promotes the expression of the key copper death gene FDX1 through the ERK1/2-YY1 signaling axis, thereby inducing the death of cells of copper, thereby inhibiting the occurrence and development of hepatocellular carcinoma.
It has clarified SEC14L3 as an important target of HCC, inhibits the growth of liver cancer cells by promoting the copper death mechanism, provides a new therapeutic strategy, and provides a scientific basis for liver cancer diagnosis, prognosis determination and treatment molecular targets.
Smart Images
Figure CN118717947B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biomedicine and relates to the application of SEC14L3 in copper death of liver cancer cells. Background Art
[0002] Primary liver cancer is the sixth most common and third most deadly cancer in the world. Primary liver cancer includes hepatocellular carcinoma (HCC) (accounting for 75%-85%), intrahepatic cholangiocarcinoma (ICC) (accounting for 10%-15%) and other rare types. Hepatocellular carcinoma is the main pathological type of primary liver cancer. Due to differences in diet, economic and technological levels, the incidence of HCC in different regions also varies greatly, and its 5-year survival rate is only 18%. The main high-risk factors for HCC include chronic viral hepatitis, aflatoxin exposure, heavy drinking and non-alcoholic fatty liver disease (NAFLD). In most high-risk areas, especially developing countries, chronic hepatitis B virus (HBV) infection and aflatoxin exposure are the main causes.
[0003] Copper plays an important role in many biological processes. As a catalytic cofactor of various key metabolic enzymes, it is widely involved in important physiological processes such as energy conversion and intracellular respiration. The concentration of intracellular copper is dynamically regulated according to metabolic needs and environmental changes, and an imbalance in copper metabolism can cause cell damage. Copper death (Cu proptosis) is a new type of cell death induced by copper, which is different from apoptosis, autophagy, ferroptosis and programmed necrosis. Ferredoxin 1 (FDX1) is the most critical regulator of copper death. The mechanism of copper death is to use potent copper ion carriers (such as Elesclomol (ES)) to transport copper ions into cells, which directly interact with lipoylation (Lip) proteins in the tricarboxylic acid cycle (TCA) pathway, such as lipoylated dihydrolipoyl transacetylase (Lip-dihydrolipoamide transacetylase, Lip-DLAT), leading to Lip-DLAT oligomerization and functional loss, and interfering with the function of iron-sulfur cluster proteins in the respiratory chain complex, causing protein toxicity stress response, and ultimately leading to cell death. The most prominent characteristics and signs of copper death are lipoylation of dihydrolipoyl transacetylase (Lip-DLAT) and Cu +Binding to Lip-DLAT causes Lip-DLAT oligomerization and ultimately leads to cell death.
[0004] In the prior art, 10 Cu proptosis-related genes (CRGs) were screened out through whole genome knockout, of which 7 genes could alleviate Cu proptosis after being knocked out. These genes can be divided into three groups, namely, the upstream key regulatory factor ferredoxin 1 (FDX1), lipoic acid pathway-related proteins (lipoyl synthase (LIAS), lipopolytransferase 1 (LIPT1)) and genes encoding pyruvate dehydrogenase complex (dihydrolipoamide dehydrogenase (DLD), DLAT, pyruvate dehydrogenase E1 subunit alpha 1 (PDHA1), pyruvate dehydrogenase E1 subunit beta (PDHB)). In addition, metal-regulatory transcription factor 1 (MTF1), glutaminase (GLS) and cyclin-dependent kinase inhibitor 2A (CDKN2A) have also been shown to be associated with cell sensitivity to copper, and the three are downregulated during copper death.
[0005] A large number of research results have shown that regulating copper in tumor cells is a cancer treatment method with potential application prospects. Therefore, it is of great significance to further study the potential mechanism of copper death regulating the occurrence and development of HCC. However, current research mainly focuses on analyzing the expression and prognostic relationship of CRGs in various cancers through bioinformatics, but its specific regulatory mechanism has not been fully studied. Therefore, it is necessary to further study the biological mechanism of copper death in liver cancer, identify new biomarkers and drug targets, and develop more effective prevention and treatment strategies. Summary of the invention
[0006] The purpose of the present invention is to address the problems of HCC in the prior art, such as complex pathogenesis, difficulty in clarifying, poor treatment prognosis, etc., and to conduct in-depth research on the mechanism of HCC, and to clarify that SEC14L3 is an important target related to copper death of liver cancer cells. SEC14L3 can promote the expression of the key gene FDX1 for copper death through the ERK1 / 2-YY1 signaling axis, which converts Cu in cells into 2+ Reduction to Cu + , while inducing DLAT lipoylation; finally Cu + Binding to Lip-DLAT and causing Lip-DLAT oligomerization ultimately induces copper cell death, thereby inhibiting the occurrence and development of hepatocellular carcinoma, providing a new strategy for liver cancer treatment.
[0007] In order to solve the above technical problems, the present invention is implemented through the following technical solutions.
[0008] The first aspect of the present invention provides the use of SEC14L3 in the preparation of a product that promotes copper cell death in tumor cells and / or improves physiological indicators related to copper cell death.
[0009] Preferably, the physiological indicators associated with copper death are selected from one or more of Lip-DLAT levels and oligomerized Lip-DLAT levels.
[0010] Preferably, SEC14L3 promotes copper death of tumor cells by regulating the expression of FDX1.
[0011] Preferably, SEC14L3 regulates the expression of FDX1 through the MAPK-ERK1 / 2-YY1 signaling axis to promote copper cell death in tumor cells.
[0012] Preferably, the tumor cells are selected from liver cancer cells.
[0013] The second aspect of the present invention provides the use of SEC14L3 in the preparation of a product for improving the sensitivity of copper death inducers to cancer treatment.
