Method for High-Throughput Screening of Promoters to Enhance Heterologous Expression of Carbonic Anhydrase in Escherichia coli

Abstract

The present invention belongs to the technical field of genetic engineering of microorganisms. More specifically, it relates to a method for high-throughput screening of promoters to enhance the heterologous expression of CA in Escherichia coli. The method comprises the following steps: S1, constructing an expression vector by using a promoter library to construct the vector, and using the carbonic anhydrase gene MlCA of Lotus japonicus intermediate rhizobia as the target gene; S2, constructing an engineered bacterium by transforming the expression vector in S1 into Escherichia coli to obtain the engineered bacterium; S3, inducing the expression of recombinant MlCA by culturing the engineered bacterium in S2 and using IPTG as an inducer to induce the engineered bacterium to express recombinant MlCA; S4, measuring the expression level by measuring the expression level of the recombinant MlCA expressed under different promoters in S3 above; S5, according to the measurement results in S4, sorting in descending order according to the expression level, and selecting the promoters with the top 10% of the expression level. In the present invention, the heterologously expressed recombinant MlCA is obtained through high-throughput promoter screening, which can effectively improve the performance of microalgae in fixing CO2.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering of microorganisms, and more specifically, relates to a method for high-throughput screening of promoters to enhance the heterologous expression of CA in Escherichia coli. Background Art

[0002] Green plants and microalgae can convert CO in the atmosphere and water into organic compounds without consuming additional energy. Biological processes such as photosynthesis in the ocean can fix 40% of the carbon fixed on Earth every year, thus maintaining the balance of CO in the atmosphere. 2 Therefore, biological processes can be used as an efficient and environmentally friendly method for CO sequestration. In addition, there are still many challenges in the aspect of biological acquisition of CO from the environment. 2 However, the CO fixation rate catalyzed by RuBisCO is significantly slower, and its effect is also reduced due to the competition of O for the active site. Another obstacle is that the diffusion rate of CO in water is slower than that in air. Microalgae have to cope with the fluctuations of inorganic carbon and pH values, which have a great impact on the availability of CO and HCO. 2 To address these challenges, it is necessary to implement a carbon concentrating mechanism (CCM) to improve the availability of intracellular CO and accelerate the rate of CO diffusion from gas to water. 2 Therefore, developing a strategic approach to CCM is crucial for improving the carbon fixation performance of microalgal photosynthesis. 2 CCM improves photosynthesis efficiency by increasing the inorganic carbon content. This strategy involves carbonic anhydrase (CA, EC.4.2.1.1). CA can efficiently and specifically catalyze the interconversion between CO and HCO, which is a relatively simple but crucial reaction because it is involved in many different biochemical and physiological processes, including photosynthesis, respiration, CO 2 2 2 2 3 - 2 2

[0003] 2 3 - 2And ion transport as well as acid-base balance. CA exists in most organisms, including microalgae, archaea, fungi, bacteria, vertebrates and plants, and common types include α, β, γ, δ and ζ. According to the BRENDA enzyme database, the carbonic anhydrase MlCA from Mesorhizobium loti has the highest specific activity, which is 1914000 μmol / min / mg. Some studies have successfully overexpressed MlCA in the microalgae C. vulgaris and C. sorokiniana respectively, while increasing the biomass of the transgenic microalgae. However, it should be noted that there are safety risks such as gene transfer in the practical application of transgenic microalgae.

[0004] The gene expression level of microorganisms is mainly related to the promoter strength and gene copy number. Metabolic engineering has been widely used to improve product yield and the metabolic performance of microorganisms. Usually, the optimization and control analysis of metabolism requires a set of continuous target gene expression levels, which can be achieved by constructing a promoter library. The screening of the promoter library can achieve precise regulation of gene expression and often obtain the best promoter for high expression of the target protein. In gene expression, the promoter is responsible for regulating the initiation of transcription, thus controlling the strength of expression.

[0005] Due to the burden and toxicity of some target proteins to the host cells, a "strong" promoter does not always lead to higher expression levels; for different proteins, the same promoter may even have different performances; therefore, the selection of the promoter for heterologous expression of CA is a crucial and complex issue.

[0006] Although CAs have made various contributions, due to the limitations of their activities in the natural environment, it poses a challenge to the carbon fixation potential of microalgae. The CCM evolved by microalgae is mainly activated under the condition of low CO 2 concentration (<0.04%), which is an evolutionary adaptation to extreme conditions. However, the CO 2 concentration in the industrial gas treatment process is usually between 10 - 20%, and it is urgent to improve the carbon fixation ability of microalgae in the industrial gas treatment process.

[0007] Chinese patent document CN202210519191.7 discloses a carbonic anhydrase gene and its uses. The examples of this invention verify that the carbonic anhydrase gene enhances the formation of CaCO 3 and the carbonic anhydrase has the function of capturing CO 2 , but no technical inspiration on how to improve the activity of carbonic anhydrase from the perspective of regulating gene elements is given in this invention. Summary of the Invention

[0008] 1. Problems to be Solved

[0009] In view of the problem that the effect of fixing CO by microalgae in the prior art still needs to be improved, the present invention provides a method for high-throughput promoter screening to improve the heterologous expression effect of CA, and further improves the CO fixation rate of microalgae by adding exogenous recombinant MlCA. 2 In view of the problem that the effect of fixing CO by microalgae in the prior art still needs to be improved, the present invention provides a method for high-throughput promoter screening to improve the heterologous expression effect of CA, and further improves the CO fixation rate of microalgae by adding exogenous recombinant MlCA. 2 fixation rate.

[0010] 2. Technical solution

[0011] In order to solve the above problems, the technical solutions adopted by the present invention are as follows:

[0012] The first aspect of the present invention provides a method for high-throughput screening of promoters to enhance the heterologous expression of CA in Escherichia coli, comprising the following steps:

[0013] S1, constructing an expression vector, using a promoter library to construct the vector, and using the carbonic anhydrase gene MlCA of Mesorhizobium loti as the target gene;

[0014] S2, constructing an engineered bacterium, transforming the expression vector in S1 into Escherichia coli to obtain an engineered bacterium;

[0015] S3, inducing the expression of recombinant MlCA, culturing the engineered bacterium in S2, using IPTG as an inducer to induce the engineered bacterium to express recombinant MlCA;

[0016] S4, measuring the expression level, measuring the expression level of recombinant MlCA expressed under the action of different promoters in S3 above;

[0017] S5, according to the measurement results of S4, sorting in descending order of expression level, and selecting the promoters with the top 10% of the expression level.

