A method for creating a crack-resistant pod rape

Abstract

The application belongs to the field of genetic engineering, and particularly relates to a method for creating anti-split-pod rape. The application edits the IND gene of rape by using the CRISPR / Cas9 gene editing technology, and breeds the obtained gene editing material, to obtain an anti-split-pod germplasm P29-SA3. The germplasm can be used to create a new anti-split-pod rape variety.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering, and particularly relates to a method for creating anti-split-pod rapeseed. BACKGROUND

[0002] Rape is the most important oil crop in China, providing about 55% of domestic vegetable oil, and also making important contributions to animal feed protein and biofuel. In recent years, the planting area of rape in China has shown a downward trend, and the dependence on external oil and protein is high. Under the complex international situation, stable production and supply face great challenges. Split pod (or split angle, or silique dehiscence) is the main bottleneck in rape production, which is not conducive to mechanized harvesting. Early harvesting will lead to a decrease in oil quality and yield. Late harvesting or "timely harvesting" results in a yield loss of 20% to 50% due to split pod. The dropped seeds can survive in the soil for several years, becoming weeds in the next crop. Developing anti-split-pod varieties suitable for mechanized harvesting can not only reduce yield loss, but also increase the range of harvesting time options and reduce the occurrence of volunteer rape in the next crop, which meets the needs of rape production.

[0003] Mutation of the BnIND gene in rape can produce silique with significantly increased resistance to split angle. The BnIND gene has great application potential and prospect for improving the dehiscence trait of rape silique. The present application uses the CRISPR / Cas9 system to mutate the BnIND gene related to the split pod trait of rape, to obtain plants with no residual vector sequence, single editing, excellent anti-split-pod trait, no off-target or clear off-target without affecting yield and agronomic traits, for rapid breeding of anti-split-pod, machine-harvesting, and high-yield rape varieties. SUMMARY

[0004] The purpose of the present application is to provide a method for creating anti-split-pod rape.

[0005] To achieve the above purpose, the present application adopts the following technical solutions:

[0006] The present application provides a mutant gene, characterized in that the sequence of the mutant gene is shown in SEQ ID NO. 5 or SEQ ID NO. 7.

[0007] The present application also provides a mutant protein, characterized in that the sequence of the mutant protein is shown in SEQ ID NO. 6 or SEQ ID NO. 8.

[0008] The present application also provides a method for breeding anti-split-pod rape, characterized in that the gene with the sequence shown in SEQ ID NO. 1 and SEQ ID NO. 3 in the rape to be improved is replaced by the gene with the sequence shown in SEQ ID NO. 5 and SEQ ID NO. 7, and the rape plant with significantly enhanced anti-split-pod ability is selected.

[0009] In some embodiments, the method of gene replacement described above comprises any one of the following:

[0010] (1) Using Brassica napus containing the sequence of SEQ ID NO. 5 and SEQ ID NO. 7 as a donor, the sequence of SEQ ID NO. 5 and SEQ ID NO. 7 is introduced into Brassica napus containing the sequence of SEQ ID NO. 1 and SEQ ID NO. 3 by sexual crossing, until the sequence of SEQ ID NO. 5 and SEQ ID NO. 7 completely replaces the sequence of SEQ ID NO. 1 and SEQ ID NO. 3.

[0011] (2) Using genetic engineering means, the sequence of SEQ ID NO. 1 and SEQ ID NO. 3 in the improved Brassica napus is targeted to modify the sequence of SEQ ID NO. 5 and SEQ ID NO. 7.

[0012] In some embodiments, the donor Brassica napus described above is from the seed with the accession number CCTCC NO: P202414.

[0013] The application also provides the use of the mutant gene described above, or the mutant protein described above, or the method described above in creating anti-cracked kernel Brassica napus.

[0014] The Brassica napus seed provided by the application is preserved in the China Center for Type Culture Collection (address: No. 299, Bayi Road, Wuchang District, Wuhan, Hubei Province), and the culture name and the identified characteristics are as follows: Brassica napus seed P29-SA3, Brassica napus, accession number CCTCC NO: P202414, preservation date 2024.5.30.

