SNP variations in the upstream regulatory region of the GhHAI2 gene in upland cotton and their applications

By developing SNP variants in the upstream regulatory region of the GhHAI2 gene in upland cotton, and using PCR amplification and sequencing or gel electrophoresis techniques, the problem of rapid and accurate identification of drought resistance traits in cotton was solved, thus improving breeding efficiency and accuracy.

CN118726374BActive Publication Date: 2026-03-06HUAZHONG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410576313.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-10
Publication Date
2026-03-06
Estimated Expiration
2044-05-10

AI Technical Summary

Technical Problem

The lack of rapid and accurate molecular markers for distinguishing drought resistance traits in cotton has limited the breeding process for molecular marker-assisted screening of new stress-resistant materials.

Method used

SNP variants located in the upstream regulatory region of the GhHAI2 gene in upland cotton were developed. These SNP variants were detected by PCR amplification and sequencing or gel electrophoresis, enabling rapid and accurate identification of cotton drought resistance.

Benefits of technology

This technology enables rapid and accurate differentiation between drought-resistant and drought-sensitive cotton germplasm at the genotype level, improving the accuracy and efficiency of breeding selection and providing a new breeding approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118726374B_ABST
    Figure CN118726374B_ABST
Patent Text Reader

Abstract

This invention relates to the field of molecular biology, and particularly to SNP variations in the upstream regulatory region of the GhHAI2 gene in upland cotton and their applications. This invention discloses an SNP variation located -660 bp upstream of the start codon in the coding region of upland cotton that is closely linked to the comprehensive drought resistance index phenotypic value. Significant differences in phenotypic values ​​are observed between different genotypes; cotton with a C / C homozygous genotype exhibits significantly lower drought resistance than cotton with a T / T homozygous genotype. This invention verifies the high consistency between genotype and phenotype in a population and utilizes this SNP variation molecular marker to provide DNA molecules, primers, kits, and detection methods for identifying drought resistance traits in cotton, enabling rapid, accurate, and reliable differentiation or identification of drought-resistant germplasm at the genotype level.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to SNP variations in the upstream regulatory region of the GhHAI2 gene in upland cotton and their applications. Background Technology

[0002] Cotton is a vital economic crop worldwide, and drought and water scarcity severely impact its yield and fiber quality. Breeding drought-resistant cotton varieties relies on phenotypic selection, but molecular markers for assessing the drought resistance of cotton germplasm resources have been lacking. Therefore, developing molecular markers for drought-resistant functional genes in cotton is crucial for breeding superior drought-resistant cotton varieties. Thus, cultivating drought-resistant cotton varieties to effectively cope with extreme adversity during cotton growth and development is a vital task in current cotton breeding. Simultaneously, utilizing molecular breeding techniques to create new drought-resistant cotton materials can significantly accelerate the breeding process of new drought-resistant cotton varieties.

[0003] SNPs (single nucleotide polymorphisms) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. Utilizing SNPs closely linked to target traits to design specific primers for PCR amplification allows for the identification of drought-resistant phenotypes in crops based on differences in the PCR products, reducing breeding workload and improving breeding efficiency. However, currently, there are relatively few SNP markers available for intuitively and accurately distinguishing differential DNA information among individuals, and further development and enrichment are needed.

[0004] However, current research on molecular markers for important cotton traits mainly focuses on screening markers for yield and its components, fiber quality traits, and resistance to wilt and Verticillium wilt. Research on molecular markers for resistance to abiotic stresses is limited, and there is a lack of molecular markers closely linked to stress-resistance genes, thus restricting the progress of marker-assisted selection for new stress-resistant materials. Therefore, there is an urgent need to develop a novel, rapid, and convenient method for marker-assisted selection breeding related to cotton drought resistance. Summary of the Invention

[0005] In view of this, the present invention proposes an SNP variant located in the upstream regulatory region of the GhHAI2 gene of upland cotton, which is closely linked to the phenotypic value of the comprehensive drought resistance index. The phenotypic values ​​corresponding to different genotypes are significantly different. It can be developed into a molecular marker to quickly, accurately and reliably distinguish or identify drought-resistant germplasm at the genotype level.