[0018] The high-throughput technology used in the present invention is a rapid and effective method, which can find promoters that can significantly enhance the expression of target genes.

[0019] Further, the following steps are further included after S5 above:

[0020] S6, measuring the enzyme activity, purifying the recombinant MlCA corresponding to the promoter selected in S5 above, and measuring its enzyme activity.

[0021] S7, sorting in descending order of enzyme activity, and selecting the top 4 promoters with the highest enzyme activity.

[0022] Further, the following steps are further included after S6 above:

[0023] Sorting in descending order of enzyme activity, and selecting the promoter with the highest enzyme activity ranking first.

[0024] Further, the above step S1 is specifically:

[0025] A promoter library, the MlCA gene, the sfGFP fusion protein, the chloramphenicol resistance gene, the ribosome binding site, and the terminator were inserted into a plasmid to construct an expression vector.

[0026] Further, in the above S1, the carbonic anhydrase gene MlCA encoding Lotus japonicus Mesorhizobium includes the nucleotide sequence shown in SEQ ID: NO 97, and its encoded CA activity is higher than that of other CAs, which is beneficial to promoting the fixation of CO2 by Chlorella.

[0027] Further, the above sfGFP encoding gene contains the nucleotide sequence shown in SEQ ID: NO 98.

[0028] With the above technical solution, by measuring the expression level of superfolder green fluorescent protein (sfGFP) in single cells, high-throughput, efficient and accurate screening and evaluation of the promoter were carried out.

[0029] Further, the above terminator contains the nucleotide sequence shown in SEQ ID: NO 99.

[0030] Further, the above ribosome binding site contains the nucleotide sequence shown in SEQ ID: NO 100.

[0031] Further, the above plasmid includes pSB1C3, which contains the nucleotide sequence shown in SEQ ID: NO 102.

[0032] Further, the above plasmid includes AT003, which contains the nucleotide sequence shown in SEQ ID: NO 101.

[0033] Further, in the above S3, the pH value is 5-11.

[0034] Preferably, in the above S3, the pH value is 7.

[0035] The reason for adopting the above technical solution as the preferred technical solution is that: in step S3, when the pH value is 7, the relative activity of recombinant MlCA is the highest.

[0036] Further, in the above S3, the temperature is 20-70 °C.

[0037] Preferably, in the above S3, the temperature is 40 °C.

[0038] The reason for adopting the above technical solution as the preferred technical solution is that: when the temperature in step S3 is 40 °C, the relative activity of recombinant MlCA is the highest.

[0039] Further, the promoter screened by the above high-throughput screening method for promoters to enhance the heterologous expression of CA in Escherichia coli is selected from one of the following nucleic acids:

[0040] (1) A nucleic acid comprising the nucleotide sequence shown in SEQ ID: NO 85;

[0041] (2) A nucleic acid comprising the nucleotide sequence shown in SEQ ID: NO 80;

[0042] (3) A nucleic acid comprising the nucleotide sequence shown in SEQ ID: NO 62;

[0043] (4) A nucleic acid comprising the nucleotide sequence shown in SEQ ID: NO 89.

[0044] The above promoters are used to construct a recombinant MlCA expression vector. Compared with other promoters, the expression level of recombinant MlCA is higher.

[0045] Furthermore, the above promoter comprises the nucleotide sequence shown in SEQ ID: NO 80.

[0046] The promoter containing the nucleotide sequence shown in SEQ ID: NO 80 has the strongest activity and the best effect on improving the CO fixation ability of Chlorella, indicating that when different promoters express the enzymes encoded by the same target gene, the activity and expression level of the enzymes are unpredictable, and the change trends of the enzyme activity and expression level are not consistent, that is, the highest expression level of recombinant MlCA does not mean the strongest activity. 2 The present invention in a second aspect provides an application of the above promoter in expressing recombinant MlCA in the method for high-throughput screening of promoters to enhance heterologous expression of CA in Escherichia coli, comprising the following steps:

[0047] P1, constructing an expression vector, using the promoter to construct the vector, and using the carbonic anhydrase gene MlCA of Mesorhizobium loti as the target gene;

[0048] P2, constructing an engineered bacterium, transforming the expression vector in S1 into Escherichia coli to obtain the engineered bacterium;

[0049] P3, inducing the expression of recombinant MlCA, culturing the engineered bacterium in S2, using IPTG as an inducer to induce the engineered bacterium to express recombinant MlCA.

[0050] P3, inducing the expression of recombinant MlCA, culturing the engineered bacterium in S2, using IPTG as an inducer to induce the engineered bacterium to express recombinant MlCA.

[0051] Furthermore, the concentration of the above IPTG is 0.2 - 1 mM.

[0052] Furthermore, the concentration of the above IPTG is 1 mM.

[0053] The present invention in a third aspect provides a recombinant MlCA induced to express in the above application.

[0054] The fourth aspect of the present invention provides an application of the aforementioned recombinant MlCA in promoting microalgae to fix CO 2 by establishing a co-culture system of the above-mentioned recombinant MlCA and microalgae.

[0055] Furthermore, in the above co-culture system, the concentration of the recombinant MlCA is 10-20 mg / L.

[0056] Preferably, in the above co-culture system, the concentration of the recombinant MlCA is 20 mg / L.

[0057] It should be noted that in the co-culture system, within 4 days, the relative activity of the recombinant MlCA compared to the first day > 80%; within 7 days, the relative activity of the recombinant MlCA compared to the first day > 50%.

[0058] The present invention enhances the process of microalgae fixing CO 2 by externally adding recombinant MlCA to microalgae. This intervention aims to improve the efficiency of converting extracellular CO 2 into HCO 2 in water even under high CO 3 - conditions, thereby promoting the transport of HCO 3 - from the extracellular environment to the intracellular. Moreover, the increased influx of HCO 3 - can provide more CO 2 under the action of intracellular recombinant MlCA to promote the more effective concentration and utilization of the binding site of RuBisCo for CO 2 . That is to say, the present patent adopts a CCM (carbon concentration mechanism) stimulation method based on recombinant MlCA to enhance the ability of microalgae to fix CO 2 under high CO 2 concentration (20%) conditions.

[0059] 3. Beneficial effects

[0060] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0061] (1) In the present invention, by screening promoters through high-throughput experiments to increase the expression level of the recombinant MlCA gene, it is found that when the promoter contains a nucleotide sequence shown in SEQ ID: NO 85, SEQ ID: NO 80, SEQ ID: NO 62 or SEQ ID: NO 89, the expression level of the recombinant MlCA ranks among the top. At the same time, the highly active recombinant MlCA screened in the present invention can effectively improve the performance of microalgae in fixing CO 2 .