[0014] Preferably, the copper death inducing agent is selected from one or more of ilisimol, disulfiram, and NSC319726.
[0015] Preferably, the cancer is selected from liver cancer.
[0016] The third aspect of the present invention provides a pharmaceutical composition for treating cancer, comprising a SEC14L3 active agent, a copper death inducer, and a pharmaceutically acceptable excipient; the SEC14L3 active agent comprises one or more of a SEC14L3 nucleotide, a SEC14L3 protein, and an agent that promotes SEC14L3 expression.
[0017] Preferably, the copper death inducing agent is selected from one or more of ilisimol, disulfiram, and NSC319726.
[0018] Preferably, the cancer is selected from liver cancer.
[0019] Preferably, the pharmaceutically acceptable excipient is selected from one or more of a filler, a disintegrant, a binder, a lubricant, a flavoring agent, a preservative, an antioxidant, and a colorant.
[0020] It should be understood that, in the context of the present invention, unless otherwise specified, the SEC14L3 or SEC14L3 active agent includes SEC14L3 nucleotides, SEC14L3 proteins encoded by SEC14L3 nucleotides, and other components capable of increasing the expression level of SEC14L3 in cells, as long as the level and / or activity of SEC14L3 can be increased. The SEC14L3 inhibitor refers to a substance that can specifically downregulate the expression level of SEC14L3 and / or the transcription level of its mature mRNA and / or the expression level or activity of SEC14L3 protein, for example, antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miR NA Erasers, Target Masking and / or multi-target methods are used to downregulate the expression level and / or activity of SEC14L3, as long as the level and / or activity of SEC14L3 can be reduced. The primers and / or primer pairs refer to PCR primers used to synthesize the cDNA chain of the SEC14L3 gene in PCR, so as to detect the expression level of the SEC14L3 gene mRNA. In addition to the primers and / or primer pairs listed in the present invention, those skilled in the art are fully capable of designing corresponding primers and / or primer pairs according to the gene sequence of SEC14L3 using conventional methods and means in the art including but not limited to molecular biology, and screening the designed primers and / or primer pairs by conventional experimental means, as long as the specific detection of the SEC14L3 expression level can be achieved; the SEC14L3 protein expression level can also be detected using conventional reagents and methods in the art.
[0021] SEC14L3 is an atypical class III phosphatidylinositol transfer protein (PITPs). The gene is located on chromosome 22q12. The protein encoded by SEC14L3 contains three domains, namely the N-terminal CRAL-TRIO domain that binds lipophilic small molecules, the SEC14 domain of the hydrophobic ligand binding pocket, and the C-terminal GOLD domain that promotes protein-protein interactions. Under physiological conditions, SEC14L3 can act as a transporter to promote the exchange of phosphatidylinositol and phosphatidylcholine between membranes to maintain the balance of membrane lipid levels. Recent studies have found that abnormal expression of SEC14L3 may be associated with the occurrence of human diseases (such as asthma), but the role and mechanism of SEC14L3 in the occurrence of HCC has not been reported.
[0022] After a lot of in-depth research, the present invention first analyzed the relationship between SEC14L3 and the occurrence and development of HCC through bioinformatics in the Cancer Genome Atlas (TCGA) database, and found that SEC14L3 was significantly low-expressed in HCC, and HCC with low expression of SEC14L3 was more malignant, and low expression of SEC14L3 significantly affected the survival prognosis of HCC patients. GSEA analysis showed that SEC14L3 was related to the activity of the MAPK pathway, and SEC14L3 was significantly positively correlated with the expression of the key copper death gene FDX1. This shows that SEC14L3 may regulate the activity of the MAPK pathway of HCC, thereby affecting FDX1 expression.
[0023] Subsequent in vitro and in vivo experiments found that the expression level of SEC14L3 in three liver cancer cell lines was significantly lower than that in normal liver cells, and its expression in 46 hepatocellular carcinoma tissues was also significantly lower than that in their paired adjacent non-tumor tissues. Next, it was found that overexpression of SEC14L3 significantly inhibited the growth of liver cancer cells in a copper ion dose-dependent manner, and significantly increased the level of Lip-DLAT and oligomerized Lip-DLAT, while SEC14L3 knockdown significantly promoted the growth of liver cancer cells and significantly reduced the level of Lip-DLAT and oligomerized Lip-DLAT. These results indicate that SEC14L3 plays an important role in the occurrence and development of HCC, and that SEC14L3 inhibits the growth of liver cancer cells by promoting copper death.
[0024] Furthermore, the present invention conducts an in-depth analysis of the potential mechanism by which SEC14L3 regulates the growth of liver cancer cells through copper death. The results show that the expression level of the key gene FDX1 for copper death in three liver cancer cells is significantly lower than that in normal liver cells; in addition, overexpression of SEC14L3 significantly reduces the level of p-ERK1 / 2, while knockdown of SEC14L3 significantly increases the level of p-ERK1 / 2; further, it is found that inhibition of p-ERK1 / 2 reduces the expression level of YY1 and promotes the expression level of FD X1 by reducing the enrichment level of YY1 on the FDX1 promoter; while activation of p-ERK1 / 2 can promote the expression level of YY1 and reduce the expression level of FDX1 by increasing the enrichment level of YY1 on the FDX 1 promoter. The above results indicate that SEC14L3 can positively regulate the expression of the key gene FDX1 for copper death through the ERK1 / 2-YY1 signal axis. The present invention reveals for the first time that SEC14L3 promotes the expression of the key gene FDX1 for copper death by mediating the ERK / 12-YY1 signal axis.
