A rice bundle sheath cell-specific promoter and its application

Abstract

The present invention relates to a rice bundle sheath cell-specific promoter and its application, belonging to the technical field of agricultural genetic engineering. The nucleotide sequence of the promoter is shown in SEQ ID NO. 1. Through single-cell sequencing and RNA in situ hybridization analysis of rice leaves, the present invention screened and identified a rice bundle sheath cell-specifically expressed gene, Os07g0683900. The 1.5 kb sequence preceding the transcription start site of this gene and the 5' UTR sequence following the transcription start site were selected as the promoter sequence. Analysis of OsSWEET13-overexpressing rice plants driven by this promoter revealed that the rice bundle sheath cell-specific promoter can significantly promote rice growth, providing important theoretical significance and application value for rice breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural gene engineering, and particularly relates to a rice bundle sheath cell-specific promoter and application thereof. Background Art

[0002] Compared to C3 plants, C4 plants have a higher photosynthetic carbon fixation efficiency, which is due to the specific differentiation of their mesophyll cells and bundle sheath functions. In C4 plants, the core carbon fixation reaction, the "Calvin cycle," is carried out specifically in bundle sheath cells, while in C3 plants, this cycle occurs specifically in mesophyll cells. Furthermore, C4 bundle sheath cells contain a large number of chloroplasts, and their morphological structure is significantly different from that of mesophyll cells. These biochemical reactions and cellular structures that are specific to the C4 bundle sheath require genes specifically expressed in the bundle sheath to maintain and regulate them.

[0003] Rice is one of the world's three major food crops and a major staple food crop in my country. Researchers and major breeding companies have been diligently attempting to transform C3 rice into C4 rice, significantly increasing its yield ceiling. This transformation relies on rice bundle sheath-specific promoters to precisely regulate upstream molecular processes in sheath cells. However, to date, some C4 bundle sheath-specific promoters from maize and other strains have been shown to have non-conserved tissue expression patterns in rice, making their utilization difficult. Consequently, there are few reports on the discovery and application of rice bundle sheath-specific promoters. Summary of the Invention

[0004] The purpose of the present invention is to provide a rice bundle sheath cell-specific promoter and its application in order to solve the above problems.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] The present invention provides a rice bundle sheath cell-specific promoter, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides an application of the rice bundle sheath cell-specific promoter in promoting the growth of C3 plants.

[0008] As a further optimization scheme of the present invention, the promotion of C3 plant growth refers to using the rice bundle sheath cell-specific promoter to activate the upstream molecular process regulatory genes of the plant's sheath cells, so that the "Calvin cycle" of the core carbon fixation reaction in the C3 plant is specifically carried out in the bundle sheath cells, thereby transforming the C3 plant into a C4 plant.

[0009] As a further optimized solution of the present invention, the C3 plant is rice.

[0010] As a further optimized solution of the present invention, the upstream molecular process regulatory gene of the sheath cells of the plant is SWEET13, and the nucleotide sequence is shown in SEQ ID NO.2.

[0011] The present invention also provides a plasmid vector, which is a pCAMBIA1300 vector in which the multiple cloning site region is sequentially connected with the bundle sheath cell-specific promoter, OsSWEET13 gene, GFP gene and NOS terminator.

[0012] The present invention also provides a genetically engineered host cell, which is an Escherichia coli DH5α competent cell or a rice bundle sheath cell having the bundle sheath cell-specific promoter integrated into its genome.

[0013] The beneficial effects of the present invention are:

[0014] The present invention screened and identified a rice bundle sheath cell-specific gene, Os07g0683900, through single-cell sequencing and RNA in situ hybridization analysis of rice leaves. The 1.5 kb sequence before the transcription start site and the 5' UTR sequence after the transcription start site of this gene were selected as the promoter sequence. By analyzing OsSWEET13-overexpressing rice plants driven by this promoter, it was found that this rice bundle sheath cell-specific promoter can significantly promote rice growth, providing important theoretical significance and application value for rice breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Os07g0683900 is specifically expressed in bundle sheath cells (A) Expression abundance of Os07g0683900 in various cell types in single-cell data; B) RNA in situ hybridization of Os07g0683900 in rice leaves.

[0016] Figure 2 This is a schematic diagram of the functional frame region of the binary vector of OsSWEET13 driven by two promoters;

[0017] Figure 3 This is a schematic diagram of the growth status of transgenic rice driven by the OsSWEET13 promoter two weeks later;

[0018] Figure 4 This is a schematic diagram of the single-plant yield of wild-type rice and pOs07g0683900::OsSWEET13 transgenic rice. DETAILED DESCRIPTION

[0019] The present application is described in further detail below. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0020] All reagents used in this experiment are conventional reagents unless otherwise specified. They are all prepared with deionized water, and all instruments used are conventional laboratory instruments.