[0062] (2) In the promoter screening method of the present invention, when the promoter contains the nucleotide sequence shown in SEQ ID: NO 80, the activity of recombinant MlCA is the highest, improving the fixation effect of CO 2 to the best.

[0063] (3) In the present invention, through experiments, the effects of time, temperature, and pH value on the activity of recombinant MlCA are optimized to further improve the fixation effect of CO 2 by microalgae.

[0064] (4) In the present invention, by adding High MlCA, the activities of RuBisCO and acetyl-CoA are effectively promoted, and the biomass and carbon fixation efficiency of microalgae are improved. In the present invention, recombinant MlCA upregulates the carbon metabolic pathway, such as the TCA cycle, providing energy and carbon for rapid growth and carbon fixation. In addition, the biosynthesis contents such as chlorophyll a / b, lipids, and proteins also increase significantly. By exploring the metabolic regulation mechanism of microalgae under the culture conditions of recombinant MlCA, the present invention provides valuable inspiration for the efficient development of microalgae cell factories. Brief Description of the Drawings

[0065] Figure 1 It is the structural diagram of the expression vector in Example 1 of the present invention;

[0066] Figure 2 It is the expression result diagram of recombinant MlCA in Escherichia coli BL21(DE3) under the control of a synthetic promoter library in the promoter screening experiment of the present invention;

[0067] Among them, the ordinate represents the expression level, defined as fluorescence (arbitrary unit, A.U.) divided by OD 600 ;

[0068] The blue thin line represents the standard error of each clone in 3 technical replicates;

[0069] In the figure, 31 clones are sorted according to the expression level.

[0070] Figure 3 It is a schematic diagram of the recombinant MlCA activity of the soluble proteins of recombinant bacteria Top1 to Top4;

[0071] Figure 4 It is the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis;

[0072] M, 1, 2, 3, and 4 represent the marker before IPTG induction, the supernatant, the precipitate after cell disruption, and the target protein purified with 100 mM imidazole buffer, respectively;

[0073] Among them, the arrow indicates the recombinant MlCA of Top2;

[0074] Figure 5 Relative activity changes of Top2 recombinant MlCA at different times;

[0075] Figure 6 Relative activity changes of Top2 recombinant MlCA at different temperatures;

[0076] Figure 7 Relative activity changes of Top2 recombinant MlCA under different pH conditions;

[0077] Figure 8 Schematic diagram of the change of microalgae cell density over time;

[0078] Figure 9 Schematic diagram of the change of microalgae protein content over time;

[0079] Figure 10 Schematic diagram of the changes of microalgae biomass concentration and maximum carbon fixation rate;

[0080] Figure 11 Graph of the determination results of microalgae chlorophyll a and b;

[0081] Figure 12 Graph of the determination results of microalgae lipids;

[0082] Figure 13 Graph of the determination results of microalgae RuBisCO activity, A-CoA activity and ROS level;

[0083] Among them, statistical analysis was performed using the T-test, and *, **, ***, **** and ns represent the significance levels: p < 0.05, p < 0.01, p < 0.001, p < 0.0001 and p ≥ 0.05 (not significant);

[0084] Figure 14 Volcano plot of Low MlCA and High MlCA treatments in metabolome analysis;

[0085] Figure 15 (a) Venn diagram and (b) heatmap of core enriched metabolites. |log 2 FC| ≥ 1 & OPLS-DA_VIP ≥ 1 & P ≤ 0.05;

[0086] Figure 16 Shows the GO enrichment of Low MlCA and High MlCA treatments in metabolome analysis;

[0087] Figure 17 Volcano plot of Low MlCA and High MlCA treatments in transcriptome analysis;

[0088] Specifically,Figure 17 The fold change value of gene or transcript expression difference between two samples, and the vertical axis is the statistical test value of gene or transcript expression difference, that is, the p-value;

[0089] Each point in the figure represents a specific gene or transcript. Red dots indicate significantly up-regulated genes, and blue dots indicate significantly down-regulated genes;

[0090] Figure 18 (a) is the Venn diagram of up-regulated genes; Figure 18 (b) is the heat map of the top 50 (Log 2 FC) differentially expressed genes up-regulated in Low MlCA and High MlCA treatments;

[0091] Figure 19 Shows the GO enrichment of Low MlCA and High MlCA treatments in transcriptome analysis;

[0092] Figure 20 Shows the network colored according to six modules and key nodes (modules, Mod#0 - 5);

[0093] Figure 21 Shows the CO 2 Linear relationship between the fixation rate and the relative abundance of modules (Mod#1 and 3);

[0094] Figure 22 Shows the key nodes of the core enriched metabolite / gene co-occurrence related network;

[0095] Figure 23 Shows the pathway by which recombinant MlCA promotes microalgae to fix CO 2 : Integrating transcriptome and metabolome analysis;

[0096] Figure 24 Shows the KEGG pathways annotated by differentially expressed genes and differentially expressed metabolites, as well as the KEGG pathways annotated by both;

[0097] Figure 25 Shows the effect of different recombinant MlCA concentrations on photocurrent;

[0098] Figure 26 Shows the effect of different recombinant MlCA concentrations on cyclic voltammetry curves (CV). Detailed implementation methods

[0099] It should be noted that when an element is referred to as being "mounted" on another element, it can be directly on the other element or the two elements can be directly integrated; when an element is referred to as "connected" to another element, it can be directly connected to the other element or the two elements can be directly integrated. At the same time, terms such as "upper", "lower", "left", "right", "middle", etc. cited in this specification are only for the convenience of clear description and are not used to limit the scope of implementation. The change or adjustment of their relative relationship, without substantial change in the technical content, should also be regarded as the scope within which the present invention can be implemented.

[0100] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this invention belongs; the term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0101] For those not specified in the examples, they are carried out under conventional conditions or conditions recommended by the manufacturer. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0102] As used herein, the term "about" is used to provide flexibility and imprecision associated with a given term, measurement, or value. Those skilled in the art can easily determine the degree of flexibility of a specific variable.

[0103] As used herein, "adjacent" means that two structures or elements are close. Specifically, elements identified as "adjacent" can be adjacent or connected. Such elements can also be close to or near each other without necessarily contacting each other. In some cases, the degree of proximity can depend on the specific context.