[0015] The innovation and beneficial effects of the application are as follows: the application edits the IND gene of Brassica napus, and through genotype identification, anti-cracked kernel analysis, agronomic trait identification, off-target and vector sequence residue analysis, an edited Brassica napus P29-SA3 with sufficient anti-cracked kernel ability and excellent comprehensive agronomic trait performance is screened out. The mutant gene of the Brassica napus can be used to cultivate a new type of anti-cracked kernel Brassica napus variety. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 Structure diagram of two copies of BnIND gene and schematic diagram of target site. The arrow indicates the target point and direction.

[0017] Figure 2 Schematic diagram of T-DNA region structure of editing vector.

[0018] Figure 3Editing plant vector sequence remnant. A: SRI calculation of random impact experiment; B: Seed exposure rate of random impact experiment; C: Fracture force test; D: Linear regression analysis of SRI and fracture force.

[0019] Figure 4 Anti-rupture angle test silique morphology. A: Silique morphology of random impact experiment; B: Silique morphology of fracture force test.

[0020] Figure 5 Off-target site analysis results.

[0021] Figure 6 Vector sequence remnant analysis results. DETAILED DESCRIPTION

[0022] The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise defined, terms are to be understood according to their common use by those of ordinary skill in the art. All patents, publications, scientific articles, and other public publications, and the like, cited herein are incorporated by reference in their entirety.

[0023] As used herein, "canola" is any canola plant and includes all plant parts, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which canola plants can be regenerated, plant calli, plant cell clumps, plant cells that are intact plants or plant parts such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, roots, root tips, anthers, and the like. Nucleic acids are written left to right in 5' to 3' orientation, unless otherwise indicated; amino acid sequences are written left to right in amino to carboxyl orientation, unless otherwise indicated. The amino acids can be represented by either their commonly accepted single-letter codes or IUPAC-IUB Biochemical Nomenclature Commission recommended three-letter codes. Likewise, nucleotides can be represented by the commonly accepted single-letter codes. Numerical ranges are inclusive of the numbers defining the range. As used herein, "nucleic acid" includes polynucleosides of deoxyribonucleotides or ribonucleotides in either single- or double-stranded form, and unless otherwise limited, includes known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" with reference to a specified nucleic acid indicates that the nucleic acid includes a nucleotide sequence, which contributes to the translation of the nucleotide sequence into a specific protein. The contribution of the nucleotide sequence is in the form of a code, which is in turn translated into a specific protein using the genetic code. As used herein, "full-length sequence" with reference to a particular polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having the native (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein. The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used to refer to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acids. The term is also used to refer to naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively "protein"). The amino acid can be a naturally occurring amino acid and, unless otherwise limited, can include known analogs of naturally occurring amino acids that can function in a manner similar to the naturally occurring amino acid.

[0024] As used herein, the terms "isolated" and "purified" are used interchangeably to refer to a nucleic acid or polypeptide, or biologically active portion thereof, that is substantially or essentially free from components, which naturally accompany or potentially accompany the nucleic acid or polypeptide as found in its natural environment. Thus, an isolated or purified nucleic acid or polypeptide produced by recombinant techniques is substantially free of other cellular material or culture medium when produced by recombinant techniques, or is substantially free of chemical precursors or other chemicals when chemically synthesized. An "isolated" nucleic acid is generally free from sequences (such as protein encoding sequences) that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid can comprise less than about 0.5 kb of nucleotide sequences that naturally flank the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

[0025] In this application, the words "comprise," "comprises," or "comprising" are to be interpreted as including the elements, numbers or steps described and any additional elements, numbers or steps. A "subject plant" or "subject plant cell" refers to a plant or plant cell in which a genetic modification has taken effect, or a progeny cell of such a modified plant or cell that comprises the modification. A "control" or "control plant" or "control plant cell" provides a reference point for measuring a phenotypic change in a subject plant or plant cell. A control plant or plant cell can include, for example: (a) a wild-type plant or cell, i.e., a plant or cell of the same genotype as the starting material for a genetic modification that produced the subject plant or cell; (b) a plant or plant cell of the same genotype as the starting material but that has been transformed with an empty construct, i.e., a construct that has no known effect on the trait of interest, such as a construct comprising a marker gene; (c) a plant or plant cell that is a non-transformed segregant of the subject plant or plant cell; (d) a plant or plant cell that is genetically identical to the subject plant or plant cell but that has not been exposed to a condition or stimulus that induces expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.