[0006] The SNP variant is located at 53156 bp on chromosome D05 of the upland cotton TM-1 reference genome TM-1_HAU-AD1_v1.0 (version Ghirsutum_genome_HAU_v1.0, available from the CottonFGD database at http: / / cotton.hzau.edu.cn / EN / Download.htm), and exhibits a T->C genotype variation compared to the reference genome. The variant site is located in the upstream regulatory region of the GhHAI2 gene, specifically 660 bp upstream of the start codon in the GhHAI2 gene coding region.

[0007] This study demonstrates that the GhHAI2 gene negatively regulates drought resistance in upland cotton. Furthermore, it reveals a significant correlation between SNP variations in the upstream regulatory region of the GhHAI2 gene and the comprehensive drought resistance index phenotypic value. Correlation analysis between genotype and phenotype shows a tight linkage between this SNP variation and the comprehensive drought resistance index phenotypic value. Significant differences in phenotypic values ​​are observed between different genotypes at this locus. Cotton with the C / C homozygous genotype exhibits significantly lower drought resistance than cotton with the T / T homozygous genotype, and the high consistency between genotype and phenotype is verified within the population.

[0008] Therefore, the SNP variation provided by this invention can be used as a molecular marker for the identification and breeding of cotton drought resistance, transforming the differentiation of phenotypes into the judgment of genotypes. Furthermore, by detecting the genotype of this molecular marker, the phenotypic trait of the cotton germplasm to be tested can be predicted rapidly and accurately.

[0009] This invention uses techniques such as PCR amplification to detect the genotype of the molecular marker. Based on the banding changes of PCR products or sequencing results, it can efficiently distinguish between drought-resistant cotton germplasm and drought-sensitive cotton germplasm. It can achieve rapid, accurate, and reliable differentiation or identification of drought-resistant germplasm at the genotype level, without being affected by environmental factors. It can greatly accelerate the breeding process, improve the accuracy of selection in breeding, and increase the efficiency of innovation in drought-resistant cotton germplasm.

[0010] Furthermore, the mutation sites provided by this invention can serve as targets for genetic engineering breeding. By using mutations, editing, or other methods to convert the allele "C" to the allele "T," individuals with the T / T genotype can be screened, while individuals with the C / T and C / C genotypes at that site can be eliminated, thereby progressively increasing the frequency of the T allele at that site. This provides a new, rapid, and effective approach for cotton genetic improvement and is of great significance for the innovation of drought-resistant cotton germplasm.

[0011] Therefore, the present invention provides at least the following technical solutions:

[0012] In a first aspect, the present invention provides a DNA molecule for identifying drought resistance traits in cotton, said DNA molecule comprising a sequence as shown in SEQ ID NO.1 or SEQ ID NO.6.

[0013] In a second aspect, the present invention provides detection primers for detecting the DNA molecule, the detection primers comprising at least one of the following primer sets: (1) upstream primer 1 (sequence as shown in SEQ ID NO.2) and downstream primer 1 (sequence as shown in SEQ ID NO.3), (2) upstream primer 2 (sequence as shown in SEQ ID NO.4) and downstream primer 2 (sequence as shown in SEQ ID NO.5).

[0014] Thirdly, the present invention provides a reagent / kit for detecting the DNA molecule, the components of the reagent / kit comprising at least one of the following: (1) PCR primers for amplifying the DNA molecule; and (2) the detection primers.

[0015] Fourthly, the present invention also provides applications of the said DNA molecule, the said detection primer, or the said reagent / kit, said applications including at least one of the following:

[0016] (1) To identify or assist in identifying the drought resistance of cotton;

[0017] (2) Compare the drought resistance of the cotton samples;

[0018] (3) Select and breed cotton plants, strains, varieties or strains with strong drought resistance;

[0019] (4) Cotton breeding;

[0020] (5) Prepare testing products related to the drought resistance of cotton.