[0021] 1. Screening and verification of rice bundle sheath cell-specifically expressed genes

[0022] 1.1 Rice Single-Cell Sequencing Analysis

[0023] (1) Experimental Materials: Seeds of the cultivated variety Oryza Sativa L. spp. japonica with husks retained were soaked in water and incubated in the dark at 37°C until they turned white. After germination, the seeds were transferred to a plant light incubator and incubated at 28°C, 16 h light, 26°C, 8 h dark, and 20,000 lux for 14 days.

[0024] (2) Sample preparation and quality inspection: Take the third rice leaf and freeze it in liquid nitrogen to prepare a single cell nucleus suspension. Take a small amount of single cell nucleus suspension and add an equal volume of 0.4% trypan blue dye. II Automated Cell Counter was used to count the cells and the viable cell concentration was adjusted to the ideal concentration (1000-2000 cells / uL).

[0025] (3) 10× labeled cDNA fragments: Gel beads containing barcode information are combined with a mixture of living cells and enzymes and placed in a reservoir separated by oil to form GEMs (Gel Beads-In-Emulsions). The gel beads then dissolve to release the captured sequences containing the barcode sequence, reverse transcribe the cDNA fragments, and label the sample. The gel beads are crushed and the oil droplets are broken up, and PCR amplification is performed using the cDNA as a template. The products of all GEMs are mixed to construct a sequencing library.

[0026] (4) Library sequencing: Sequencing was performed using the Illumina sequencing platform with a sequencing read length of PE150, and the sequencing results were quality controlled.

[0027] (5) Data quality control: The sequencing results were compared with the Nipponbare genome, and the sequencing data were processed. The sequencing quality was controlled using cellranger. Based on the expression level of intracellular genes, the number of expressed genes, the expression level of mitochondria, and the expression level of chloroplasts, low-quality cells such as double cells, multiple cells, or dead cells were filtered out.

[0028] (6) Linear dimensionality reduction and cluster analysis: PCA linear dimensionality reduction analysis was performed using gene expression levels. Cell clustering was performed after dimensionality reduction, and cluster analysis was performed on the reduced data using the soft k-means clustering algorithm. Based on the results of cell subpopulation classification, two nonlinear dimensionality reduction techniques, t-SNE (t-Distributed Stochastic Neighbor Embedding) and UMAP (Uniform Manifold Approximation and Projection) provided by Seurar (V3.1.0), were used to reduce the dimensionality of the single-cell subpopulation classification results and visualize the data.

[0029] (7) Cell type identification: Subpopulation identification was performed based on the reported specific marker genes of different rice cell types, the correlation between clusters, and the highly expressed genes in the clusters. The identified marker genes were visualized and analyzed using the DotPlot and FeaturePlot functions.

[0030] (8) Differential gene analysis: The rank sum test was used to analyze the differential expression of genes in different cell populations. The genes with upregulated expression in the subpopulations were screened based on a p-value less than 0.05 and a difference multiple greater than 1.5.

[0031] 1.2 RNA in situ hybridization of Os07g0683900 in rice leaves

[0032] (1) Fixation: Take the third leaf of a 14-day-old Nipponbare seedling and quickly place it in Carnoy's fixative (ethanol:acetic acid 3:1) and place it in a 4°C refrigerator overnight.

[0033] (2) Dehydration: Place the fixed leaf tissue into a fully automatic dehydrator for dehydration.

[0034] (3) Embedding: Turn on the freezing embedding table in advance and set the temperature to 65°C. Pour 1 / 3 of wax into the embedding box first. After 1 minute, quickly put the sample in. Use preheated tweezers to arrange the sample neatly and place the embedding box. Let it stand until it is completely solidified and store at 4°C.

[0035] (4) Sectioning: The embedded sample was trimmed into a trapezoidal shape with a blade, sliced ​​with a microtome, and examined under an optical microscope. Appropriate sections were selected and placed in a 30°C DEPC water bath for spreading. The sections were then removed with a glass slide and placed in a 42°C drying machine overnight and stored at 4°C.

[0036] (5) Template preparation: A pair of specific primers for amplifying approximately 800 bp were designed from the Os07g0683900 gene, and a T7 promoter sequence was added to the 5′ end of the forward or reverse primer;

[0037] Sense chain primer: SEQ ID NO.3: Os07g0683900-F: GTTCAAGGACATGAGGTTCAGCA C, SEQ ID NO.4: Os07g0683900-R: GTCACCCTCGCACCACTTCCACGTAATACGACT CACTATAGGGC;

[0038] Antisense primer: SEQ ID NO.5: Os07g0683900-F: GTAATACGACTCACTATAGGGCGTTCAAGGACATGAGGTTCAGCAC, SEQ ID NO.6: Os07g0683900-R: GTCACCCTCG CACCACTTCCAC;

[0039] The sense and antisense probes were amplified using cDNA as template using high-fidelity enzymes, and then the agarose gel was cut and recovered.