[0104] As used herein, the term "at least one of..." is intended to be synonymous with "one or more of...". For example, "at least one of A, B, and C" clearly includes only A, only B, only C, and their respective combinations.

[0105] Concentrations, amounts, and other numerical data may be presented herein in a range format. It should be understood that such range formats are used merely for convenience and brevity and should be interpreted flexibly as including not only the numerical values explicitly recited as the limits of the range but also all individual numerical values or sub-ranges subsumed within the above-stated range as if each numerical value and sub-range were explicitly recited. For example, a numerical range of from about 1 to about 4.5 should be interpreted as including not only the explicitly recited limits of 1 to about 4.5 but also the individual numbers (such as 2, 3, 4) and sub-ranges (such as 1 to 3, 2 to 4, etc.). The same principle applies to ranges reciting only one numerical value, such as "less than about 4.5", which should be interpreted as including all of the above values and ranges. In addition, this interpretation should apply regardless of the breadth of the range or feature being described.

[0106] Any of the above steps (e.g., steps S1, S2, S3... or steps (1), (2), (3)... or steps 1), 2), 3)...) in any method or process claim may be performed in any order and are not limited to the order recited in the claim.

[0107] A method + function or step + function limitation is employed only when all of the following conditions are present in a particular claim limitation: a) "a method for..." or "a step for..." is explicitly recited; b) the corresponding function is explicitly recited. Structures, materials, or acts supporting the method + function are explicitly recited in the description herein. Accordingly, the scope of the present invention should be determined solely by the appended claims and their legal equivalents, rather than by the description and examples given herein.

[0108] The present invention will be further described below in conjunction with specific embodiments.

[0109] Example 1

[0110] This example provides a method for high-throughput screening of promoters to enhance heterologous expression of CA in Escherichia coli, specifically including the following steps:

[0111] The first step: Using restriction endonucleases ( v2, NEB) and DNA ligase (T4 DNA ligase, NEB) procedures, a nucleic acid library (promoter library), ribosome binding site (RBS BBa_B0034), sfGFP coding gene (superfolder green fluorescent protein mutant, sfGFP_mut3), and terminator (BBa_B0015, iGEM Part Registry) were sequentially inserted into pSB1C3 at 37°C for 5 min, 16°C for 5 min, for 60 cycles;

[0112] Step 2: Purify the product obtained in the first step using the TIANquick Midi Purification Kit (TIANGEN), and then transform the purified product into 100 μL of Invitrogen electroMAX DH10B (Thermo Scientific) using an Electroporator (Biorad);

[0113] Step 3: After recovery, inoculate the product strain from Step 2 into 250 mL of LB Broth medium containing antibiotics and culture overnight for 12 h;

[0114] Step 4: Extract the plasmid from the overnight culture obtained in Step 3 using the TIANprep Mini Plasmid Kit (TIANGEN BIOTECH (BEIJING) CO., LTD., TIANGEN);

[0115] Step 5: Insert the MlCA gene between the ribosome binding site and the sfGFP coding gene in the plasmid of the product from Step 4 using restriction enzymes (FastDigest BpiI, Thermo Scientific) and DNA ligase (T4 DNA ligase, NEB), at 37°C for 5 min, 16°C for 5 min, for 60 cycles;

[0116] Step 6: Bacterial transformation and culture operations: Transform the DNA product obtained in Step 5 into 100 μL of BL21(DE3) competent cells (TransGen Biotech), and then inoculate it onto a plate containing LB + 2% agar and culture overnight at 37°C. The cultured plate is stored at 4°C.

[0117] In this example, the promoter library contains 96 different promoters, and the sequences are shown as SEQ ID: NO 1 to SEQ ID: NO 96. After successfully preparing Escherichia coli containing the promoter, isolate single colonies for further identification and perform Sanger sequencing using a 20 - bp oligonucleotide (5'ataggcgtatcacgaggcag).

[0118] The promoter library of the present invention was designed and synthesized by Ailurus Biotech.

[0119] It should be noted that there are various types of promoters. The BBa type represents the promoters selected from the iGEM Parts Registry. The promoter BBa_R1075 created by the participants is an example. The promoters in the present invention can be obtained from the official website of iGEM at http: / / parts.igem.org / Main_Page. The T7 type represents the mutant modification of the T7 promoter, and its serial number is designated as an internal reference. For example, T7_459 refers to the promoter selected from the Escherichia coli genome, such as 4599580 / -, and the number indicates its specific position in the Escherichia coli genome.

[0120] As Figure 1 shown, the structure of the expression vector contained in the recombinant Escherichia coli in this example contains a chloramphenicol resistance gene (CmR) as a selection marker, and the ColE1 origin of replication to facilitate plasmid replication. The expression of the recombinase is regulated by a promoter library, a robust ribosome binding site (RBSBBa_B0034), and a bidirectional terminator (BBa_B0015).

[0121] The strains, gene sequences, growth media, and genetic parts used in this example are as follows:

[0122] MlCA gene: The carbonic anhydrase sequence of Mesorhizobium loti, obtained from the Department of Chemical Engineering, National Cheng Kung University, Taiwan, China;

[0123] In the third step, the strain is propagated using LB-Broth (tryptone 10, sodium chloride 10, and yeast extract 5, g / L) medium;

[0124] SOC medium (tryptone 20, yeast extract 5.0, glucose 5.0, NaCl 0.5, KCl 0.186, MgSO 4 1.2, g / L) is used for the transformation recovery of Escherichia coli in the present invention.

[0125] The preparation method of this example refers to the GoldenGate Assembly method of Ailurus Bio Company.

[0126] The main reagents and instruments used in this example are as follows:

[0127] Restriction endonucleases Nco I, Hind III, CloneJET PCR Cloning Kit, BCA Protein Assay Kit, Thermo Scientific; Phusion high-fidelity DNA polymerase, NEB; 6×His-Tagged Protein Purification Kit, Beijing ComWin Biotech Co., Ltd.; ClonExpress II One Step Cloning Kit, Nanjing Novozymes Biotech Co., Ltd. Touch PCR temperature control system, Bio-Rad; Thermostatic oscillator, Shanghai Yiheng Scientific Instrument Co., Ltd., etc.

[0128] Example 2

[0129] This example provides a green fluorescent protein reporter assay for the product of Example 1. The specific methods and results are as follows:

[0130] Green fluorescent protein reporter assay method:

[0131] Pick 192 monoclonal colonies from the plate obtained in the sixth step of the aforementioned Example 1, and inoculate them into 0.75 mL of liquid LB medium containing 30 ng / μL of chloramphenicol, respectively. Place them in two 2 mL 96-well deep-well plates (NEST), and seal the deep-well plates with breathable Nunc Seals (Thermo Scientific). Incubate overnight at 37°C and 1000 rpm.