[0021] Fifthly, the present invention provides a method for detecting the aforementioned DNA molecule, the method comprising the following steps:

[0022] S1 was subjected to PCR amplification of the genomic DNA of the cotton sample;

[0023] S2 determines the drought resistance trait of the cotton being tested by sequencing the DNA of the PCR amplification products or by gel electrophoresis. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of variations at different physical locations of the GhHAI2 gene locus;

[0025] Figure 2This is the result of the correlation detection between the comprehensive drought resistance index phenotypic values ​​of three variations on chromosome D05 in the upstream regulatory region of GhHAI2 in Example 517 natural populations. * indicates p<0.05. The horizontal axis represents different genotypes, and the vertical axis represents the comprehensive drought resistance index. Among them: Figure a shows the correlation between the two homozygous genotypes 2I and TT at 53119bp and the comprehensive drought resistance index phenotypic value (where 2I represents the TTC / TTC homozygous genotype, and TT represents the T / T homozygous genotype); Figure b shows the correlation between the two homozygous genotypes CC and TT at 53156bp and the comprehensive drought resistance index phenotypic value; Figure c shows the correlation between the two homozygous genotypes TT and CC at 53636bp and the comprehensive drought resistance index phenotypic value (TT represents the T / T homozygous genotype, and CC represents the C / C homozygous genotype).

[0026] Figure 3 The sequencing peak diagrams are obtained by sequencing the PCR products amplified by the primers shown in SEQ ID NO.2 and SEQ ID NO.3 for Wankangmian 9 and Junmian 1. Figure a shows the genotype information and sequencing peak diagram of Wankangmian 9 at 53156bp, and Figure b shows the genotype information and sequencing peak diagram of Junmian 1 at 53156bp.

[0027] Figure 4 The images are gel electrophoresis diagrams of PCR products amplified from natural cotton germplasm populations using the primer pairs shown in SEQ ID NO.4 and SEQ ID NO.5. * indicates materials with insignificant or nonspecific amplification. Figure a shows drought-resistant cotton germplasm materials, and Figure b shows drought-sensitive cotton germplasm materials. Detailed Implementation

[0028] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0029] In this invention, the term "SNP variant" is equivalent to the term "SNP site," and the two can be used interchangeably.

[0030] This invention reveals that SNP variations in the upstream regulatory region of the GhHAI2 gene are significantly correlated with the phenotypic value of the comprehensive drought resistance index. The SNP variation is located at 50625 bp on chromosome D05 of the upland cotton reference genome (Ghirsutum_genome_HAU_v1.0), and this SNP variation exhibits a T->C genotypic variation compared to the upland cotton reference genome.

[0031] Correlation analysis between genotype and phenotype revealed a close linkage between the SNP variations and the phenotypic value of the comprehensive drought resistance index. Significant differences were found in the phenotypic values ​​corresponding to different genotypes at the SNP loci, with cotton genotypes of C / C homozygous exhibiting significantly lower drought resistance than cotton genotypes of T / T homozygous.

[0032] In view of this, the present invention provides at least the following technical solutions:

[0033] In a first aspect, the present invention provides a DNA molecule for identifying drought resistance traits in cotton, said DNA molecule comprising a sequence as shown in SEQ ID NO.1 or SEQ ID NO.6.

[0034] Furthermore, the DNA molecule includes an SNP site for identifying the drought resistance trait of cotton, the SNP site being located at the 311th base from the 5' end of the sequence shown in SEQ ID NO.1, or at the 18th base from the 5' end of the sequence shown in SEQ ID NO.6;

[0035] The alleles of the bases at the SNP sites are T or C, where the T / T homozygous genotype corresponds to drought-resistant cotton germplasm, and the C / C homozygous genotype corresponds to drought-sensitive cotton germplasm.