[0040] (6) In vitro transcription and probe purification: T7 RNA Polymerase (Promega) and DIG-11-UTP (Roche) were used for in vitro transcription and labeling. The reaction system consisted of 2 μL of 10× transcription buffer, 0.5 μL of RNase inhibitor, 0.8 μL of 25× NTP mix, 2 μL of Dig-UTP, 2 μL of T7 RNA Polymerase, and 200 ng of cDNA. The reaction was incubated at 37°C for 2 h. 0.2 μL of RNase-free DNase was added to the reaction system, and the reaction was incubated at 37°C for 15 min. 1 μL of 0.5 M EDTA, 2.5 μL of 4 M LiCl, and 75 μL of anhydrous ethanol were added, and the reaction was precipitated at -20°C for 2-3 h. Subsequently, centrifuge at 12,000 rpm at 4°C for 30 minutes, discard the supernatant, add 1 mL of pre-chilled 80% ethanol, centrifuge at 12,000 rpm at 4°C for 5 minutes, completely discard the supernatant, dry in a laminar flow hood, and fully dissolve in 100 μL of DEPC H2O. Add 100 μL of carbonate buffer and incubate in a 60°C water bath for approximately 1 hour, then neutralize the reaction with 20 μL of 10% acetic acid. Add 1 μL of glycogen, 1 μL of 1M MgCl2, and 600 μL of anhydrous ethanol to the system, and incubate at -20°C overnight. Subsequently, centrifuge at 12,000 rpm at 4°C for 30 minutes, discard the supernatant, add 1 mL of pre-chilled 80% ethanol, centrifuge at 12,000 rpm at 4°C for 5 minutes, completely discard the supernatant, dry in a laminar flow hood, and fully dissolve in 50 μL of DEPC H2O.

[0041] (7) Probe prehybridization: Place the sections on a staining rack and perform the following operations in sequence: xylene for 10 min, twice → 100% ethanol for 2 min, twice → 95% ethanol for 1 min → 90% ethanol for 1 min → 80% ethanol for 1 min → 60% ethanol, 0.75% NaCl for 1 min → 30% ethanol, 0.75% NaCl for 1 min → 0.75% NaCl for 2 min, twice → 1× PBS for 2 min, twice → acetic anhydride solution (containing 19.2 mg / mL proteinase K) for 25 min → 1× PBS (containing 2 mg / mL glycine) for 2 min → 1× PBS for 2 min, twice → FAA (ethanol: acetic acid: formaldehyde: water = 10:1:2:7) for 5 min → 1× PBS for 5 min, twice → 0.75% NaCl for 2 min, twice → 30% ethanol, 0.75% NaCl for 30 s → 60% ethanol, 0.75% NaCl 30s→80% ethanol 30s→90% ethanol 30s→95% ethanol 30s→100% ethanol 10min, 2 times.

[0042] (8) Probe hybridization: Place the slides at room temperature to dry for 30 minutes. Dilute the synthesized probe 5 times with 50% formamide solution, add 1uL probe + 29uL 50% formamide, denature at 80℃ for 2 minutes, quickly place on ice for 3 minutes, add 120uL hybridization solution, place absorbent paper in a wet box, soak with 2×SSC solution, add 100uL hybridization solution containing the probe to each slide, cover with a coverslip, and place in a wet box at 50℃ for incubation for 16-20 hours.

[0043] (9) Washing off the probe: Remove the coverslip in 0.2×SSC preheated at 55°C and incubate in 0.2×SSC at 55°C for 2 h, replacing the 0.2×SSC solution every 30 min. Transfer to 0.2×SSC preheated at 37°C and incubate for 5 min, repeat once, and finally place in 1×PBS and rinse for 5 min.

[0044] (10) Immunodetection and color development: Transfer to 1% blocking solution and block on a shaker at room temperature for 1 hour. Add 100uL of antibody solution to each slide, cover with a coverslip, and incubate in a humidified chamber at room temperature for 90 minutes. Wash the coverslip in the blocking solution of the previous step and wash three times with 1% blocking solution at room temperature for 30 minutes each. Transfer to TNM-50 solution and wash twice for 5 minutes each. Add 100uL of NBT / BCIP color development substrate to the slide and develop color in the dark for 1-3 days. After color development, separate the slides in 1×TE and observe and photograph under an optical microscope.

[0045] Through single-cell sequencing and RNA in situ hybridization analysis of rice leaves in steps 1.1 and 1.2 above, a gene Os07g0683900 with high and specific expression in the rice vascular bundle sheath was screened and confirmed. Figure 1 As shown in A, the expression abundance of Os07g0683900 in various cell types in single-cell sequencing data is shown in Figure 1 Shown in B is RNA in situ hybridization for Os07g0683900 in rice leaves. The darker purple-stained area is the bundle sheath cell, and the arrow indicates one of the bundle sheath cells.