[0025] Furthermore, the present invention has conducted an in-depth study on the mechanism of action of SEC14L3 and ERK / 12-YY1-FDX1 signal axis regulating copper death to inhibit the growth of liver cancer cells. The results showed that under the action of ES and copper ions, overexpression of SEC14L3 significantly inhibited the growth of liver cancer cells and significantly increased the level of Lip-DLAT and oligomerized Lip-DLAT; on this basis, activating ERK1 / 2 activity significantly promoted the growth of liver cancer cells and significantly reduced the level of Lip-DLAT and oligomerized Lip-DLAT; and further combined overexpression of FDX1 significantly restored the growth inhibition of liver cancer cells and significantly increased the level of Lip-DLAT and oligomerized Lip-DLAT. In addition, under the action of ES and copper ions, SEC14L3 knockdown significantly promoted the growth of liver cancer cells and significantly reduced the level of Lip-DLAT and oligomerized Lip-DLAT; on this basis, inhibiting ERK1 / 2 activity significantly inhibited the growth of liver cancer cells and significantly increased the level of Lip-DLAT and oligomerized Lip-DLAT; and further combined with FDX1 knockdown significantly restored the growth vitality of liver cancer cells and significantly reduced the level of Lip-DLAT and oligomerized Lip-DLAT. The above results show that SEC14L3 promotes copper death through the ERK / 12-YY1-FDX1 signaling axis to inhibit the growth of liver cancer cells, further confirming that SEC14L3-mediated copper death can become a new treatment direction for liver cancer.
[0026] In general, the present invention, through bioinformatics analysis and a series of in vitro and in vivo experiments, discovered and clarified for the first time that SEC14L3 inhibits the growth of hepatocellular carcinoma by regulating copper death, and deeply studied its mechanism of action, namely, SEC14L3 promotes the expression of the key copper death gene FDX1 through the ERK1 / 2-YY1 signaling axis, which converts Cu in cells into 2+ Reduction to Cu + , while inducing DLAT lipoylation (Lip-DLAT); finally Cu + Binding to Lip-DLAT and oligomerization of Lip-DLAT eventually induces copper death in cells, thereby inhibiting the occurrence and development of hepatocellular carcinoma. The present invention enriches the relevant mechanisms of copper death regulation, provides sufficient scientific basis and theoretical foundation for exploring new molecular targets for diagnosis, prognosis and treatment of hepatocellular carcinoma, and developing new targeted drugs, and has important social value and scientific significance. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Schematic diagram of the analysis results of the clinical pathological relationship between SEC14LE and HCC.
[0028] Figure 2 Schematic diagram of the effect of SEC14LE on the survival rate of HCC patients.
[0029] Figure 3 Schematic diagram of the difference in SEC14L3 expression levels in normal hepatocytes and hepatoma cells.
[0030] Figure 4 Schematic diagram of the difference in SEC14L3 expression levels between liver cancer tissues and adjacent adjacent tissues.
[0031] Figure 5 This is a schematic diagram of the effect of copper on the activity of liver cancer cells.
[0032] Figure 6 Schematic diagram of the effects of siRNA and overexpression on SEC14L3 expression levels in liver cancer cells.
[0033] Figure 7 This is a schematic diagram of the effect of SEC14L3 expression level on copper ion activity.
[0034] Figure 8 It is a schematic diagram of the effect of SEC14L3 expression level on Lip-DLAT level; in the bar graph, in the same group, the left group is the Lip-DLAT group, and the right group is the DLAT group.
[0035] Fig. 9Schematic diagram of Immunoblot (Nativa-PAGE) results showing the effect of SEC14L3 expression level on oligomerized Lip-DLAT level.
[0036] Fig.10 Schematic diagram of immunofluorescence results showing the effect of SEC14L3 expression level on oligomerized Lip-DLAT level in HepG2 cells.
[0037] Fig.11 Schematic diagram of immunofluorescence results showing the effect of SEC14L3 expression level on oligomerized Lip-DLAT level in SK-HEP-1 cells.
[0038] Fig.12 Schematic diagram of the difference in FDX1 expression levels between normal hepatocytes and hepatoma cells.
[0039] Fig.13 It is a schematic diagram of the effect of SEC14L3 expression level on FDX1 expression level in HepG2 cells; in the rightmost bar graph, in the same group, the left group is the SEC14L3 group, and the right group is the FDX1 group.
[0040] Fig.14 It is a schematic diagram of the effect of SEC14L3 expression level on FDX1 expression level in SK-HEP-1 cells; in the bar graph on the right, in the same group, the left group is the SEC14L3 group, and the right group is the FDX1 group.
[0041] Fig.15 Schematic diagram of the effect of SEC14L3 expression level on MAPK-ERK1 / 2 in HepG2 cells; in the bar graph, in the same group, from left to right are SEC14L3-CON group, SEC14L3-OE group, siSEC14L3-CON group, and siSEC14L3 group.
[0042] Fig.16 Schematic diagram of the effect of SEC14L3 expression level on MAPK-ERK1 / 2 in SK-HEP-1 cells; in the bar graph, in the same group, from left to right are SEC14L3-CON group, SEC14L3-OE group, siSEC14L3-CON group, and siSEC14L3 group.
[0043] Fig.17 Schematic diagram of the effect of SEC14L3 expression level on YY1 in liver cancer cells after ERK1 / 2 agonist treatment.
[0044] Fig.18 Schematic diagram of the effect of SEC14L3 expression level on FDX1 in liver cancer cells after ERK1 / 2 agonist treatment.
[0045] Fig.19 Schematic diagram of the effect of SEC14L3 expression level on YY1 in liver cancer cells after treatment with ERK1 / 2 inhibitors.
[0046] Fig. 20 Schematic diagram of the effect of SEC14L3 expression level on FDX1 in liver cancer cells after treatment with ERK1 / 2 inhibitors.
