Peanut salt-tolerant gene ahagl21 and application thereof
By cloning the AhAGL21 gene from salt-tolerant peanut varieties and overexpressing it in Arabidopsis thaliana, the problem of unclear function of peanut MADS-box transcription factors was solved, salt tolerance was improved, and genetic resources and molecular mechanisms for salt-tolerant breeding were elucidated.
Patent Information
- Application Number
- CN202410911406.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-09
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2044-07-09
AI Technical Summary
In the current technology, the function, mechanism of action, regulatory network and application technology of peanut MADS-box transcription factors are not fully understood, making it difficult to effectively cultivate new peanut varieties with high salt tolerance.
The AhAGL21 gene was screened and cloned from salt-tolerant peanut varieties. Through PCR amplification and transformation of Arabidopsis thaliana with an overexpression recombinant vector, it was verified that the expression level was significantly increased under salt stress, thereby enhancing the salt tolerance of the plant.
The AhAGL21 gene overexpression lines showed significantly higher germination rate and cotyledon greening rate under salt stress than the wild type, proving that it is a salt-tolerant gene, enriching the gene resources for peanut salt-tolerant breeding and the functional diversity of MADS-box transcription factors.
Smart Images

Figure CN118726395B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to a peanut salt-tolerant gene AhAGL21 and application thereof. BACKGROUND
[0002] Studies have shown that peanuts have certain tolerance to salt stress, and cultivating new peanut varieties with high salt tolerance is an effective means to expand planting area and improve yield. Therefore, identifying salt-tolerant genes, studying their physiological functions and molecular mechanisms in salt-tolerance regulation in peanuts, constructing a comprehensive regulatory network, and integrating transgenic and molecular-assisted breeding techniques to select new salt-tolerant peanut varieties are of great significance to ensure peanut resistance and high yield and sustainable development of the peanut industry, and are strongly necessary and urgent.
[0003] MADS-box genes are important transcription factors in eukaryotes, which can participate in key physiological and biochemical processes such as plant growth and development regulation, signal transduction and stress response. Therefore, it is of great significance to systematically study the function of peanut MADS-box genes and their salt stress response mechanism, and the feasibility has scientific basis.
[0004] MADS-box is a kind of transcription factor widely existing in plants, which can be divided into Type I and Type II, and all known functional MADS-box genes belong to Type II. Type II, also known as MIKC type, can be divided into MIKC C and MIKC* two groups, and MIKC C can be further divided into 15 subfamilies: AG, AGL6, AGL12, AGL15 / 18, AGL17, AP1, AP3, FLC, PI(TT16), SEP, SOC1, Bsister(GGM13), OsMADS32 and SVP. MADS-box plays a key regulatory role in plant growth and development, metabolism and stress response, and is a potential candidate gene for cultivating stress-resistant, high-yield and high-quality varieties through genetic engineering, but the function, mechanism, regulatory network and application technology of peanut MADS-box transcription factors have not been fully determined and need to be systematically and in-depth studied. SUMMARY
[0005] The application provides a peanut salt-tolerant gene AhAGL21 and application thereof. The AhAGL21 gene is screened, isolated and cloned from a salt-tolerant peanut variety, and experiments show that the expression amount of the peanut transcription factor AhAGL21 gene is significantly increased under salt stress, and the salt tolerance of transgenic Arabidopsis is significantly enhanced, which determines that AhAGL21 is involved in salt response and confirms that the gene can effectively improve the salt tolerance of crops.
[0006] To achieve the above-mentioned purposes, the application adopts the following technical solutions:
[0007] The application provides a peanut salt-tolerant gene AhAGL21, wherein a nucleotide sequence of the peanut salt-tolerant gene AhAGL21 is shown as SEQ ID No. 1, and an amino acid sequence encoded by the peanut salt-tolerant gene AhAGL21 is shown as SEQ ID No. 2.
[0008] Further, an amplification primer sequence of the peanut salt-tolerant gene AhAGL21 is as follows:
[0009] AhAGL21-F: ATGGGAAGGGGAAGAGTGGAAC;
[0010] AhAGL21-R: TCAAAGCATCCATCCAGGAACAA.