[0036] The SNP site is located in the upstream regulatory region of the GhHAI2 gene, specifically 660 bp upstream of the start codon in the coding region of the GhHAI2 gene.

[0037] In a second aspect, the present invention provides detection primers for detecting the DNA molecule, the detection primers comprising at least one of the following primer sets: (1) upstream primer 1 (sequence as shown in SEQ ID NO.2) and downstream primer 1 (sequence as shown in SEQ ID NO.3), (2) upstream primer 2 (sequence as shown in SEQ ID NO.4) and downstream primer 2 (sequence as shown in SEQ ID NO.5).

[0038] Thirdly, the present invention provides a reagent / kit for detecting the DNA molecule, the components of the reagent / kit comprising at least one of the following: (1) PCR primers for amplifying the DNA molecule; and (2) the detection primers.

[0039] In some preferred embodiments, the reagent / kit components further include: Taq DNA polymerase, dNTPs, and buffer reagents.

[0040] Fourthly, the present invention also provides applications of the said DNA molecule, the said detection primer, or the said reagent / kit, said applications including at least one of the following:

[0041] (1) To identify or assist in identifying the drought resistance of cotton;

[0042] (2) Compare the drought resistance of the cotton samples;

[0043] (3) Select and breed cotton plants, strains, varieties or strains with strong drought resistance;

[0044] (4) Cotton breeding;

[0045] (5) Prepare testing products related to the drought resistance of cotton.

[0046] Fifthly, the present invention provides a method for detecting the aforementioned DNA molecule, the method comprising the following steps:

[0047] S1 was subjected to PCR amplification of the genomic DNA of the cotton sample;

[0048] S2 determines the drought resistance trait of the cotton being tested by sequencing the DNA of the PCR amplification products or by gel electrophoresis.

[0049] In some preferred embodiments, in step S1,

[0050] The PCR amplification reaction system includes: 1 μL DNA template, 0.2 μL upstream primer, 0.2 μL downstream primer, 2 μL 10× Buffer, 0.4 μL dNTP mix, 0.2 μL Taq enzyme, and 16 μL ddH2O.

[0051] In some preferred embodiments,

[0052] In step S1: the primers for PCR amplification include upstream primer 1 (sequence shown in SEQ ID NO.2) and downstream primer 1 (sequence shown in SEQ ID NO.3); the reaction conditions for PCR amplification include: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 20 s, 30 cycles; 72℃ extension for 30 s.

[0053] In step S2: based on the sequencing results of the PCR amplification products, if the base at the SNP site of the cotton sample is T, the cotton germplasm is drought-resistant; if the base at the SNP site is C, the cotton germplasm is drought-sensitive. In some preferred embodiments,

[0054] In step S1: the primers for PCR amplification include upstream primer 2 (as shown in SEQ ID NO.4) and downstream primer 2 (as shown in SEQ ID NO.5); the reaction conditions for PCR amplification include: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 20 s, 30 cycles; 72℃ extension for 30 s.

[0055] In step S2: the results of gel electrophoresis of the PCR amplification products are used to determine whether the cotton germplasm to be tested is drought-resistant when the PCR amplification product can amplify a 585bp band, or when the band cannot be specifically amplified or the amplified band does not contain a 585bp band, the cotton germplasm to be tested is drought-sensitive.

[0056] Experimental methods not specified in this invention are generally performed under conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0057] The cotton germplasm used in this invention was selected from a natural population containing 517 upland cotton germplasm resources collected by our research group. The original source was introduced from abroad. The public can obtain the relevant germplasm resources from the applicant (Table 1 shows the information of the upland cotton germplasm resources used in this invention). It can only be used to repeat the experiments of this invention and may not be used for other purposes. The relevant research on the 517 upland cotton natural population germplasm resources has been published in the literature "Li B, Tian Q, Wang X, Han B, Liu L, Kong X, Si A, Wang J, Lin Z, Zhang X, Yu Y, Yang X. Phenotypic plasticity and genetic variation of cotton yield and its related traits under water-limited conditions. Crop J, 2020, 8(6): 966-976" and "Li Baoqi, Analysis of the genetic basis of cotton response to drought based on field phenotype and phenotypic platform image indicators, 2020".