[0132] Dilute the overnight bacterial solution 1:325 to 750 μL of LB medium containing 30 ng / μL of chloramphenicol. Seal the deep-well plates with breathable Nunc Seals and incubate at 37°C and 1000 rpm. After 3 hours, dilute the bacterial solution in the logarithmic phase 1:225 to 750 μL of LB medium containing 30 ng / μL of chloramphenicol; after pipetting and mixing evenly, take 100 μL of the bacterial solution from each well and transfer it to 3 standard 96-well microplates for setting 3 technical replicates. Seal the 96-well microplates with Nunc Seals (Thermo Scientific) and incubate at 37°C and 1000 rpm for 16 h.

[0133] Take 10 μL of the overnight bacterial solution from each well and transfer it to a black clear-bottom 96-well cell culture plate (InVitroScientific) containing 90 μL of PBS (Sangon Biotech).

[0134] Use Multimode microplate Reader to measure the optical density (OD) at 600 nm 600), and the fluorescence excitation value (excitation wavelength: 485 nm, emission wavelength: 535 nm). The background signals of OD and fluorescence values were measured, and the background was removed from each measurement value. Samples with OD 600 not significantly greater than the background signal were discarded. The protein expression level was obtained by dividing the mean fluorescence value (A.U.) by the corresponding OD 600 mean value. 600

[0135] Results of green fluorescent protein reporter assay:

[0136] As Figure 2 shown, some of these promoters exhibited strong and efficient protein expression performance, showing significant differences. Among the different monoclonal samples successfully measured, 31 unique promoters were identified as having high expression performance, and the protein expression levels of the corresponding 31 monoclonal samples are shown in Table 1.

[0137] Table 1 Original data of fluorescence value measurement including three replicated blank groups and experimental group data

[0138]

[0139]

[0140] Example 3

[0141] According to the results of the green fluorescent protein reporter assay in the foregoing Example 2, the top 4 engineered bacteria with the highest expression levels were labeled as Escherichia coli Top1 - Top4.

[0142] This example provides the determination of the protein concentration and enzyme activity of the recombinant MlCA expressed by Escherichia coli Top1 - Top4. The specific determination methods and results are as follows:

[0143] Methods for protein concentration and enzyme determination:

[0144] The protein concentration was measured using bovine serum albumin (BSA). According to the enzyme hydration experiment, the activity of the purified recombinant MlCA was confirmed. The solution used for the hydration determination of the purified recombinant MlCA included 9 mL of Tris-HCl buffer (pH 8.3), 200 μL of enzyme solution, and 6 mL of CO 2 saturated water. The Wilbur-Anderson (WA) unit was used to measure and represent the activity of recombinant MlCA per milligram of protein.

[0145] Results of enzyme activity determination:

[0146] Figure 3Shows the schematic diagram of the recombinant MlCA activity of the soluble proteins of Escherichia coli Top1 to Top4 at a concentration of 1.0 mM IPTG. Among them, the recombinant MlCA expressed by Escherichia coli Top2 has the highest activity.

[0147] Figure 4 Was sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis;

[0148] M, 1, 2, 3, and 4 represent the marker before IPTG induction, the supernatant, the precipitate after cell disruption, and the target protein purified with 100 mM imidazole buffer, respectively;

[0149] Among them, the arrow indicates the recombinant MlCA expressed by Escherichia coli Top2. The WB result shows that the obvious band is greater than 50 kDa, which is consistent with the size (52.59 kDa) of the sfGFP-MlCA fusion protein, indicating that the fusion protein is successfully expressed in Escherichia coli.

[0150] This example also provides the effects of the recombinant MlCA purified and expressed by Escherichia coli Top2 (abbreviated as Top2 recombinant MlCA) on time, temperature, and pH value.

[0151] As Figure 5 shown, analyzing the stability of the relative activity of Top2 recombinant MlCA over time, the activity > 85% within 4 days.

[0152] As Figure 6 shown, analyzing the change of the relative activity of Top2 recombinant MlCA at temperatures of 20 - 70 °C, the activity is the highest at 40 °C.

[0153] As Figure 7 shown, analyzing the change of the relative activity of Top2 recombinant MlCA at pH values of 5 - 11, the activity is the highest at pH 7.

[0154] Example 4

[0155] This example provides the application of the above-expressed Top2 recombinant MlCA in promoting microalgae to fix CO 2 and includes the following steps:

[0156] Cultivate Escherichia coli Top2 cells containing plasmids in LB culture medium supplemented with the corresponding antibiotics. Dilute the overnight culture at a ratio of 1:100 in fresh LB medium containing antibiotics, and then culture it under stirring conditions at 37 °C and 200 r / min. Use OD 600 optical density to measure the biomass during the culture process to monitor the growth situation. When OD 600When it reached 0.6 - 0.8 h, isopropyl - d - thiogalactoside (IPTG) with a final concentration of 1.0 mM was used to induce recombinant MlCA, and it was cultured with shaking at 22 °C for 12 h.

[0157] A co - culture system was established in an autoclaved flask. In an illuminated incubator at a temperature of 25 °C, the system was irradiated with a cool white fluorescent lamp of 2000 Lux, and the light - dark cycle was 12 / 12 h. The medium used was a modified BG11 medium without Na 2 CO 3 , with a total volume of 50 mL. For the co - culture, the microalgae inoculum was 3.55×10 6 cells / mL and purified recombinant MlCA. In this example, the final concentration of recombinant MlCA in the co - culture system was set as: high concentration 20 mg / L (High MlCA), and the final concentration refers to the concentration of recombinant MlCA in the 50 - mL system. 20% (v / v) of CO 2 continuously entered the upper part of the anaerobic flask through a 0.22 - μm filter. A silicone tube was used at one end of the three - way valve and discharged from the other end, and the gas flow rate was 0.3 vvm. All treatments were performed in triplicate.

[0158] In this example, Chlorella vulgaris (FACHB - 5) was purchased from the Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan.

[0159] Example 5

[0160] This example provides an application of recombinant MlCA, which is basically the same as Example 4, except that the final concentration of recombinant MlCA in the co - culture system was set as: low concentration 10 mg / L (Low MlCA).