[0011] The application further provides application of the peanut salt-tolerant gene AhAGL21 in improving plant salt tolerance.
[0012] Further, the application comprises the following steps:
[0013] (1) PCR amplification and cloning of the gene AhAGL21;
[0014] (2) connecting a full-length CDS of the cloned gene AhAGL21 into an expression vector to obtain an overexpression recombinant vector;
[0015] (3) transforming the overexpression recombinant vector into Agrobacterium to obtain an overexpression recombinant strain;
[0016] (4) transforming the overexpression recombinant strain into plants, and screening and obtaining an AhAGL21 gene overexpression strain.
[0017] Further, an amplification system of PCR in the step (1) is as follows: 5 μL 5× PrimeSTAR GXL Buffer, 1 μL dNTP Mixture, 1 μL total cDNA, 1 μL AhAGL21-F, 1 μL AhAGL21-R, 1 μL PrimeSTAR GXLDNA Polymerase and 9 μL sterile double-distilled water.
[0018] Further, the expression vector in the step (2) is pCambia2300, the vector promoter is 35S, and the screening marker is an herbicide-resistant gene BAR.
[0019] Further, compared with a wild type strain, the AhAGL21 gene overexpression strain has obviously improved salt tolerance.
[0020] Further, compared with the wild type strain, the AhAGL21 gene overexpression strain has a significantly increased transcription level of leaves and roots under salt stress.
[0021] Further, the plant is Arabidopsis thaliana.
[0022] The application further provides the peanut salt-tolerant gene AhAGL21 or the primer of the peanut salt-tolerant gene AhAGL21 for use in breeding a salt-tolerant peanut variety.
[0023] Compared with the prior art, the application has the following advantages and beneficial effects: based on peanut transcriptome data analysis, the application finds that multiple MADS-boxes can respond to peanut salt stress physiological processes, and takes them as candidate gene resources for peanut salt-tolerant breeding. The application determines and clones a MADS-box transcription factor gene (named as AhAGL21) through a large number of experiments, verifies the expression mode of AhAGL21 under salt stress through fluorescent quantitative PCR, and finds that the transcription levels of the gene in leaves and roots under salt stress are significantly increased. The salt tolerance of the overexpression transgenic Arabidopsis thaliana plant AhAGL21-OE is evaluated, and the results show that the germination rate and cotyledon greening rate of the AhAGL21-OE transgenic Arabidopsis thaliana are obviously higher than those of the wild type, indicating that the salt tolerance of the AhAGL21-OE transgenic Arabidopsis thaliana is better than that of the wild type, thereby proving that the gene is a salt-tolerant gene.
[0024] The identification and salt-tolerant function analysis of the peanut AhAGL21 gene in the application enrich the gene resources for peanut salt-tolerant breeding and the functional diversity of MADS-box transcription factors, and have important theoretical significance and application value. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 The expression mode of the AhAGL21 gene in leaves and roots under salt stress is shown in (A) AhAGL21 expression in peanut roots and (B) AhAGL21 expression in peanut leaves.
[0026] Figure 2 The tissue expression mode analysis of the peanut AhAGL21 gene is shown in (A) and (B).
[0027] Figure 3 The germination rate comparison between the wild type and the transgenic plant AhAGL21-OE is shown in (A) seed germination of the wild type and the overexpression strain on salt-containing or salt-free medium for 7 days, (B) germination rate statistics after germination for 7 days, and (C) cotyledon greening rate statistics. DETAILED DESCRIPTION
[0028] The technical solutions of the application are further described in combination with the following specific examples.
[0029] In the following examples, unless otherwise specified, the experimental methods used are conventional methods, and the materials, reagents, etc. used can be purchased from biological or chemical reagent companies.