[0026] Those skilled in the art will readily recognize, for example, that advances in the field of molecular biology, such as site-specific mutagenesis and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of appropriate tools and procedural steps for modifying or engineering the amino acid sequence and potentially the genetic sequence of a protein of interest in agriculture.

[0027] In some embodiments, alterations can be made to the nucleotide sequences of the application to make conservative amino acid substitutions. Principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, alterations can be made to the nucleotide sequences of the application that do not change the amino acid sequence, e.g., the codons encoding the same amino acid sequence can be replaced with monocot plant preferred codons, without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, portions of the nucleotide sequences in the application are replaced with different codons that encode the same amino acid sequence, thereby changing the nucleotide sequence while not changing the amino acid sequence it encodes. Conservative variants include those sequences that encode the same amino acid sequence of a protein of the embodiments due to the degeneracy of the genetic code. In some embodiments, portions of the nucleotide sequences in the application are replaced according to monocot plant preferred codons. Those of skill in the art will recognize that amino acid additions and / or substitutions generally are based on the relative similarity of the amino acid side chains, for example, as is shown by the hydrophobic, charged, size, and other properties of the amino acids. Exemplary amino acid substitution groups that take various of the foregoing properties into consideration are well-known in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance in appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C), incorporated herein by reference. Conservative substitutions can be made, such as replacing one amino acid with another having similar properties. Identification of sequence identity includes hybridization techniques. For example, all or a portion of a known nucleotide sequence is used as a probe to selectively hybridize to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments from a selected organism (i.e., a genomic or cDNA library).

[0028] In some embodiments, fragments of the nucleotide sequences and the amino acid sequences they encode are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide or a portion of the amino acid sequence of a polypeptide of the embodiments. Fragments of the nucleotide sequence can encode protein fragments that retain the biological activity of the native or corresponding full-length protein and thus have the protein activity. Mutant proteins include biologically active fragments of the native protein that comprise contiguous amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants comprising at least one nucleotide sequence of the embodiments. In some embodiments, plants are transformed using an expression vector comprising at least one nucleotide sequence of the embodiments operably linked to a promoter that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants that comprise a heterologous polynucleotide within the genome. Generally, the heterologous polynucleotide is stably integrated within the genome of the transformed plant cell or transgenic plant such that the polynucleotide is passed to the progeny. The heterologous polynucleotide can be integrated into the genome either alone or as part of an expression vector. In some embodiments, plants contemplated by the present application include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, fruits, ears, kernels, husks, cobs, roots, root tips, anthers, and the like. The present application also includes plant cells, protoplasts, tissues, calli, embryos, and flowers, tassels, ears, grain, and other plant reproductive materials that are produced by, or are derived from, a transgenic plant or its progeny, and thus contain the nucleotide sequences of the present application in at least one of their cells.

[0029] The following examples are intended to illustrate the present application and are not intended to limit the scope of the application. Modifications or substitutions of the methods, steps or conditions of the present application are considered to be within the scope of the present application without departing from the spirit and scope of the present application. Unless otherwise specified, the examples were performed according to conventional experimental conditions, such as those described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2001) or according to the conditions suggested by the manufacturer. Unless otherwise specified, the chemical reagents used in the examples were conventional commercially available reagents and the technical means used in the examples were conventional means known to those skilled in the art.

[0030] Example

[0031] Example 1B Editing of the BnIND gene

[0032] The inventors edited BnIND gene using CRISPR-Cas9 method, since the gene has two copies in the genome of Brassica napus: BnA03.IND (BnaA03g27180D, nucleotide and amino acid sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively) and BnC03.IND (BnaC03g32180D, nucleotide and amino acid sequences are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively). The present application selected two target sites (Target 1 and Target 2) shared by BnA03.IND and BnC03.IND, designed and constructed CRISPR-Cas9 gene editing vector (schematic diagram of target sites is shown in Figure 1 ). Among them, Target 1 (CCGTTCCTAAGCCGAACCGC) is located upstream of the bHLH domain, and Target 2 (TTGAAGAGGATGGTGCCAGG) is located in the bHLH domain, and the distance between the two target sites is 81 bp.