[0047] Fig.21 This is a schematic diagram of the effect of SEC14L3 expression level on the enrichment level of YY1 on the FDX1 promoter after ERK1 / 2 agonist treatment; in the same group, the left group is the IgG group and the right group is the YY1 group.
[0048] Fig. 22 This is a schematic diagram of the effect of SEC14L3 expression level on the enrichment level of YY1 on the FDX1 promoter after treatment with ERK1 / 2 inhibitors; in the same group, the left group is the IgG group and the right group is the YY1 group.
[0049] Fig.23 Schematic diagram of the effect of SEC14L3 and FDX1 overexpression on liver cancer cell proliferation.
[0050] Fig.24 Schematic diagram of the effect of inhibiting SEC14L3 and FDX1 expression on liver cancer cell proliferation.
[0051] Fig.25 This is a schematic diagram of the effect of SEC14L3 expression level on the growth of liver cancer cells in vivo; in the tumor growth curve, from top to bottom are the Control group, Control+ES-CuCl2 group, and SEC14L3+ES-CuCl2 group.
[0052] Fig.26 Schematic diagram of the results of immunofluorescence and immunohistochemistry analysis of mouse tumor tissues.
[0053] Fig. 27 Schematic diagram of the quantitative analysis results of immunofluorescence and immunohistochemistry of mouse tumor tissues. DETAILED DESCRIPTION
[0054] In order to make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0055] Unless otherwise specified, the cell lines listed in the context of the present invention, including MIHA, HepG2, Huh7 and SK-HEP-1, were purchased from the American Type Culture Collection (Manassas, USA), cultured according to the prior art, and all cell lines were identified by short tandem repeat analysis of the China Type Culture Collection (Wuhan), and the presence of mycoplasma contamination was verified using a PCR detection kit (Shanghai Biothrive Sci), and frozen in liquid nitrogen for subsequent experiments. The reagents used in the present invention were all commercially available. The upstream primer sequence for detecting the expression level of SEC14L3 mRNA is shown in SEQ ID NO: 1, which is 5'-GAGCACTCGGTGCAGATC-3', and the downstream primer sequence is shown in SEQ ID NO: 2, which is 5'-GCTGGCTGGGTAGAACAT-3'; the upstream primer sequence for detecting the expression level of FDX1 mRNA is shown in SEQ ID NO: 3, which is 5'-GCTTCCAGCAGGGTCTCTC-3', and the downstream primer sequence is shown in SEQ ID NO: 4, which is 5'-CGCGAGAGACTCCAAAGAGG-3'; the siRNA sequence designed for SEC14L3 to reduce the expression level of SEC14L3 in cells is shown in SEQ ID NO: 5 (Sense (5'-3'): CCCTGAAGTTCATGCTCATCGTGAATT) and SEQ ID NO: 6 (Antisense (5'-3'): TTCACGATGAGCATGAACTTCAGGGTT); the siRNA sequence designed for FDX1 to reduce the expression level of FDX1 in cells is shown in SEQ ID NO: NO: 7 (Sense (5'-3'): AAAACATTTTGCTAAAGTCTT) and SEQ ID NO: 8 (Antisense (5'-3'): GACTTTAGCAAAATGTTT TTT); the forward primer sequence of FDX1 promoter in the ChIP experiment is shown in SEQ ID NO: 9, which is 5'-CACTTTGGAAGGCTGAGGTG-3', and the reverse primer sequence is shown in SEQ ID NO: 10, which is 5'-CTATAAAACTCCCACCCCTC-3'; the upstream primer sequence used to detect the expression level of YY1 mRNA is shown in SEQ ID NO: 11, which is 5'-AACAGGCATCCCGAGTTCAG-3', and the downstream primer sequence is shown in SEQ ID NO: 12, which is 5'-GGGGGCTAAAATCACAGCCT-3'.
[0056] The clinical samples used in the present invention were all from the First Affiliated Hospital of Jinan University, and the patients signed informed consent forms; the pathology and tissue morphology of all tissue samples were confirmed by the Department of Pathology of the First Affiliated Hospital of Jinan University. The procedures and methods of the present invention were approved by the Institutional Ethics Committee of the First Affiliated Hospital of Jinan University, in line with the requirements of medical ethics and the quality management standards for drug clinical trials, and the experimental processes all complied with the Declaration of Helsinki. The experimental methods used in the present invention, such as bioinformatics analysis, molecular biology experiments, cell biology experiments, immunohistochemistry, etc., are conventional methods and techniques in the field. Representative results selected from the biological experiment repetitions are presented in the context figures, and the data are displayed as mean ± SD and mean ± SEM as specified in the figure. All in vitro experiments were repeated at least three times, and animal experiments were repeated twice. The data were analyzed using GraphPad Prism 8.0 software. Conventional medical statistical methods such as t-test, chi-square test, and analysis of variance were used to compare the mean differences between two or more groups. *p < 0.05 is considered a significant difference.
[0057] Example 1
[0058] Firstly, differentially expressed genes (DEGs) and survival-related genes (SRGs) were analyzed between hepatocellular carcinoma (HCC) and adjacent tissues. The results showed that there were 1895 DEGs in HCC tissues compared with adjacent tissues, including 1359 upregulated and 536 downregulated DEGs; and Cox regression analysis identified a total of 5693 SRGs. Subsequently, the intersection of DEGs and SRGs was taken to obtain expression-survival-related genes, and a total of 335 expression-survival-related genes were identified for subsequent analysis. These results indicate that there are multiple genomic changes in the pathogenesis of HCC, and expression-survival-related genes may be key genes in the occurrence and development of HCC.