[0161] Comparative Example 1

[0162] A culture system was established in an autoclaved flask. In an illuminated incubator at a temperature of 25 °C, the system was irradiated with a cool white fluorescent lamp of 2000 Lux, and the light - dark cycle was 12 / 12 h. The medium used was a modified BG11 medium without Na 2 CO 3 , with a total volume of 50 mL. The culture used a 2.5% microalgae inoculum. 20% (v / v) of CO 2 continuously entered the upper part of the anaerobic flask through a 0.22 - μm filter. A silicone tube was used at one end of the three - way valve and discharged from the other end, and the gas flow rate was 0.3 vvm. All treatments were performed in triplicate (this comparative example was marked as the "CK" group).

[0163] For Examples 4 - 5 and Comparative Example 1 above, the effects of microalgae fixing CO 2 were analyzed from multiple aspects as follows:

[0164] (1) Microalgae cell density determination

[0165] Method for determining microalgae cell density:

[0166] The cell density of the microalgae in Examples 4 - 5 and Comparative Example 1 was determined, and the specific determination method is as follows:

[0167] The algal cell density and OD were measured by the hemocytometer method and spectrophotometry respectively 670 .

[0168] Take a clean hemocytometer, use a pipette to take a little well - mixed microalgae solution to be measured in the counting chamber area, then cover the counting chamber with a coverslip in the center. After standing for 10 min, wait for the algal solution to seep into the counting chamber by itself and then start counting. Place the hemocytometer on the stage, find the small grid network with a low - power microscope and then switch to a high - power microscope for observation and counting. Use a counting plate with a 25×16 specification, count the microalgae cells in the four corners (upper left, lower left, upper right, lower right) and the 4×4 small grids in the middle. Calculate the number of cells contained in each mL of algal solution through formula (3).

[0169]

[0170] In the formula: CD is the cell density, cell·mL- 1 ; N is the total number of cells in 80 small grids, cell.

[0171] Take 200 μL of algal solution, use pure water as the blank, and measure the absorbance value at a wavelength of 670 nm.

[0172] The curve of microalgae cells and OD 670 is shown as follows. The curve equation is y = 30.18x + 1.05, where x is the absorbance value measured at a wavelength of 670 nm and y is the microalgae cell density.

[0173] Results of microalgae cell density determination:

[0174] As Figure 8 shown, the growth of Chlorella is affected by different concentrations of CA. Under the culture conditions of different concentrations of CA, the initial growth of Chlorella cells is rapid, reaching the fastest on the 6th day with the steepest growth curve, reaching the peak on the 8th day, and slightly slowing down on the 10th day. On the 10th day, the cell densities of the Low / High MlCA groups are 17.05×10 6 and 18.85×10 6 respectively, which are significantly higher than those in Comparative Example 1 (the Low / High MlCA groups are 1.3 and 1.4 times that of the CK group respectively).

[0175] (2) Microalgae protein analysis

[0176] Protein analysis was performed on the microalgae in Examples 4-5 and Comparative Example 1. The specific measurement methods and results are as follows:

[0177] Microalgae protein analysis method:

[0178] Microalgae cells were disrupted using a high-pressure homogenizer (Constant system, One-Shot Model, UK) at a pressure of 30 kpsi. The cell extract and precipitate were separated by centrifugation at 8000×g for 15 min. Using bovine serum albumin (BSA) as a standard, the protein content was determined using the BioRad protein assay. According to the formula Y(OD 595 ) = 0.0012X (mg / L) - 0.0038, the calibration curve of the absorption of OD 595 and the concentration (mg / L) was obtained.

[0179] Microalgae protein analysis results:

[0180] The effects of different concentrations of CA on the protein concentration of Chlorella are shown in Figure 9 . The research results show that the protein concentration of Chlorella cultured with exogenous CA increased significantly, especially from the second day. The protein content of Comparative Example 1 increased slowly with a small amplitude. In contrast, the protein content of Chlorella treated with Low MlCA and High MlCA gradually increased and reached peaks on the tenth day, which were 0.054 and 0.062 mg / mL respectively, increasing by 1.64 times and 1.88 times respectively compared with Comparative Example 1.

[0181] (III) Determination of microalgae biomass concentration and CO 2 fixation rate

[0182] The microalgae in Examples 4-5 and Comparative Example 1 were subjected to biomass concentration and CO 2 fixation rate determination. The specific measurement methods and results are as follows:

[0183] Microalgae biomass concentration and CO 2 fixation rate determination method:

[0184] During the 8-day cultivation period, microalgae biomass was collected every other day to monitor the growth situation. Microalgae cells were collected by centrifugation at 7000×g for 5 min. The cell precipitate was washed with distilled water and freeze-dried. The biomass concentration was determined by the gravimetric method. Weigh the empty weight m 0 of the centrifuge tube, take 10 mL of the algal solution, centrifuge at 10000 rpm for 10 min, discard the supernatant, place the harvested algal sludge in a -20°C refrigerator, and then freeze-dry it. Weigh the weight m 1 of the centrifuge tube. The dry weight was calculated by Equation (Equation 2):

[0185] M = (m1 - m0) / V (Equation 2)

[0186] Where: M is the dry weight, g / L; m 1 is the weight of the empty centrifuge tube before the experiment, g; m 0 is the weight of the centrifuge tube containing microalgae after freeze-drying, g; V is the volume of the algal solution sampled, L.

[0187] CO 2 fixation rate (R CO2 mg L -1 d -1 ) is determined according to the following formula:

[0188] P X ×X cbm ×(M CO2 / M C )

[0189] Wherein, P X is the biomass productivity (mg / L -1 d -1 ), X cbm is the C (%) determined by elemental analysis, M CO2 and M C are the molecular weights of CO 2 and C, respectively.

[0190] Microalgae biomass concentration and CO 2 fixation rate measurement results:

[0191] Figure 10 Describes the biomass concentration and maximum CO 2 fixation rate of Chlorella on the 10th day of cultivation at different CA concentrations. The growth of Chlorella in the high CA group was the best, and the biomass concentration and carbon fixation rate were 1.007 g / L and 1.702 g / L / d, respectively, which was 18.2% higher than that of Comparative Example 1.