[0046] The 1.5 kb sequence before the transcription start site of the Os07g0683900 gene and the 5'UTR sequence after the transcription start site were selected as the Os07g0683900 promoter sequence. The Os07g0683900 promoter sequence is shown in SEQ ID NO.1.

[0047] 2. Os07g0683900 promoter overexpresses OsSWEET13

[0048] Bundle sheath cells enclose vascular cells and phloem cells, insulating them from mesophyll cells. Sugars synthesized in mesophyll cells must pass through the bundle sheath to be transported to the phloem and then to other parts of the plant. The SWEET13 gene is a key protein in sugar transport and is specifically and highly expressed in the bundle sheath cells of C4 plants.

[0049] 2.1. Construction of Rice Transformation Vectors

[0050] Based on the promoter sequence of rice Os07g0683900 (shown in SEQ ID NO. 1), amplification primers containing homology arms were designed using PrimerPremier 5.0 software:

[0051] SEQ ID NO.7: p-Os07g0683900-F:CAGCTATGACATGATTACagatctTGCGAATGGAAAGGTCAAGGTATCCA;

[0052] SEQ ID NO. 8: p-Os07g0683900-R:TTCACCTCCagcCTGCAGagatctGAGGAGGAGCGAGAGGTGCCACGT.

[0053] Using rice genomic DNA as a template, the Os07g0683900 promoter sequence was PCR amplified, and the PCR product was subjected to gel electrophoresis to obtain the gel recovery product of the target band. The pCAMBIA1300 vector was linearized with BglⅡ, and an Os07g0683900 promoter, OsSWEET13 gene (sequence shown in SEQ ID NO.2), GFP gene and a NOS terminator were sequentially connected to the multiple cloning site of the pCAMBIA1300 vector through homologous recombination reaction to construct the Os07g0683900 promoter vector plasmid ( Figure 2 At the same time, a control group was set up, and a CaMV35S promoter, OsSWEET13 gene, GFP gene and a NOS terminator were connected to the multiple cloning site of the pCAMBIA1300 vector in sequence to construct a CaMV35S promoter vector plasmid ( Figure 2 ), the two vector plasmids were transformed into Escherichia coli DH5α competent cells respectively, single clone colonies were picked for PCR verification, the positive bacterial liquid was expanded and cultured, the plasmid was extracted, and sent to the company for sequencing.

[0054] 2.2 Acquisition and identification of transgenic rice

[0055] The Os07g0683900 promoter vector plasmid and the CaMV35S promoter vector plasmid were transformed into rice ZH11 plants, and the expression of OsSWEET13 was driven by the Os07g0683900 promoter and the constitutive strong promoter CaMV35S, respectively. The results showed that overexpression of OsSWEET13 using the bundle sheath cell-specific Os07g0683900 promoter significantly promoted rice growth ( Figure 3 On the contrary, the growth and development of rice overexpressing OsSWEET13 driven by CaMV35S was inhibited ( Figure 3 The reason is that 6-carbon sugars are the core substances of key metabolic pathways such as glycolysis and gluconeogenesis. The constitutive ectopic high expression of OsSWEET13 may cause metabolic disorders and affect rice growth. The Os07g0683900 promoter can drive the specific expression of OsSWEET13 in vascular bundle sheath cells, thereby promoting rice growth.

[0056] Ten different T1 lines of pOs07g0683900::OsSWEET13 transgenic rice were planted, with eight transgenic-positive seedlings planted in each line. These transgenic seedlings and 40 ZH11 wild-type seedlings were harvested individually, and the seeds were dried at 37°C for 5 days. The seed weight of each rice plant was then counted. Figure 4 The results showed that the seed mass and yield of each plant of pOs07g0683900::OsSWEET13 were significantly higher than those of the wild type, indicating that specifically expressing OsSWEET13 in the rice bundle sheath using the Os07g0683900 promoter can increase rice yield.

[0057] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. An application of a rice bundle sheath cell-specific promoter in promoting the growth of C3 plants, characterized in that: The nucleotide sequence of the promoter is shown in SEQ ID NO. 1, and the C3 plant is rice.

2. The use according to claim 1, characterized in that The promotion of C3 plant growth refers to using the rice bundle sheath cell-specific promoter to activate the upstream molecular process regulatory genes of the plant's sheath cells, so that the "Calvin cycle", the core carbon fixation reaction in the C3 plant, is specifically carried out in the bundle sheath cells, thereby transforming the C3 plant into a C4 plant.

3. The use according to claim 2, characterized in that The upstream molecular process regulatory gene of the sheath cells of the plant is SWEET13 , the nucleotide sequence is shown in SEQ ID NO.2.

Images