[0059] In order to accurately screen for more relevant expression-survival key genes, the random forest model was used to analyze the effects of the above-mentioned intersection genes on survival and to rank them by importance. The results showed that SEC14L3 may be one of the top ten genes highly associated with HCC. Subsequently, the correlation between the top ten key genes and the copper death upstream regulatory gene FDX1 was analyzed, and it was found that SEC14L3 was most significantly positively correlated with FDX1 (R=0.32, p<0.0001). These results indicate that SEC14L3 is a key gene in the development of HCC and may regulate copper death.
[0060] In order to explore the effect of SEC14L3 on HCC, the relationship between SEC14LE and HCC clinicopathology was analyzed. The results showed that compared with adjacent normal tissues, the expression of SEC14L3 in HCC tissues was significantly reduced (p < 0.0001); compared with stage I and stage II HCC tissues, SEC14L3 in stage III (advanced liver cancer) and stage IV (advanced liver cancer) HCC tissues was significantly reduced (p = 0.0210); in addition, compared with moderately differentiated (G2) and well differentiated (G1) HCC tissues, SEC14L3 in poorly differentiated (G3) and undifferentiated (G4) HCC tissues was significantly reduced (p < 0.0001) (see Figure 1 Subsequently, by analyzing the effect of SEC14L3 on the overall survival (OS), disease-specific survival (DSS) and progression-free survival (PFS) of HCC patients, it was found that low expression of SEC14L3 was associated with worse OS (Hazard ratio (HR) = 0.59, p = 0.0030), DSS (HR = 0.62, p = 0.0320) and PFS (HR = 0.60, p = 0.0010) in HCC patients (see Figure 2 The above results show that SEC14L3 is lowly expressed in HCC tissues, HCC with low SEC14L3 expression is more malignant, and low SEC14L3 expression significantly affects the survival prognosis of HCC patients.
[0061] In order to explore the pathways that SEC14L3 may regulate, KEGG single gene GSEA analysis was performed on SEC14L3. The results showed that the MAPK pathway was significantly enriched in HCC patients with low expression of SEC14L3. Therefore, combined with the GTPase properties of SEC14L3 and the abnormal activation of the MAPK-ERK1 / 2 pathway in almost all advanced HCC patients, it is inferred that SEC14L3 may affect FDX 1 expression through the MAPK-ERK1 / 2 signaling axis.
[0062] To further verify the relationship between SEC14L3 and HCC, fluorescence quantitative RT-PCR and Immunoblot (SDS-PAGE) were used to verify the mRNA and protein expression levels of SEC14L3 in HepG2, Huh7 and SK-HEP-1. The results showed that compared with MIHA normal hepatocytes, the mRNA and protein expressions of SEC14L3 in HepG2, Huh7 and SK-HEP-1 were significantly reduced (see Figure 3). Subsequently, tumor tissues and matched adjacent non-tumor tissues (MANT) of 46 liver cancer patients from the First Affiliated Hospital of Jinan University were collected for IHC analysis. The results showed that the expression level of SEC14L3 protein in HCC tissues was also significantly lower than that in MANT, which was consistent with the above cell results (p < 0.0001) (see Figure 4 ).
[0063] Example 2
[0064] In order to explore the effect of copper on liver cancer cells, different concentrations of the potent copper ion carrier Elesclomol (ES) (0nM, 10nM, 30nM, 50nM) and a fixed concentration of copper ions (CuCl2, 1μM) were added to the culture medium of liver cancer cells (HepG2 and SK-HEP-1) respectively; another experimental group was set up, that is, different concentrations of ES (0nM, 10nM, 30nM, 50nM) and a fixed concentration of copper ions (CuCl2, 1μM) were added to the culture medium, and the copper chelator tetrathiomolybdate (Tetrathiomolybdate, TTM) was added. After 48 hours of culture, CCK-8 experiments were performed to detect the proliferation activity of liver cancer cells. The results showed that copper ions inhibited the growth of liver cancer cells in a dose-dependent manner, and the addition of TTM could completely reverse the activity of liver cancer cells (see Figure 5 The above results show that copper ions can promote the death of liver cancer cells, and ES treatment alone has no effect on the growth of liver cancer cells.
[0065] In order to study whether SEC14L3 can regulate copper death of liver cancer cells, SEC14L3 expression plasmid (SEC14L3-OE) and its negative control (SEC14L3-CON), siRNA (siSEC14L3) that interferes with knocking down SEC14L3 expression and its negative control (siSEC14L3-CON) were transfected into liver cancer cells (HepG2 and SK-HEP-1), and RT-PCR was used to detect the changes in SEC14L3 mRNA. The results showed that the mRNA expression level of SEC14L3 in the SEC14L3-OE group was significantly higher than that in the SEC14L3-CON group, while the mRNA expression level of SEC14L3 in the siSEC14L3 group was significantly lower than that in the siSEC14L3-CON group, indicating that the SEC14L3 overexpression plasmid and siRNA sequence were successfully transfected into liver cancer cells (see Figure 6 ).
[0066] Subsequently, different concentrations of the potent copper ion carrier elisemol (ES) (0nM, 10nM, 30nM, 50nM) and a fixed concentration of copper ions (CuCl2, 1μM) were added to the culture medium of each group, and CCK-8 experiments were performed after 48 hours of culture to detect the proliferation activity of liver cancer cells. Compared with the negative control group, overexpression of SEC14L3 can significantly enhance the inhibitory effect of copper ions on the growth of liver cancer cells, while interference knockdown of SEC14L3 expression significantly weakened the inhibitory effect of copper ions on the growth of liver cancer cells (see Figure 7 ). This indicates that SEC14L3 can positively regulate the inhibitory effect of copper ions on the growth of liver cancer cells.