[0058] Table 1 Information on cotton germplasm resources used in this invention

[0059]

[0060]

[0061] This invention utilizes the Comprehensive Index of Drought Tolerance (CIDT) to assess the overall drought resistance of cotton. The calculation formula is as follows:

[0062] CIDT = DRC(LP+LW+YPH+FSBN) / (GP+SW+FL+FS+FE+PH+FFSH+FFSBN+EBN), where DRC value is the ratio of the phenotypic value of the drought treatment to that of the control group. Each trait corresponds to its own DRC value. The population average values ​​of lint percentage (LP), lint index (LW), seed cotton yield per hectare (YPH), and number of fruiting branches (FSBN) were significantly increased under water restriction conditions (p<0.001). The population average values ​​of growth period (GP), seed index (SW), fiber length (FL), fiber strength (FS), fiber elongation (FE), plant height (PH), fruiting branch first node height (FFSH), fruiting branch first node position (FFSBN), and effective boll number per plant (EBN) were significantly decreased under water restriction conditions (p<0.001). Related studies were also published in the above article.

[0063] (I) Screening SNP variations in the upstream regulatory region of GhHAI2 as molecular markers for identifying drought resistance traits in cotton.

[0064] In their previous research, the inventors discovered that the GhHAI2 gene in upland cotton negatively regulates drought resistance in upland cotton (Liu Z, Zhang M, Wang L, Sun W, Li M, Feng C, Yang X. Genome-wide identification and expression analysis of PYL family genes and functional characterization of GhPYL8D2 under drought stress in Gossypium hirsutum. Plant Physiol Biochem, 2023, 203:108072).

[0065] Based on this, the inventors used the upstream regulatory region of the GhHAI2 gene as the research object, constructed a natural variation map of upland cotton, and retrieved the variation information of the GhHAI2 gene locus from it. They then conducted candidate gene association analysis using the Comprehensive Drought Resistance Index (CIDT) phenotypic value.

[0066] The specific experimental steps and results are as follows:

[0067] 1.1 Experimental Procedure

[0068] (1) A natural variation map of upland cotton was constructed using 517 publicly published upland cotton resequencing data (the original resequencing data was released in the SRA database of NCBI, project number PRJNA556955). Variation information between 50625bp and 54996bp was obtained from the natural variation map, that is, the variation information between 50625bp and 54996bp of chromosome D05 was extracted from the vcf files of the resequencing genotypes of the 517 cotton germplasm natural populations.

[0069] (2) The 517 cotton varieties were grouped according to different genotypes and haplotype analysis was performed. The group t-test of the comprehensive drought resistance index phenotypic value was calculated. The p-value is the correlation between the variation and the phenotype after the t-test. The significance threshold is less than 0.05.

[0070] 1.2 Experimental Results

[0071] Three variants in the upstream regulatory region were found at the GhHAI2 locus, including one Indel variant and two SNP variants. All three variants were significantly correlated with the comprehensive drought resistance index phenotypic value. Results are shown below. Figure 1 , Figure 2 And Table 2.

[0072] Table 2 Summary of variation information at the GhHAI2 locus in natural populations of upland cotton

[0073]

[0074] like Figure 1 , 2 As shown in Table 2, all three variations in the upstream regulatory region of GhHAI2 were significantly correlated with the phenotypic value of the comprehensive drought resistance index.

[0075] Note: The meanings of each column in Table 2 are as follows: Type: variant type; Pos: physical location in the genome; Ref: reference genotype; Alt: variant genotype; Dist to ATG: physical distance from the start codon, negative values ​​indicate the upstream regulatory region of the start codon; CIDT_p: p-value of the T-test for the combined drought resistance index (CIDT) of the two genotypes.

