Soybean nodule-related gene gmwak2a and application thereof

Abstract

This invention discloses the soybean root nodule-related gene GmWAK2a and its applications. The expression of the target gene GmWAK2a is controlled using the CRISPR-Cas9 gene editing system to regulate the number of soybean root nodules. By manipulating the expression level of this gene through molecular biology operations, transgenic plants with increased or decreased root nodule numbers compared to the control group are obtained. Based on experimental research and scientific findings on the role of GmWAK2a in regulating soybean nodulation, this invention establishes a technical pathway to increase the number of soybean nodules through gene editing of GmWAK2a, possessing significant theoretical and applied value.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a root nodule-related gene and its application in regulating the number of soybean nodules. Background Technology

[0002] Soybeans are not only an important economic crop for food, oil, and feed, but also a nitrogen-demanding plant, heavily reliant on nitrogen fertilizer in their production. However, as a legume, soybeans can interact with rhizobia to form symbiotic organs called root nodules, thereby obtaining the nitrogen nutrients needed for growth through symbiotic nitrogen fixation. Therefore, the normal development of root nodules is a crucial prerequisite for the stable functioning of symbiotic nitrogen fixation, making the identification of functional genes regulating soybean root nodule formation particularly important.

[0003] To date, it has not been reported whether the gene GmWAK2a studied in this invention plays a role in the interaction between leguminous plants and rhizobia and in the formation of root nodules. Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a soybean root nodule-related gene GmWAK2a and its application, using the CRISPR-Cas9 gene editing system to control the expression of the target gene GmWAK2a to regulate the number of soybean root nodules.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0006] The present invention includes a root nodule-associated gene GmWAK2a, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] This invention also includes equivalent genes, alleles, and homologous genes that have the same biological effects as the above-mentioned genes.

[0008] The present invention also includes biological components associated with the gene, including but not limited to: nucleic acid molecules encoded by the gene; recombinant expression vectors and expression cassettes containing the nucleic acid molecules encoded by the gene; and proteins encoded by the gene.

[0009] The present invention also includes the use of the gene in regulating the number of root nodules in crops.

[0010] As a preferred embodiment of the present invention, the use includes: regulating the expression level of the gene through molecular biological operations, thereby obtaining transgenic plants with an increased or decreased number of root nodules compared with a blank control.

[0011] As a preferred embodiment of the present invention, the use includes: obtaining transgenic plants with a reduced number of root nodules compared to a blank control by increasing the expression level of the gene; or obtaining transgenic plants with an increased number of root nodules compared to a blank control by inhibiting or knocking out the expression of the gene.

[0012] The present invention also includes a method for improving soybean root nodule data by constructing molecular biological components to reduce or knock out the expression of the gene, thereby obtaining transgenic plants with an increased number of root nodules compared with a blank control.

[0013] As a preferred technical solution of the present invention, firstly, gene editing target sequence primers are designed based on specific target sequences, then target adapters are prepared, and after the target adapters are ligated with gRNA vectors by enzyme digestion, nucleotide fragments containing the target gene target sequence are amplified by KOD amplification system and purified and recovered. The obtained PCR products are used to construct a recombinant expression vector, and the obtained recombinant expression vector is transformed into Escherichia coli. Then, the plasmid containing the target fragment is extracted from E. coli and transformed into Agrobacterium rhizogenes. The target transgenic plant is constructed by Agrobacterium rhizogenes-mediated transformation.

[0014] As a preferred embodiment of the present invention, the nucleotide sequence of the target sequence is shown in SEQ ID NO.2 and SEQ ID NO.3; pYLCRISPR / Cas9-DB is used as the empty vector when constructing the recombinant expression vector.

[0015] As a preferred embodiment of the present invention, when the target adapter is ligated to the gRNA vector, the gRNA vector is digested with BsaI enzyme, and the target adapter is ligated to the digested gRNA vector with T4 ligase.

[0016] As a preferred embodiment of the present invention, when constructing the recombinant expression vector, the PCR product containing the target sequence is recovered from the KOD amplification system, the PCR product obtained by digestion with Bsa I enzyme is combined with the pYLCRISPR / Cas9-DB empty vector plasmid to obtain the target fragment and the linearized vector, and then the digested vector plasmid and the target gene band are gel-cleaved and purified, and the recovered DNA fragment is ligated with the target vector pYLCRISPR / Cas9-DB using T4 ligase to obtain the recombinant expression vector.

[0017] The beneficial effects of adopting the above technical solution are as follows: Based on experimental research and scientific research findings on the role of GmWAK2a in regulating soybean nodulation, this invention creates a technical path to increase the number of soybean nodules by gene editing GmWAK2a, which has important value in both theoretical and applied aspects. Attached Figure Description

[0018] Figure 1The diagram shows the target sites for GmWAK2a knockout, where green boxes represent exons, black lines represent introns, and letters represent gene editing target sequences.

[0019] Figure 2 Sanger sequencing peaks for gene-editing empty vectors EV and Cas9-GmWKA2a.