[0067] Previous studies have shown that the main characteristics of copper death are the increase of lipoylated dihydrolipoyl transacetylase (Lip-DLAT) protein level and oligomerized Lip-DLAT level. In order to clarify whether the inhibitory effect of SEC14L3 on the growth of liver cancer cells by copper ions is mediated by copper death, SEC14L3 expression plasmid (SEC14L3-OE) and its negative control (SEC14L3-CON), siRNA knocking down SEC14L3 expression (siSEC14L3) and its negative control (siSEC14L3-CON) were transfected into liver cancer cells (HepG2 and SK-HEP-1), and 30nM of the potent copper ion carrier elisemol (ES) and 1μM copper ions were added to the culture medium of each group, and a group of negative controls were set up. After 48 hours of culture, Immunoblot (SDS-PAGE and Native-PAGE) and immunofluorescence were used to detect the changes in the levels of Lip-DLAT and oligomerized Lip-DLAT. The results of Immunoblot (SDS-PAGE) showed that overexpression of SEC14L3 significantly increased the level of Lip-DLAT compared with the negative control group, while interference knockdown of SEC14L3 expression significantly reduced the level of Lip-DLAT (see Figure 8 ); Immunoblot (Native-PAGE) and immunofluorescence results showed that compared with the negative control group, overexpression of SEC14L3 could significantly increase the level of oligomeric Lip-DLAT, while interference knockdown of SEC14L3 expression significantly reduced the level of oligomeric Lip-DLAT (see Figure 9-11 ). In addition, Immunoblot (SDS-PAGE) results showed that compared with the negative control group, overexpression or knockdown of SEC14L3 expression in liver cancer cells had no significant effect on DLAT expression levels. The above results show that SEC14L3 positively regulates copper death in liver cancer cells.
[0068] Example 3
[0069] FDX1 is the most critical upstream regulator of copper death. FDX1 is an evolutionarily conserved protein containing an iron-sulfur cluster. Under physiological conditions, it can transfer electrons to a variety of different proteins as a reducing agent to affect a variety of different biochemical processes in the cell. FDX1 can initiate a free radical chain reaction by transferring electrons, thereby causing lipoylation of TCA cycle-related proteins. Protein lipoylation is a highly conserved post-translational modification of lysine. It is known that it only occurs in four enzymes involved in the TCA cycle, including dihydrolipoamide branched chain transacylase E2 (DBT), glycine cleavage system protein H (GCSH), dihydrolipoamide S-succinyltransferase (DLST) and DLAT, and protein lipoylation modification is essential for normal enzyme function. Studies have shown that FDX1, as an important upstream regulator of copper death, can not only 2+ Reduction to Cu + To enhance the cytotoxicity of copper, it can also promote the lipoylation of DLAT, while Cu + Binding to lip-DLAT promotes oligomerization and aggregation of the latter, which eventually leads to cell death. Previous studies have shown that FDX1 is significantly low-expressed in HCC, and low expression of FDX1 is associated with worse overall survival (OS), disease-specific survival (DSS) and progression-free survival (PFS) in HCC patients. In vitro experiments have shown that knocking down FDX1 significantly promotes the proliferation and migration of liver cancer cells, indicating that FDX1 can be used as a potential therapeutic target for HCC.
[0070] In order to study the relationship and regulatory role of SEC14L3 and the key gene FDX1 of copper death in liver cancer cells, the mRNA and protein expression levels of FDX1 in liver cancer cells (HepG2, Huh7 and SK-HEP-1) were detected by fluorescence quantitative RT-PCR and Immunoblot (SDS-PAGE). The results showed that compared with MIHA normal liver cells, the mRNA and protein expression levels of FDX1 in liver cancer cells were significantly reduced (see Fig.12 ).
[0071] Subsequently, the SEC14L3 expression plasmid (SEC14L3-OE) and its negative control (SEC14L3-CON), siRNA that interferes with knocking down SEC14L3 expression (siSEC14L3) and its negative control (siSEC14L3-CON) were transfected into liver cancer cells (HepG2 and SK-HEP-1), and then fluorescent quantitative RT-PCR and Immuno blot (SDS-PAGE) were used to detect the changes in FDX1 mRNA and protein. The results showed that compared with the negative control group, overexpression of SEC14L3 significantly promoted the mRNA and protein expression levels of FDX1, while knocking down SEC 14L3 expression significantly inhibited the mRNA and protein expression levels of FDX1 (see Figure 13-14 ). The above results indicate that SEC14L3 positively regulates FDX1 expression in liver cancer cells.
[0072] The mitogen-activated protein kinase-extracellular signal-regulated kinase1 / 2 (MAPK-ERK1 / 2) signaling axis is involved in regulating important biological processes such as cell proliferation, differentiation, apoptosis and angiogenesis. In order to study whether SEC 14L3 can regulate the MAPK-ERK1 / 2 pathway, SEC14L3 expression plasmid (SEC14L3-OE) and its negative control (SEC14L3-CON), siRNA knocking down SEC14L3 expression (siSEC14L3) and its negative control (siSEC14L3-CON) were transfected into liver cancer cells (HepG2 and SK-HEP-1), and the changes of ERK1 / 2 and phosphorylated ERK1 / 2 (p-ERK1 / 2) proteins were detected by Immunoblot (SDS-PAGE). The results showed that compared with the negative control group, overexpression of SEC14L3 significantly reduced the level of p-ERK1 / 2; knockdown of SEC14L3 significantly increased the level of p-ERK1 / 2; while SEC14L3 had no effect on the protein expression of ERK1 / 2 (see Figure 15-16 The above results indicate that SEC14L3 negatively regulates the activity of MAPK-ERK1 / 2 signaling pathway in liver cancer cells.
[0073] Yin-Yang1 (YY1) is a multifunctional transcription factor that is widely expressed in human tissues and participates in a variety of cellular processes under physiological conditions, including gene transcription regulation (activation / inhibition), cell proliferation, DNA repair, etc. Studies have found that ERK can regulate YY1 through direct protein interactions, which further affects downstream gene expression. However, the role of the ERK1 / 2-YY1 signaling axis in hepatocellular carcinoma has not been reported.