[0033] The construction process of the editing vector is as follows: according to the target site, design PCR amplification primers, after synthesis of primers, use PGTR plasmid as template for amplification, and construct the PCR product to the final CRISPR expression vector PV58-K by homologous recombination. Positive clones are screened by colony PCR. The positive clone detection reaction system is as follows:

[0034]

[0035] The PCR reaction system is as follows:

[0036]

[0037]

[0038] After selecting positive clones for sequencing, and the sequence is correct, genetic transformation is carried out by Agrobacterium mediation. The editing vector includes SgRNA expression frame driven by U6 promoter and Cas9 expression frame driven by 35S promoter (schematic diagram of T-DNA vector is shown in Figure 2 ).

[0039] Obtaining of Brassica napus editing plants: using Agrobacterium transformation method to transform the constructed vector into Brassica napus Westar, after seed germination, infection, co-culture, induction of callus, differentiation, rooting and other genetic transformation operations, 35 E0 generation single plants (named P1-P35) are obtained.

[0040] The above gene editing vector and Brassica napus transformation method are conventional experimental operations in the art.

[0041] Example 2 Identification and screening of edited plants

[0042] P1-P35 were sequenced directly and library construction by PCR amplification product. There were 31 strains of target genes with heterozygous, homozygous and chimeric mutations. Through the identification of anti-split pod traits, P18, P29 and P31 were selected for self-pollination to obtain E1 generation. The presence of gene editing tools in the genome of Brassica napus was detected (detection primers CAS9-F gttcgggaatctcattgcgc, CAS9-R ctcctcaggatagcgtgcag, product size 564bp), and the positive control band size was consistent with the expected size, and no amplification product was considered to have separated the gene editing tool. Seven single plants of Brassica napus without gene editing tools were screened, P18-S1, P18-S2, P18-H15, P29-B12, P29-SA3, P29-SC4, P31-G8. Further confirmed by one generation sequencing and second generation sequencing, BnA03.IND and BnC03.IND genes both occurred homozygous mutation.

[0043] The above seven single plants of Brassica napus without residual vector sequences were further determined for anti-split angle ability. Two methods were used: anti-split angle coefficient determination method and S-type high-precision pressure sensor method.

[0044] The steps of anti-split angle coefficient determination method are as follows: select edited plants with clear editing and wild type Westar pods that lack the development of cracking area, when all the silique stops growing and starts to turn yellow, cover all the pods with nylon mesh to prevent the pods from falling during harvesting, observe the silique after it turns completely yellow and continue to dry in the greenhouse for two weeks, incubate them at 25℃ and 50% relative humidity for 2 weeks to ensure water balance of the experimental materials. Replace the random impactor with a shaker, put 15 intact silique (similar size to Westar) and 11 steel balls (diameter 14mm) from each plant into a plastic container with thick side wall (inner diameter 13cm, height 14cm), shake at 285rpm on the shaker (Peiyin THZ-C, amplitude 26mm) for 1min 15s / time, a total of 5 times, with 3 replicates for each sample. After each shaking, count the number of cracked pods and exposed seeds, and remove the damaged or cracked pods and exposed seeds from the container, observe the cracking of the silique and record continuously (the cracking of the silique wall or the visible rapeseed is the standard for cracking of the silique). Calculate the anti-split pod index (SRI) according to the formula: Where i represents the number of times, Xi represents the number of cracked pods in the ith time. The results of each material are shown in Table 1.

[0045] Table 1 Anti-split angle coefficient of E1 generation plants

[0046]

[0047] S-type high-precision pressure sensor method steps as follows: first, the instrument is calibrated with 1 kg weight, unit N, the number of decimal places accurate to 2. The value displayed on the pressure sensor changes quickly, the speed of pressing as slow as possible. According to the random collision experiment, the silique in the cracking zone is easy to crack from the top. When pressure test, select the relatively weak part (1 / 3 of the top of the pod) to place on the pressure sensor, gently press the silique to break with fingers, read the display at the same time, take 15 silique readings from each plant to get the average value, calculate the multiple of the gene editing plant compared with wild type Westar. The determination results of each material are shown in Table 2.