[0020] Figure 3 This is a statistical diagram illustrating the types of gene editing in GmWAK2a.

[0021] Figure 4 This is a schematic diagram of the phenotype of the gene-edited GmWAK2a and the empty vector hairy root nodule.

[0022] Figure 5 A schematic diagram showing the number of root nodules in each hairy root of all gene-edited GmWAK2a and empty vectors. Detailed Implementation

[0023] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are commercially available products and can be directly obtained through market purchase. The following embodiments are intended to facilitate a better understanding of the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent companies. Unless otherwise specified, all percentages in the following embodiments refer to mass percentages.

[0024] It should be understood that, when used in this specification and the appended claims, the term "comprising" indicates the presence of a described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or a collection thereof. It should also be understood that the term "and / or" as used in this specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations. As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrase "if determined" or "if detected [the described condition or event]" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once detected [the described condition or event]," or "in response to detection [the described condition or event]."

[0025] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this application mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.

[0026] In this invention, the nucleotide sequence of the GmWAK2a gene is shown in SEQ ID NO.1.

[0027] This invention uses the CRISPR-Cas9 gene editing system to knock out the target gene GmWAK2a, and relates to the application of genes that regulate the number of soybean root nodules and the proteins they encode. Specifically, this invention relates to the application of the soybean-derived GmWAK2a gene and the protein it encodes in regulating the number of soybean root nodules.

[0028] Example 1: Construction of soybean GmWAK2a vector

[0029] 1) Primer design for GmWAK2a gene editing target sequence

[0030] For the target gene GmWAK2a, two suitable sgRNAs were identified as target sites in the exons near the ATG region. Two relatively close target sites in the first exon of the GmWAK2a gene were preferentially selected for vector construction, such as... Figure 1 As shown. Primer design is completed by adding gene-specific target sequences to the primer template. The specific target sequences are as follows:

[0031] sgRNA-1:CCTCGAATGACTAATATCAC (SEQ ID NO: 2)

[0032] sgRNA-2:ATGCATGTGTCGGGATGGTT (SEQ ID NO: 3)

[0033] 2) Target connector preparation

[0034] Add adapter primers, anneal at 90°C for 30 seconds, then at room temperature to form DNA double strands.

[0035] 3) Target linker and gRNA vector restriction enzyme ligation

[0036] The gRNA vector was digested with Bsa I enzyme, and the target adapter was ligated to the digested gRNA vector using T4 ligase.

[0037] 4) Amplify gRNA expression fragments

[0038] Using the ligation product as a template, specific primers were designed based on its sequence. Target sequence 1 and target sequence 2 containing the target gene target were amplified using the KOD amplification system. The obtained target sequence 1 product and target sequence 2 were ligated and amplified, and then purified and recovered using the PCR product purification kit from Shanghai Sangon Biotech.

[0039] 5) Target fragment ligated into pYLCRISPR / Cas9-DB expression vector

[0040] The recovered PCR products containing target sequences 1 and 2 and the empty pYLCRISPR / Cas9-DB vector plasmid were digested with Bsa I to obtain the target fragment and linearized vector. The digested vector plasmid and target gene band were then gel-cleaved and purified. The recovered DNA fragment was ligated into the target vector pYLCRISPR / Cas9-DB using T4 ligase. The ligation product was transformed into E. coli and sequenced for identification.

[0041] 6) Target fragment transformed into Agrobacterium rhizogenes K599

[0042] The pYLCRISPR / Cas9-DB plasmid containing the target fragment was extracted from Escherichia coli DH5α, transformed into Agrobacterium rhizogenes K599, and after being correctly identified, stored in an ultra-low temperature freezer at -80℃ for later use.

[0043] Example 2: Transformation of soybean hairy roots

[0044] 1) Culture of Agrobacterium rhizogenes

[0045] Agrobacterium rhizogenes K599, both empty vector (EV) and vector containing the target fragment, were cultured in 50 mL LB broth (supplemented with spectinomycin and streptomycin) overnight at 28°C and 200 rpm. The culture was then centrifuged at 4500 rpm for 10 minutes, the supernatant was discarded, and the culture was resuspended in co-culture medium (CCM) to OD0.05. 600 = Around 0.8.

[0046] 2) Co-culture of Agrobacterium and soybean

[0047] Germinating seeds were cut from the hypocotyl at approximately 0.5 cm from the ion leaf node using a sterilized scalpel and placed in prepared liquid co-culture medium (CCM) containing bacterial solution. After gently shaking at 150 rpm / min for one hour at room temperature, the explants were placed on solid CCM and co-cultured with Agrobacterium in the dark for three days.

[0048] 3) Soil relocation

[0049] After co-culturing, the explants were transferred to vermiculite that had been pre-soaked in low-nitrogen nutrient solution and covered with a film to retain moisture. The film was removed about six days after transplanting.