[0192] (IV) Determination of microalgae pigment content

[0193] The microalgae pigment content of Examples 4 - 5 and Comparative Example 1 was measured. The specific measurement methods and results are as follows:

[0194] Microalgae pigment content measurement method:

[0195] Centrifuge 1 mL of the microalgae culture at 2000×g for 10 minutes, then resuspend the cells in 1.0 mL of methanol and incubate for 30 min at 45 °C in the dark. The methanol extract (supernatant) was collected after centrifugation at 12500×g for 10 min, transferred to a 96-well microplate, and the absorbance at wavelengths of 649, 665, and 750 nm was measured using a spectrophotometer. The relationship between the optical density and the pigment concentration was calculated by a mathematical algorithm. All experiments were conducted independently with three replicates. Chlorophyll a and chlorophyll b were estimated according to the following formulas:

[0196] Chla (mg / L) = -5.19×(A 649 -A 750 ) + 13.36×(A 665 -A 750 )

[0197] Chlb (mg / L) = 27.43×(A 649 -A 750 ) - 8.12×(A 665 -A 750 ).

[0198] Results of microalgae pigment content determination:

[0199] As Figure 11 shown, different concentrations of CA had an impact on the contents of chlorophyll (a and b) in Chlorella vulgaris. The chlorophyll a contents under Low / High MlCA treatments were 1.968 mg / mL and 1.948 mg / mL, respectively, which were 1.36-fold and 1.35-fold higher than that of Comparative Example 1. The chlorophyll b contents were 1.053 mg / mL and 1.284 mg / mL, respectively, which were 1.40-fold and 1.71-fold higher than that of Comparative Example 1. This indicates that CA is beneficial to the synthesis of chlorophyll in Chlorella vulgaris, thereby improving the photosynthetic efficiency.

[0200] (V) Determination of microalgae lipid content

[0201] The lipid contents of the microalgae in Examples 4-5 and Comparative Example 1 were determined, and the specific determination methods and results are as follows:

[0202] Method for determining microalgae lipid content:

[0203] The lipid content in microalgae was analyzed by Nile red staining. Dilute the microalgae cell solution OD 680It was 0.2, and then stained with 5 μg / mL Nile red dye (50 μg / mL in acetone) and 20% (v / v) DMSO. The samples were incubated in the dark at 40 °C for 10 min and shaken at 150 rpm. After staining, the samples were transferred to a black 96-well plate, and the fluorescence was measured on a spectrofluorometer (M2, Molecular Devices, USA) at excitation and emission wavelengths of 530 nm and 575 nm. The calibration curve was prepared using soybean oil as the standard solution, diluted to 0 - 400 mg / L. The calibration curve between the Nile red fluorescence intensity (a.u.) and the oil concentration (mg / L) was converted according to the formula Y (a.u.) = 0.794X (mg / L) - 28.6. All experiments were conducted independently in triplicate.

[0204] Determination results of microalgae lipid content:

[0205] As Figure 12 shown, it reveals the effects of different concentrations of CA on the lipid concentration of Chlorella vulgaris. Compared with Comparative Example 1, the lipid concentrations of the groups under Low / High MlCA treatments were 107.768 and 110.136 mg / mL respectively (1.02 times and 1.05 times that of the CK group).

[0206] (VI) Determination of RuBisCO activity, A-CoA activity and ROS level

[0207] At the end of the experiment, the enzyme activities of RuBisCO and acetyl-CoA of the microalgae in Examples 4 - 5 and Comparative Example 1 were measured. The specific measurement methods and results are as follows:

[0208] Methods for determining RuBisCO activity, A-CoA activity and ROS level:

[0209] The enzyme-linked immunosorbent assay (ELISA) kits produced by Nanjing Jiancheng Bioengineering Research Institute Co., Ltd., China were used to determine the activities of RuBisCO and acetyl-CoA. In addition, the level of reactive oxygen species (ROS) in microalgae cells was evaluated using a DCFH-DA (2′,7′-dichlorodihydrofluorescein diacetate) cellular ROS detection kit provided by the same supplier.

[0210] Determination results of RuBisCO activity, A-CoA activity and ROS level:

[0211] As Figure 13As shown, compared with Comparative Example 1, the RuBisCO activity treated by the Low / High MlCA group increased significantly (p<0.01), reaching 3.41 and 4.49 U / L respectively, which were 1.15 and 1.51 times that of Comparative Example 1. Compared with Comparative Example 1, the acetyl-CoA activity treated by the Low / High MlCA group also increased significantly (p<0.05), and the acetyl-CoA activity treated by the high CA was higher than that treated by Low MlCA (p<0.01). It can be seen from this that High MlCA is beneficial to microalgae for CO fixation 2 .

[0212] The accumulation of ROS is the response of microalgae to some adverse conditions (such as stress, toxicity and nutrient deficiency). The results showed that CA could reduce the ROS level (p<0.05), especially in the high CA treatment.

[0213] (VII) Multi-omics analysis

[0214] (1) Provide the analysis of microalgae metabolomics

[0215] Perform metabolomics analysis on the microalgae in Examples 4-5 and Comparative Example 1. The specific measurement methods and results are as follows:

[0216] Microalgae metabolome analysis method:

[0217] Use the non-targeted LC-MS method to analyze the components of Chlorella at 6 days. The identification of all metabolites is the putative level 2 of the Metabolomics Standards Initiative - obtained through the HMDB database. Grind 100 mg of microalgae liquid with liquid nitrogen, and the homogenate is fully vortexed and resuspended in pre-cooled 80% methanol and 0.1% formic acid, incubated on ice for 5 min, and then centrifuged at 15000×g for 20 min at 4°C. The supernatant is diluted with LC-MS grade water to a final concentration containing 53% methanol. Then transfer the sample to a new Eppendorf tube and centrifuge at 15000×g for 20 minutes at 4°C. Finally, inject the supernatant into the LC-MS / MS system for analysis.

[0218] The ultra-high performance liquid chromatography-mass spectrometry / mass spectrometry analysis was jointly completed by the Vanquish ultra-high performance liquid chromatography system (ThermoFisher, Germany) and the Orbitrap Q ExactiveTM HF-X mass spectrometer (ThermoFisher, Germany) of Shanghai Ling'en Biotechnology Co., Ltd.

[0219] The sample was injected through a Hypesil Gold chromatographic column (100×2.1 mm, 1.9 μm) at a flow rate of 0.2 mL / min with a linear gradient of 17 min. Eluent A (0.1% FA in water) and B (methanol) were used in the positive polarity mode, while eluent A (5 M ammonium acetate, pH 9.0) and B (methanol) were used in the negative polarity mode.