[0076] Regulatory regions play a relatively more important role in gene expression changes, and association analysis also shows that SNP variations in regulatory regions, such as T->C (e.g., ...), are more significant. Figure 2 A significant correlation was found between the phenotype and the SNP variant T->C (p = 0.04178). This invention selected the SNP variant T->C as the basis for the development of PCR markers.

[0077] The results of genotyping of 517 cotton varieties showed that heterozygous genotypes accounted for only 8 of the 517 samples, or about 1.55%. From a statistical point of view, the impact of these heterozygous genotypes on the overall sample is negligible and will not have a significant impact on the results.

[0078] like Figure 2 As shown in b, the phenotypic values ​​corresponding to different genotypes are significantly different, and the C / C homozygous genotype significantly reduces the drought resistance of cotton.

[0079] This invention also selected a DNA molecule containing the upstream regulatory region of the GhHAI2 gene with the SNP site. The nucleotide sequence (5'-3') of the DNA molecule is shown in SEQ ID NO.1, and the SNP site is specifically located at the 311th base from the 5' end of the sequence shown in SEQ ID NO.1. In the genome, this SNP variation is located at 53156 bp on chromosome D05 of the upland cotton TM-1 reference genome "TM-1_HAU-AD1_v1.0 (version Ghirsutum_genome_HAU_v1.0, which can be openly obtained from the CottonFGD database at http: / / cotton.hzau.edu.cn / EN / Download.htm)," and exhibits a T->C genotype variation compared to the reference genome.

[0080] (II) The application of the DNA molecule for identifying drought resistance traits in cotton and its detection method and detection primers provided by this invention. use

[0081] This invention provides two sets of primers, an upstream primer and a downstream primer, and the nucleotide sequences (5'-3') of the PCR products amplified by the two sets of primers are shown below:

[0082] Upstream primer 1: GTCCAGCAGAATCCAGTTTGT (see SEQ ID NO.2);

[0083] Downstream primer 1: GAAATCAACGCAAAATCGAAT (see SEQ ID NO.3);

[0084] The sequence (5'-3') corresponding to the 846bp banded product amplified using the PCR primer pair consisting of upstream primer 1 and downstream primer 1 is shown in SEQ ID NO.1.

[0085] (See SEQ ID NO.1), where the SNP site is shown at base 311 (shaded area).

[0086] Upstream primer 2: TTGATTGGCCCACGACAT (see SEQ ID NO.4);

[0087] Downstream primer 2: AAAAGAAAAAAAAATAGAACCAAAG (see SEQ ID NO. 5);

[0088] The sequence (5'-3') corresponding to the 585bp banded product amplified using the PCR primer pair consisting of upstream primer 2 and downstream primer 2 is shown in SEQ ID NO. 6.

[0089] (See SEQ ID NO.6), where the 18th base (shaded area) shows the SNP site.

[0090] Example 1

[0091] In this embodiment, genomic DNA was first extracted from Wankangmian 9 and Junmian 1 materials. Then, using these as templates, PCR amplification was performed using upstream primer 1 and downstream primer 1. The PCR amplification products were then subjected to Sanger sequencing to confirm whether the genotype information of Wankangmian 9 and Junmian 1 at 53156bp on chromosome D05 could distinguish between drought-resistant cotton germplasm and drought-sensitive cotton germplasm.

[0092] The specific experimental steps and results are as follows:

[0093] 2.1 Experimental Procedure

[0094] (1) Genomic DNA extraction: Genomic DNA was extracted from Wankangmian 9 and Junmian 1 using the CTAB method.