[0074] In order to clarify whether SEC14L3 regulates FDX1 expression through the ERK1 / 2-YY1 signaling axis, SEC14L3 (SEC14L3-OE) and SEC14L3 combined with ERK1 / 2 agonists (SEC14L3-OE+Ro 67-7476) were overexpressed in hepatoma cells (HepG2 and SK-HEP-1), and a negative control (SEC14L3-CON) group was established. Then, the mRNA and protein changes of YY1 and FDX1 were detected by fluorescent quantitative RT-PCR and Immunoblot (SDS-PAGE), respectively. The results showed that compared with the SEC14L3-CON group, overexpression of SEC14L3 significantly inhibited the mRNA and protein expression of YY1 (see Fig.17 ), while promoting the mRNA and protein expression of FDX1 (see Fig.18 ); on this basis, after the addition of Ro 67-7476 (ERK1 / 2 agonist) treatment, the mRNA and protein expression levels of YY1 were significantly increased compared with the SEC14L3-OE group, while the mRNA and protein expression levels of FDX1 were significantly decreased compared with the SEC14L3-OE group.
[0075] In addition, we knocked down SEC14L3 expression (siSEC14L3) and knocked down SEC14L3 expression in combination with ERK1 / 2 inhibitor (siSEC14L3+PO98059) in liver cancer cells (HepG2 and SK-HEP-1), and set up a negative control (siSEC14L3-CON) group. Then, we used fluorescent quantitative RT-PCR and Immunoblot (SDS-PAGE) to detect the mRNA and protein changes of YY1 and FDX1, respectively. The results showed that compared with the siSEC14L3-CON group, interference knockdown of SEC14L3 expression significantly promoted the mRNA and protein expression of YY1 (see Fig.19 ), and significantly inhibited the mRNA and protein expression of the downstream signaling molecule FDX1 (see Fig. 20); on this basis, after adding PD98059 (p-ERK1 / 2 inhibitor) treatment, the mRNA and protein expression levels of YY1 were significantly lower than those of the siSEC14L3 group, while the mRNA and protein expression levels of FDX1 were significantly higher than those of the siSEC14L3 group.
[0076] Furthermore, in order to study the mechanism of ERK1 / 2-YY1 signaling axis regulating FDX1, ChIP technology was used to detect the enrichment of YY1 on the FDX1 promoter in each group. The results showed that compared with SEC14L3-CON, overexpression of SEC14L3 significantly reduced the enrichment level of YY1 on the FDX1 promoter; on this basis, after adding Ro67-7476 treatment, the enrichment level of YY1 on the FDX1 promoter was significantly higher than that of the SEC14L3-OE group (see Fig.21 Compared with the siSEC14L3-CON group, knocking down SEC14L3 expression significantly increased the enrichment level of YY1 on the FDX1 promoter; compared with the siSEC14L3 group, after adding PD98059 treatment on this basis, the enrichment level of YY1 on the FDX1 promoter was significantly lower than that of the siSEC14L3 group (see Fig. 22 The above results collectively indicate that SEC14L3 positively regulates the expression of FDX1 in liver cancer cells through the ERK1 / 2-YY1 signaling pathway. The mechanism is that SEC14L3 negatively regulates the enrichment level of YY1 on the FDX1 promoter, thereby affecting the expression of FDX1.
[0077] In order to clarify that SEC14L3 regulates copper death through the ERK1 / 2-YY1-FDX1 signaling axis to affect the viability of liver cancer cells, SEC14L3 (SEC14L3-OE), SEC14L3 combined with ERK1 / 2 agonist (SEC14L3-OE+Ro 67-7476), and SEC14L3 and FDX1 combined with ERK1 / 2 agonist (SEC14L3-OE+Ro 67-7476+FDX1-OE) were overexpressed in liver cancer cells (HepG2 and SK-HEP-1), and a negative control (SEC14L3-OE-CON) group was set up. 30nM of the potent copper ion carrier elismol (ES) and 1μM copper ions were added to the culture medium, and a negative control group without ES-CuCl2 was set up. After 48h of culture, the CCK-8 method was used to detect the changes in liver cancer cell viability. The results showed that compared with the SEC14L3-CON+ES-CuCl2 group, overexpression of SEC14L3 significantly enhanced the inhibitory effect of copper ions on the growth of liver cancer cells; on this basis, after the addition of Ro 67-7476, the growth activity of liver cancer cells was significantly increased compared with the SEC14L3-OE+ES-CuCl2 group; compared with the SEC14L3-OE+ES-CuCl2+Ro67-7476 group, the combined overexpression of FDX1 significantly inhibited the growth activity of liver cancer cells (see Fig.23 ). The results of Immunoblot (SDS-PAGE and Native-PAGE) and immunofluorescence techniques showed that compared with the SEC14L3-CON+ES-CuCl2 group, overexpression of SEC14L3 significantly increased the Lip-DLAT level and oligomerized Lip-DLAT level of liver cancer cells; on this basis, after adding Ro 67-7476, the Lip-DLAT level and oligomerized Lip-DLAT level of liver cancer cells were significantly reduced compared with the SEC14L3-OE+ES-CuCl2 group; compared with the SEC14L3-OE+ES-CuCl2+Ro 67-7476 group, combined overexpression of FDX1 significantly increased the Lip-DLAT level and oligomerized Lip-DLAT level of liver cancer cells; and Immunoblot (SDS-PAGE) results showed that the above treatments had no significant effect on the expression level of DLAT (not shown in the figure).