[0048] Table 2 Silique pressure resistance of E1 generation plants

[0049]

[0050]

[0051] Comprehensive Table 1 and Table 2, E1 generation homozygous editing plants and wild type Westar anti-cracking ability, P29-B12 anti-cracking angle ability is the strongest (see Figure 3 ). Because all the silique of wild type Westar is broken at the first collision, so its anti-cracking index is 0, the highest SRI (anti-cracking index) of editing plant is P29-B12 (0.78), the lowest is P18-H15 (0.40), which are significantly higher than the anti-cracking level of wild type. The statistical results of seed exposure rate show that there is a significant difference between editing plants and wild type Westar (P≤0.0001), among them, the seed exposure rate of P29-B12 is the smallest, with an average of 2.80%, less than 3% of Westar, and the seed exposure rate of P18-H15 is the largest, with an average of 25.8%, less than 27% of Westar.

[0052] At the same time, the silique cracking force test method P29-B12 has the highest cracking force, with an average of 9.39N, which is 1.65 times of Westar, and P18-H15 has the lowest cracking force, with an average of 7.57N, which is 1.33 times of Westar. Linear fitting correlation analysis was made between SRI and cracking force, and they showed positive linear correlation (y = 4.374x + 5.903, R 2 = 0.3326, P < 0.0001).

[0053] After the random collision experiment and the cracking force experiment, the inventors observed the silique morphology of wild-type Westar and E1 edited lines. The Westar silique was divided into two halves along the dehiscence zone, and the edges of the dehiscence valve were smooth and complete, but the edited lines were damaged at the top and base of the silique after collision, broken in the middle, and the seeds were not easy to fall off. Most of the silique did not separate along the original dehiscence zone position during the cracking force test, and the edges of the dehiscence valve presented jagged sawtooth shape. Figure 4

[0054] Further investigation of the comprehensive agronomic traits such as flowering period and effective silique number, the results are shown in Table 3.

[0055] Table 3 Agronomic trait investigation of E1 edited lines

[0056]

[0057] The inventors also analyzed the off-target of each edited material. Using CRISPR-P2.0

[0058] (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), according to the probability from large to small, there is 1 potential off-target site with 4 base mismatches at the Target1 site, and the PAM sequence is 5'-NAG-3'. There are 52 potential off-target sites at the Target2 site. This study only retains 16 sites that meet the Westar variety genome sequence in the first 20 results (Table 4-1), of which 8 have a Mismatch Number of 3, and 8 have a Mismatch Number of 4. Then using Cas-OFFinder (http: / / www.rgenome.net / cas-offinder / ) to select Brassica napus (v4.1)-Rapeseed, Mismatch Number is selected as 2, DNA / RNA Bulge Number is selected as 1, S1 predicts 1 potential off-target site, and S2 predicts 7 potential off-target sites. The specific information of the potential off-target sites is shown in the table. In summary, there are 2 potential off-target sites for Target1, and 23 potential off-target sites for Target2 (the potential off-target sites analyzed by different methods are shown in Table 4 and Table 5).

[0059] Table 4 Potential off-target sites predicted by CRISPR-P2.0

[0060]

[0061]

[0062] ​Note: lowercase letters represent mismatched bases, MMs represent the number of mismatched bases, long dashed lines above are potential off-target sites of Target 1, and below are potential off-target sites of Target 2; the underlined line represents the typical PAM sequence NGG and the atypical PAM sequence NAG; Score 1 represents the target editing region.

[0063] Table 5 Cas-OFFinder predicted potential off-target sites

[0064]

[0065] Note: lowercase letters represent mismatched bases, MMs represent the number of mismatched bases, long dashed lines above are potential off-target sites of Target 1, and below are potential off-target sites of Target 2; the underlined line represents the typical PAM sequence NGG and the atypical PAM sequence NAG, and bold letters represent DNA Bulge bases; "-" represents RNA Bulge (i.e., sgRNA has one more base than genomic DNA); MMs of 0 represent the target editing region.