[0095] Place 100 mg of fresh cotton leaves in a 2 mL centrifuge tube, add a clean steel ball and 200 μL of extraction buffer, and grind on a sample grinder (Shanghai Jingxin #Tissuelyser-192) for 60 s at a frequency of 60 Hz. After grinding, add 800 μL of LTAB lysis buffer and lyse in a 65℃ water bath for 30 min. Add 800 μL of chloroform to the lysed sample and mix thoroughly for 5 min to remove pigments and other impurities. Centrifuge at 12000 rpm for 10 min, transfer the supernatant and mix with an equal volume of -20℃ pre-cooled isopropanol, incubate at -20℃ for 2 h, centrifuge at 12000 rpm for 1 min, and discard the supernatant. Add 1 mL of 75% ethanol to the precipitate and wash twice for 10 min each time. Centrifuge and discard the supernatant after each wash. Allow the precipitate to air dry at room temperature and dissolve the DNA in ddH2O.

[0096] The extraction buffer consisted of 0.35M glucose, 0.1M Tris-HCl, 5mmol / L Na2EDTA, 2% (w / v) PVP K-30 and 0.1% (w / v) DIECA, with a pH of 7.5. 0.2% β-mercaptoethanol was added before use.

[0097] The CTAB lysis buffer consisted of 0.1M Tris-HCl, 1.4M NaCl, 0.02M Na2EDTA, 2% CTAB, 2% (w / v) PVP K-30 and 0.1% (w / v) DIECA, with a pH of 8.0.

[0098] (2) PCR amplification: Take 75-100 ng of genomic DNA as a template for PCR amplification. Prepare the PCR amplification system according to the formula in Table 3, and perform PCR amplification according to the procedure in Table 4.

[0099] Table 3 PCR amplification system

[0100]

[0101] Table 4 PCR Amplification Program

[0102]

[0103] (3) Sanger sequencing: The PCR amplification products were sent to the company for Sanger sequencing. The sequencing results are shown in SEQ ID NO.1.

[0104] 2.2 Experimental Results

[0105] like Figure 3 As shown, comparison of sequencing peaks confirmed that the genotype of Wankangmian 9 at the 53156bp physical position is T (drought-resistant genotype); the genotype of Junmian 1 at the 53156bp physical position is C (drought-sensitive genotype). Based on the information of the upland cotton natural variation map material and its corresponding genotype information constructed in experimental step 1.1, Wankangmian 9 is a typical drought-resistant germplasm with genotype "T", and Junmian 1 is a drought-sensitive germplasm with genotype "C". The sequencing results are consistent with these findings. Therefore, the DNA molecule with the sequence shown in SEQ ID NO.1, its detection method, upstream primer 1, and downstream primer 1 provided by this invention can be used to distinguish between drought-resistant and drought-sensitive cotton germplasm, and can be applied in fields such as assisted selection breeding and the cultivation of new cotton germplasm resources.

[0106] Example 2

[0107] In this embodiment, 24 samples each of drought-resistant and drought-sensitive materials were selected, genomic DNA was extracted, and PCR amplification was performed using a PCR primer pair consisting of upstream primer 2 and downstream primer 2. Chi-square test was used to determine whether there was a significant difference in the amplification results between drought-resistant and drought-sensitive materials, thereby confirming whether the presence or absence of amplification bands was significantly correlated with drought resistance and sensitivity phenotypic traits.

[0108] The specific experimental steps and results are as follows:

[0109] 3.1 Experimental Procedure

[0110] (1) Genomic DNA extraction: Genomic DNA was extracted from the selected materials using the CTAB method.

[0111] The specific operation is the same as step (1) in 2.1.

[0112] (2) PCR amplification: Use 75-100 ng of genomic DNA as a template for PCR amplification. Prepare the PCR amplification system according to the formula in Table 3, and perform PCR amplification according to the procedure in Table 5. (The only difference between Table 5 and Table 4 is the annealing temperature.)

[0113] Table 5 PCR amplification program

[0114]

[0115] (3) Gel electrophoresis: The amplified PCR products were subjected to gel electrophoresis.