[0078] On the other hand, SEC14L3 expression was knocked down (siSEC 14L3), SEC14L3 expression was knocked down and combined with ERK1 / 2 inhibitor (siSEC14L3+PD98059), SEC14L3 and FDX1 expression were knocked down and combined with ERK1 / 2 inhibitor (siSEC14L3+PD98059+siFDX1) in liver cancer cells (HepG2 and SK-HEP-1), and a negative control (siSEC14L3-CON) was set up. 30nM of the potent copper ion carrier elisemol (ES) and 1μM copper ions were added to the culture medium, and a negative control group without ES-CuCl2 was set up. After 48h of culture, the CCK-8 method was used to detect the changes in liver cancer cell viability. The results showed that compared with the siSEC14L3-CON+ES-CuCl2 group, knocking down SEC14L3 expression significantly weakened the inhibitory effect of copper ions on the growth of liver cancer cells; on this basis, after adding PD98059, the growth activity of liver cancer cells was significantly reduced compared with the siSEC14L3+ES-CuCl2 group; compared with the siSEC14L3+ES-CuCl2+PD98059 group, the combined knockdown of FDX1 significantly enhanced the growth activity of liver cancer cells (see Fig.24 ). The results of Immunoblot (SDS-PAGE and Native-PAGE) and immunofluorescence technology showed that compared with the siSEC14L3-CON+ES-CuCl2 group, interference knockdown of SEC14L3 expression significantly reduced the Lip-DLAT level and oligomerization Lip-DLAT level of liver cancer cells; on this basis, after adding PD98059, the Lip-DLAT level and oligomerization Lip-DLAT level of liver cancer cells were significantly increased compared with the siSEC14L3+ES-CuCl2 group; compared with the siSEC14L3+ES-CuCl2+PD98059 group, combined knockdown of FDX1 significantly reduced the Lip-DLAT level and oligomerization Lip-DLAT level of liver cancer cells; and the results of Immunob lot (SDS-PAGE) showed that the above treatments had no significant effect on the expression level of DLAT (not shown in the figure). The above results collectively indicate that SEC14L3 regulates copper death through the ERK1 / 2-YY1-FDX1 signaling axis to inhibit the vitality of liver cancer cells.
[0079] To elucidate how SEC14L3 regulates hepatocellular carcinoma growth through copper death in vivo, HepG2 cells stably transfected with SEC14L3-CON and SEC14L3-OE were injected subcutaneously into 4-week-old male SPF-grade BALB / c-nu mice. Seven days later, the SEC14L3-CON group was randomly divided into two groups and intraperitoneally injected with saline and ES (50 mg / kg) + CuCl2 (0.06 mg / kg), respectively, while the SEC14L3-OE group was intraperitoneally injected with ES (50 mg / kg) + CuCl2 (0.06 mg / kg) 5 times a week, and tumor growth was monitored; after 28 days, the nude mice were killed and the tumor weight was measured. The results showed that the tumor size, tumor weight and growth rate of the SEC14L3-CON + ES-CuCl2 group were significantly lower than those of the SEC14L3-CON group; and stable overexpression of SEC14L3 significantly enhanced the inhibitory effect of ES-CuCl2 on tumors (see Fig.25 ).
[0080] Subsequently, immunofluorescence and immunohistochemistry staining were used to detect Lip-DLAT deposition and Ki-67 expression in each group. Compared with the SEC14L3-CON group, the oligomeric Lip-DLAT deposition in the liver cancer tissue of the SEC14L3-CON+ES-CuCl2 group increased significantly, and the proportion of Ki-67 expressing cells decreased significantly; while stable overexpression of SEC14L3 significantly increased ES-CuCl2-mediated Lip-DLAT deposition and significantly inhibited the proportion of Ki-67 expressing cells (see Figure 26-27 These results suggest that SEC14L3 can inhibit the growth of hepatocellular carcinoma in vivo by promoting copper death.
[0081] It is clear from the above that SEC14L3 is a target associated with HCC. Through bioinformatics analysis and a series of in vitro and in vivo experiments, the present invention first discovered and clarified that SEC14L3 inhibits the growth of hepatocellular carcinoma by regulating copper death, and deeply studied its mechanism of action, namely, SEC14L3 promotes the expression of the key copper death gene FDX1 through the ERK1 / 2-YY1 signaling axis, which converts Cu in cells into 2+ Reduction to Cu + , while inducing DLAT lipoylation (Lip-DLAT); finally Cu +Binding to Lip-DLAT and oligomerization of Lip-DLAT eventually induces copper death in cells, thereby inhibiting the occurrence and development of hepatocellular carcinoma. The present invention enriches the relevant mechanisms of copper death regulation, provides sufficient scientific basis and theoretical foundation for exploring new molecular targets for diagnosis, prognosis and treatment of hepatocellular carcinoma, and developing new targeted drugs, helps to better achieve precision treatment, and provides a new drug treatment target for humans to conquer liver cancer, which has important social value and scientific significance.
[0082] The above specific implementation method part specifically introduces the analytical method involved in the present invention. It should be noted that the above introduction is only to help those skilled in the art better understand the method and ideas of the present invention, rather than limiting the relevant content. Without departing from the principle of the present invention, those skilled in the art may also make appropriate adjustments or modifications to the present invention, and the above adjustments and modifications shall also fall within the scope of protection of the present invention.
Claims
1. Use of SEC14L3 and copper death inducer in the preparation of a drug for treating liver cancer, characterized in that: The copper death inducing agent is selected from one or more of ilisimol, disulfiram, and NSC319726.
2. A pharmaceutical composition for treating liver cancer, characterized in that: It includes a SEC14L3 active agent, a copper death inducer, and a pharmaceutically acceptable excipient; the SEC14L3 active agent is selected from one or more of SEC14L3 nucleotides and SEC14L3 proteins; the copper death inducer is selected from one or more of ilisimol, disulfiram, and NSC319726.