[0030] Example 1: Cloning of AhAGL21 gene
[0031] The RNA of the salt-tolerant peanut variety "Huayu 22" was extracted, and the cDNA was reversely transcribed therefrom. The cDNA was used as a template to amplify the AhAGL21 gene using primers. The amplified sequence was sequenced to determine the sequence of the target gene AhAGL21. The nucleotide sequence of the gene AhAGL21 is shown in SEQ ID No. 1, and the encoded amino acid sequence is shown in SEQ ID No. 2.
[0032] The PCR amplification system for amplifying the peanut AhAGL21 gene was as follows: 5 μL 5× PrimeSTAR GXL Buffer, 1 μL dNTP Mixture, 1 μL total cDNA, 1 μL AhAGL21-F, 1 μL AhAGL21-R, 1 μL PrimeSTAR GXL DNA Polymerase, and 9 μL sterile double-distilled water.
[0033] The PCR reaction conditions for amplifying the peanut AhAGL21 gene were as follows: 98 ℃ for 1 min; 98 ℃ for 10 s, 58 ℃ for 15 s, and 68 ℃ for 40 s; a total of 30 cycles; and 68 ℃ for 3 min.
[0034] The sequence of the PCR amplification primer was as follows:
[0035] AhAGL21-F: 5'-ATGGGAAGGGGAAGAGTGGAAC-3' (SEQ ID No. 3);
[0036] AhAGL21-R: 5'-TCAAAGCATCCATCCAGGAACAA-3' (SEQ ID No. 4).
[0037] The cloned full-length CDS of the gene was connected to the expression vector pCambia2300 using seamless cloning technology. The promoter of the vector was 35S, and the selection marker was the herbicide-resistant gene BAR. The overexpression vector was transformed into Arabidopsis, and the obtained transgenic plants were used for salt tolerance identification and analysis.
[0038] Example 2: Expression pattern of peanut AhAGL21 gene under salt stress
[0039] The peanut seedlings grown for two weeks are subjected to stress treatment (100 mM NaCl), and total RNA is extracted from leaves and roots, respectively, to analyze the expression change rule of the AhAGL21 gene after salt stress for 0 h, 1 h, 6 h, 24 h and 48 h. Figure 1 It is further verified that the AhAGL21 gene is sensitive and important to salt stress response.
[0040] The primers for gene quantitative PCR are as follows:
[0041] The forward primer sequence is RTAhAGL21-F: 5'-GATACATCTCTCAGGCAAGTCA-3' (SEQ ID No. 5);
[0042] The reverse primer sequence is RTAhAGL21-R: 5'-TGTTCCTTGTTTTGCAGATCAG-3' (SEQ ID No. 6).
[0043] Peanut Actin is used as an internal reference gene, the forward primer sequence amplified is Actin-F: 5'-TTGGAATGGGTCAGAAGGATGC-3'; and the reverse primer sequence is Actin-R: 5'-AGTGGTGCCTCAGTAAGAAGC-3'.
[0044] Example 3, tissue expression pattern of peanut AhAGL21 gene
[0045] It is found through experiments that the expression amount of the AhAGL21 gene in leaves, stem tips, roots, nodule roots, pistils, pericarps and seeds is relatively high. Figure 2 The plant root is the most direct part responding to salt stress, and the high expression of AhAGL21 in roots and leaves indicates that AhAGL21 has high sensitivity to respond to peanut salt stress. In addition, AhAGL21 can participate in the formation of pistils, stamens, pericarps, seeds and the like in addition to participating in salt stress response.
[0046] Example 4, germination rate analysis of AhAGL21 gene overexpression strain
[0047] The AhAGL21 overexpression vector is constructed, and AhAGL21-OE1 and AhAGL21-OE2 (overexpression transgenic Arabidopsis thaliana strains) are obtained. Figure 3
[0048] 1, vector construction
[0049] Primers (with NcoI and SpeI restriction sites at both ends) were designed to amplify the AhAGL21 sequence, which was then ligated into the pUCm-Tz vector. The T vector containing the AhAGL21 gene and the expression vector pCAMBIA2300 were digested with the restriction endonucleases NcoI and SpeI, respectively. The DNA fragments and expression vectors were recovered via gel extraction. The AhAGL21 gene was then ligated into the expression vector using T4 DNA ligase.