[0116] 3.2 Experimental Results

[0117] like Figure 4 As shown, molecular marker amplification is performed using a PCR primer pair consisting of upstream primer 2 and downstream primer 2. The presence or absence of a PCR amplification band can conveniently determine whether the molecular marker is present. Specifically, when a PCR product band of 585 bp can be specifically amplified, the tested cotton germplasm is drought-resistant; when a band cannot be specifically amplified or the amplified band does not contain the 585 bp band, the tested cotton germplasm is drought-sensitive. This method of presenting results is convenient and intuitive.

[0118] Among drought-resistant germplasm, 21 materials showed amplified bands, while 3 materials did not show obvious specific bands. Among drought-sensitive germplasm, 22 materials did not show obvious specific bands, while 2 materials showed the target band. Chi-square analysis revealed a significant difference in amplification results between drought-resistant and drought-sensitive materials (p=4.02857E-08), indicating a significant correlation between the presence or absence of amplified bands and drought resistance and sensitivity phenotypic traits. Therefore, the DNA molecule with the sequence shown in SEQ ID NO.6, its detection method, upstream primer 2, and downstream primer 2 provided by this invention can be used to distinguish between drought-resistant and drought-sensitive cotton germplasm, and can be applied in fields such as assisted selection breeding and the cultivation of new cotton germplasm resources.

[0119] In summary, the DNA molecule (sequence shown in SEQ ID NO.1 or SEQ ID NO.6), its detection method, and the two primer pairs provided by this invention can all be used to identify drought resistance in cotton. When the SNP site in the cotton material being tested is detected as "T", it is a drought-resistant germplasm; when the SNP site in the cotton material being tested is detected as "C", it is a drought-sensitive germplasm. This transforms phenotypic judgment into genotypic identification, enabling rapid identification or screening of drought-resistant germplasm at the genotypic level. Furthermore, the PCR detection primers developed in this embodiment amplify the SNP variations, resulting in good genotyping effects and providing a convenient method for screening drought-resistant cotton materials.

[0120] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of a SNP molecular marker in identifying Gossypium hirsutum drought-resistant germplasm, characterized in that, The SNP molecular marker is located at 53156bp of D05 chromosome of Gossypium hirsutum, and the nucleotide is T / C; the nucleotide type of the SNP molecular marker in the drought-resistant germplasm of Gossypium hirsutum is T; and the reference genome is TM-1_HAU-AD1_v1.

0.

2. Use according to claim 1, characterized in that, The application comprises at least one of the following applications: (1) identifying or assisting in identifying drought resistance of Gossypium hirsutum; (2) comparing drought resistance of Gossypium hirsutum to be tested; (3) breeding Gossypium hirsutum single plant, strain, line or variety with stronger drought resistance; (4) Gossypium hirsutum breeding; (5) preparing a detection product related to drought resistance of Gossypium hirsutum.

3. A method of identifying drought resistant germplasm in Gossypium hirsutum, comprising, The method comprises at least one of the following: A. using primers with sequences shown in SEQ ID NO. 2-3 to perform PCR amplification on genomic DNA of Gossypium hirsutum to be tested, detecting the nucleotide type of the SNP molecular marker located at 53156bp of D05 chromosome of Gossypium hirsutum, and the reference genome is TM-1_HAU-AD1_v1.0; when the nucleotide type of the SNP molecular marker is T, the Gossypium hirsutum germplasm to be tested is drought-resistant, and when the nucleotide type of the SNP molecular marker is C, the Gossypium hirsutum germplasm to be tested is drought-sensitive; B. using primers with sequences shown in SEQ ID NO. 4-5 to perform PCR amplification on genomic DNA of Gossypium hirsutum to be tested; by judging the results of gel electrophoresis of the PCR amplification product, when the PCR amplification product can amplify a 585bp band type, the Gossypium hirsutum germplasm to be tested is drought-resistant, and when no band can be specifically amplified or the amplified band type does not contain the 585bp band type, the Gossypium hirsutum germplasm to be tested is drought-sensitive.

Citation Information

Patent Citations

  • InDel molecular marker related to cotton drought resistance and application thereof

    CN112981000A