[0066] Using IGV software, the sequencing data files of the 7 homozygous edited plants were sorted and analyzed for potential off-target sites, and the potential off-target sites on chromosome A04

[0067] TTGgAGAGGATGGTGaCAGtGGG is located in the BnaA04g05940D gene, and off-targets are found in P18-S2 and P18-H15, with a single base A inserted between 3-4 bases upstream of the PAM sequence 5' end, and P18-S2 is a homozygous mutation at the off-target site, and P18-15 is a heterozygous mutation (see Figure 5 ). The gene encodes a protein with Ca 2+ / calmodulin-dependent protein kinase activity and is involved in intracellular signal transduction. This position is located in the UTR region, and the insertion of one base does not change the coding sequence of the gene.

[0068] Further analysis of the residual vector sequence in the edited plants. The clean reads after second-generation sequencing were aligned with the vector sequence, and the Bam files obtained after alignment were presented in IGV. The results showed that in P18-H15, P18-S1, and P18-S2, the reads on the corresponding vector were arranged in a scattered and orderly manner, and the bases had a relatively high abundance (see Figure 6 ). The remaining sites with particularly low abundance (≤5x) may be aerosol contamination and are not analyzed. The above results show that the three E1 generation plants P18-H15, P18-S1, and P18-S2 have residual vector sequences, and the P29 and P31 offspring have no residual vector sequences.

[0069] In combination with the above results, the inventors bred plants P29-SA3 with sufficient anti-splitting ability and excellent comprehensive agronomic performance.

[0070] Example 3 Editing genotype of plants

[0071] The inventors further identified and confirmed the editing genotypes of P29-B12, P29-SA3 and other 5 edited materials. It was found that the editing genotypes of these plants were different. Among them, the sequences of the target genes BnA03.IND and BnC03.IND of P29-SA3 after mutation are shown in SEQ ID NO. 5 and SEQ ID NO. 7, and the amino acid sequences encoded by the mutated genes are shown in SEQ ID NO. 6 and SEQ ID NO. 8.

[0072] Using the Brassica napus containing the sequences of SEQ ID NO. 5 and SEQ ID NO. 7 as the donor, the sequences of SEQ ID NO. 5 and SEQ ID NO. 7 are introduced into the Brassica napus containing the sequences of SEQ ID NO. 1 and SEQ ID NO. 3 by sexual crossing, or using genetic engineering means to modify the sequences of SEQ ID NO. 1 and SEQ ID NO. 3 in the Brassica napus to be improved to the sequences of SEQ ID NO. 5 and SEQ ID NO. 7, both of which can obtain new germplasm of Brassica napus with commercial value.

[0073] Although the present application has been described in detail with general description and specific embodiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application.

Claims

1. A method of breeding a split resistant oilseed rape, characterized in that: The gene of the sequence shown as SEQ ID NO. 1 and SEQ ID NO. 3 in the oilseed rape to be improved is replaced by the gene of the sequence shown as SEQ ID NO. 5 and SEQ ID NO. 7, and the oilseed rape plant with significantly enhanced anti-splitting ability is selected; The gene replacement method is any one of the following: (1) the oilseed rape containing the gene of the sequence shown as SEQ ID NO. 5 and SEQ ID NO. 7 is used as a donor, the gene of the sequence shown as SEQ ID NO. 5 and SEQ ID NO. 7 is introduced into the oilseed rape containing the gene of the sequence shown as SEQ ID NO. 1 and SEQ ID NO. 3 by sexual hybridization, until the gene of the sequence shown as SEQ ID NO. 5 and SEQ ID NO. 7 completely replaces the gene of the sequence shown as SEQ ID NO. 1 and SEQ ID NO. 3; (2) the gene of the sequence shown as SEQ ID NO. 1 and SEQ ID NO. 3 in the oilseed rape to be improved is targeted to be modified into the gene of the sequence shown as SEQ ID NO. 5 and SEQ ID NO. 7 by using genetic engineering means.

2. The method of claim 1, wherein: The donor oilseed rape is from the seed with the preservation number of CCTCC NO: P202414.

Images