[0050] 2. Obtaining transgenic plants
[0051] (1) Take a single clone of Agrobacterium that has been transformed into AhAGL21 and put it into 4 mL of LB medium. Incubate overnight at 28 °C and 200 rpm. The next day, take 2 mL of bacterial culture into 50 mL of LB medium and continue to incubate overnight until OD600 is 0.8.
[0052] (2) Centrifuge at 3000 rpm for 10 min to collect the bacterial culture. The bacterial precipitate is resuspended in the infection solution and diluted to OD600 of 0.8.
[0053] (3) Immerse the inflorescence of Arabidopsis thaliana in the staining solution for 1 min, then incubate in the dark for 1 day, and then put it back into the incubator for further culture.
[0054] (4) Cultivate until the pods turn yellow, harvest the seeds, dry them at 30 ℃ and store them at low temperature.
[0055] (5) The harvested transgenic seeds were disinfected with 70% alcohol for 5 min, 2.6% NaClO for 10 min, and rinsed 3 times with sterile water. The seeds were then sown in MS solid medium containing 50 μg / mL kanamycin for screening and culture. Plants with normal growth, dark green leaves, and well-developed root systems were continued to be planted in soil for culture. After they grew, DNA was extracted for PCR testing of positive plants.
[0056] 3. Identification of salt tolerance in transgenic plants
[0057] 1 / 2 MS medium with NaCl concentrations of 0 and 150 mM were prepared respectively. Changes in germination rate and cotyledon greening rate (two salt tolerance physiological indicators) were observed and statistically analyzed in transgenic and wild-type Arabidopsis plants. The results showed that ( Figure 3 As shown in Figures B and C, on a medium supplemented with 150 mM NaCl, the germination rate and cotyledon greening rate of AhAGL21-OE were significantly higher than those of the wild type, indicating that its salt tolerance was superior to that of the wild type. These results lay a solid foundation for subsequent experiments and provide important resources and technical insights for elucidating the physiological and molecular mechanisms by which the AhAGL21 gene regulates peanut salt tolerance.
[0058] The above examples are only used to illustrate the technical solutions of the present application, but not to limit the present application; although the present application has been described in detail with reference to the foregoing examples, the technical solutions recorded in the foregoing examples can still be modified by those of ordinary skill in the art, or some technical features thereof can be replaced by equivalent replacements; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions claimed by the present application.
Claims
1. Application of peanut salt-tolerant gene AhAGL21 in improving plant salt tolerance, characterized in that, The nucleotide sequence of the peanut salt-tolerant gene AhAGL21 is shown as SEQ ID No. 1, and the encoded amino acid sequence is shown as SEQ ID No. 2, and the plant is Arabidopsis thaliana or peanut.
2. The use of the peanut salt-tolerant gene AhAGL21 in improving plant salt tolerance according to claim 1, characterized in that, The application comprises the following steps: (1) PCR amplification and cloning of the gene AhAGL21; (2) connecting the cloned full-length CDS of the gene AhAGL21 into an expression vector to obtain an overexpression recombinant vector; (3) transforming the overexpression recombinant vector into Agrobacterium to obtain an overexpression recombinant strain; (4) transforming the overexpression recombinant strain into plants, screening and obtaining an AhAGL21 gene overexpression line.
3. The use of peanut salt-tolerant gene AhAGL21 in improving plant salt tolerance according to claim 2, characterized in that, The amplification system of PCR in the step (1) is: 5 μL 5× PrimeSTAR GXL Buffer, 1 μL dNTP Mixture, 1 μL total cDNA, 1 μL AhAGL21-F, 1 μL AhAGL21-R, 1 μL PrimeSTAR GXL DNA Polymerase and 9 μL sterile double distilled water.
4. The use of the peanut salt-tolerant gene AhAGL21 in improving plant salt tolerance according to claim 2, characterized in that, The expression vector in the step (2) is pCambia2300, the vector promoter is 35S, and the screening marker is an anti-herbicide gene BAR.