[0050] 4) Inoculation with rhizobia

[0051] The slow-growing soybean rhizobium strain USDA110 was cultured in TY medium to the exponential growth stage beforehand, and then diluted with ddH2O to an appropriate density (OD). 600 =0.08), when soybeans are 10 days old, gently irrigate the vermiculite around the roots of soybean seedlings with rhizobium, and the inoculation amount is 15 mL per seedling.

[0052] 5) Sample and count the number of root nodules on individual hairy roots.

[0053] Thirty days after inoculation, the underground phenotype of the transformed plants was observed and analyzed, and the number of root nodules of each hairy root was counted. After numbering each hairy root, samples were taken from the root tip of each hairy root at a depth of 2-3 cm for DNA extraction.

[0054] 6) DNA extraction

[0055] DNA was extracted from the collected samples using CTAB reagent, and the DNA was detected using Bar primers. Hairy roots transformed with the corresponding empty vector were used as negative controls. The Bar primer sequences are as follows:

[0056] Bar-F: CTACATCGAGACAAGCACGGTCAA (SEQ ID NO: 4);

[0057] Bar-R: AGAAACCCACGTCATGCCAGTTC (SEQ ID NO: 5).

[0058] 7) PCR amplification and sequencing of target sequences

[0059] After noting the serial numbers of the hairy roots that identified DNA as positive, the DNA from the positive roots was then amplified by PCR, including the target sequence. The primer sequences are as follows:

[0060] F:AGTTCATAACTGTAGGTTGCGACA (SEQ ID NO: 6);

[0061] R: CTGTATATAAACATCAAACAGTGGT (SEQ ID NO: 7).

[0062] The PCR products that successfully amplified the target band were sequenced. The sequencing results were compared with the target sequence to determine whether the editing was successful and the type of editing. Of the 22 Bar gene-positive hairy roots, 11 were edited. The double peaks in the sequencing results indicated successful gene editing. Figure 2 Of these, 1 / 3 (red letters indicate base substitutions) of the transgenic hairy roots showed base substitutions at the target site, 7 / 12 (dashes indicate base deletions) of the transgenic hairy roots showed deletions of 2-16 bp, and 1 / 6 (blue letters indicate base insertions) of the hairy roots showed base insertions. Figure 3 ).

[0063] Example 3: Phenotypic Analysis of Gene-Edited GmWAK2a Hairy Roots

[0064] Comparing the root nodule data of the gene-edited hairy root material (Cas9-GmWAK2a) with the root nodule data of the hairy root material (EV) transformed with the empty vector, the average number of root nodules per hairy root transformed with the empty vector was about 12, while the average number of root nodules per edited transgenic hairy root was about 22. Figure 4 and 5 Statistical data analysis showed that, compared with the control, the number of hairy root nodules generated by GmWAK2a gene editing was significantly increased.

[0065] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.

[0066] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. The role of the GmWAK2a gene in regulating soybean root nodule number, characterized by: The nucleotide sequence of the gene GmWAK2a is shown in SEQ ID NO.1; the specific use is to obtain transgenic soybean plants with an increased number of root nodules compared with the blank control by inhibiting the expression of the gene or knocking out the gene.

2. A method for increasing the number of soybean root nodules, characterized in that: Molecular biology components were constructed to reduce the expression of the target gene or knock out the target gene, resulting in transgenic soybean plants with an increased number of root nodules compared to the blank control; the target gene is GmWAK2a, and its nucleotide sequence is shown in SEQ ID NO.

1.

3. The method according to claim 2, characterized in that: First, gene editing target sequence primers were designed based on specific target sequences. Then, target adapters were prepared. After the target adapters were ligated with gRNA vectors by enzyme digestion, nucleotide fragments containing the target gene target sequence were amplified and purified using the KOD amplification system. The resulting PCR products were used to construct a recombinant expression vector, which was then transformed into E. coli. The plasmid containing the target fragment was then extracted from E. coli and transformed into Agrobacterium rhizogenes. The transgenic soybean plant was then constructed using Agrobacterium rhizogenes-mediated transformation.

4. The method according to claim 3, characterized in that: The nucleotide sequence of the target sequence is shown in SEQ ID NO.2 and SEQ ID NO.3; pYLCRISPR / Cas9-DB was used as the empty vector when constructing the recombinant expression vector.

5. The method according to claim 3, characterized in that: When the target linker is ligated to the gRNA vector via enzyme digestion, it utilizes... Bsa The gRNA vector was digested with enzyme I, and the target adapter was ligated to the digested gRNA vector using T4 ligase.

6. The method according to claim 3, characterized in that: In constructing the recombinant expression vector, the PCR product containing the target sequence was recovered from the KOD amplification system. The PCR product obtained by digestion with Bsa I was combined with the empty pYLCRISPR / Cas9-DB vector plasmid to obtain the target fragment and the linearized vector. Then, the digested vector plasmid and the target gene band were gel-cleaved and purified. The recovered DNA fragment was ligated with the target vector pYLCRISPR / Cas9-DB using T4 ligase to obtain the recombinant expression vector.

Images