[0220] The solvent gradient was set as follows: 2% B for 1.5 min; m / z = 1, 2 - 100% B for 12.0 min; 100% B for 14.0 min; 100 - 2% B for 14.1 min; 2% B for 17 min. Eluent A (0.1% FA in water) and B (methanol) were used in the positive polarity mode, while eluent A (5 m ammonium acetate, pH 9.0) and B (methanol) were used in the negative polarity mode.

[0221] The Q ExactiveTM HF-X mass spectrometer was operated in positive / negative polarity mode with a spray voltage of 3.2 kV, a capillary temperature of 320 °C, a sheath gas flow rate of 40 arb, and an auxiliary gas flow rate of 10 arb.

[0222] Results of microalgae metabolome analysis:

[0223] To explore the changes in metabolic fluxes, non-targeted metabolomics analysis was performed on the control group of Comparative Example 1, Low and High MlCA groups. A total of 917 metabolites were identified, including lipids and lipid-like molecules, nucleosides, nucleotides and analogs, organic oxygen compounds, organic acids and derivatives, benzenes, phenylpropanoids and polyketides, organic heterocyclic compounds, lignins, neolignins and related compounds, alkaloids and derivatives, organic nitrogen compounds, hydrocarbon derivatives, etc. Principal component 1 (PC1) accounted for 44.7%, and component 2 (PC2) accounted for 26.6%.

[0224] A variable importance in projection score greater than 1 and a P-value less than 0.05 were used as strict criteria for screening significantly different metabolites. It should be noted that the volcano plot ( Figure 14 ) highlighted the main differences in metabolites with high FC values. The results showed that there were 130 and 191 metabolites upregulated, and 152 and 155 metabolites downregulated in the Low MlCA_vs._CK group and High MlCA_vs._CK group, respectively.

[0225] Specifically, in the Low MlCA_vs._CK group, the main significant differences in metabolites with higher FC values were classified into the following categories: adenosine-5'-monophosphate, uridine-5'-monophosphate (UMP), LysoPE 18:2 (2n isomer), N',N”-DiFeruloylspermidine, 2'-deoxyinosine, oleoylethanolamide, uridine-5'-monophosphate, 2'-deoxyadenosine-5'-monophosphate, glycerophospho-N-palmitoylethanolamine, and xanthine. While in the High MlCA_vs._CK group, they included octadec-9-ynoic acid, D-glucose-6-phosphate, canthaxanthin, thymol, psoralen, eicosapentaenoic acid, uridine monophosphate (UMP), xanthine, dCMP, and 7-(2-thienyl)[1,2,4]triazolo[4,3-a]pyrimidine.

[0226] In addition, through the Venn analysis of upregulated metabolites ( Figure 15 a), a total of 66 core enriched metabolites were identified, such as oleoylethanolamide, cysteinylglycine, O-phospho-L-serine, N-trimethylglycine, L-glutamic acid, L-aspartic acid, L-(-)-methionine, N-isovaleryl glycine, 3-methylcrotonylglycine, etc., and were visually represented in the heatmap in ( Figure 15 b). These metabolites spanned multiple superclasses in the Human Metabolome Database (HMDB), including alkaloids and their derivatives, benzenoids, lipids and lipid-like molecules, nucleosides, nucleotides and analogs, organic acids and their derivatives, organic nitrogen compounds, organic oxygen compounds, and organic heterocyclic compounds. Notably, these results indicated that there were significant differences in the metabolite profiles between the CA group and Comparative Example 1, highlighting the different regulatory effects of CA supplementation on key metabolic pathways.

[0227] Such as Figure 16As shown, the present invention lists the top 30 enriched pathways that change according to GO annotation. Biosynthesis of plant secondary metabolites, biosynthesis of amino acids, biosynthesis of alkaloids derived from the shikimic acid pathway, purine metabolism, biosynthesis of secondary metabolites, nucleotide metabolism, 2-oxocarboxylic acid metabolism, biosynthesis of aminoacyl-tRNA, carbon metabolism, biosynthesis of phenylalanine, tyrosine and tryptophan, biosynthesis of terpenes and steroids, biosynthesis of cofactors, biosynthesis of histidine and purine alkaloids, glyoxylate and dicarboxylic acid metabolism, biosynthesis of isoquinoline alkaloids, tryptophan metabolism, alanine, aspartate and glutamate metabolism, citric acid cycle, glycine, serine and Threonine metabolism, serine and threonine metabolism, methane metabolism, plant hormone signal transduction, zeatin biosynthesis, ornithine alkaloid biosynthesis, lysine biosynthesis, phenylpropionic acid biosynthesis, α-linolenic acid metabolism, ascorbic acid and aldehyde acid metabolism, cyanoamino acid metabolism, glucuronide biosynthesis, biosynthesis of neomycin, kanamycin and gentamicin, starch and sucrose metabolism, benzene compounds, lipids and lipid molecules, nucleosides, nucleotides and analogs, organic acids and their derivatives, organic nitrogen compounds, organic oxygen compounds, organic heterocyclic compounds, as well as phenylpropanoids and polyketides. Specifically, central carbon metabolism plays an important role in microalgae cell growth and nutrient absorption.

[0228] (2) Provide microalgae transcriptome analysis

[0229] The transcriptome analysis was performed on the microalgae of Examples 4 to 5 and Comparative Example 1. The specific measurement methods and results are as follows:

[0230] Microalgae transcriptome analysis methods:

[0231] Extract RNA:

[0232] Used according to the manufacturer's instructions (Invitrogen) Total RNA was extracted from tissues using 500 μg / ml RNA extraction reagent. Genomic DNA was subsequently removed using DNase I (TaKara). RNA quality was assessed using a 2100 Bioanalyzer (Agilent) and quantified using ND-2000 (NanoDrop Technologies). Only high-quality RNA samples (OD 260 / 280 =1.8~2.2,OD 260 / 230 ≥2.0, RIN ≥6.5, 28S:18S ≥1.0, >10μg) were used to construct sequencing libraries.

[0233] Library preparation and Illumina HiSeq sequencing:

[0234] The RNA-seq transcriptome library was generated from 1 μg of total RNA using the TruSeqTM RNA Sample Preparation Kit from Illumina (San Diego, CA). Messenger RNA was isolated by polyA selection using oligo(dT) beads and then fragmented with fragmentation buffer. The entire process included cDNA synthesis, end repair, A-base addition, and ligation of Illumina-tagged adapters according to the Illumina protocol. These libraries were size-selected for cDNA target fragments of 200 - 300 bp using 2% Low Range Ultra Agarose and then PCR amplified for 15 cycles using Phusion DNA polymerase (NEB). After quantification with TBS380, the libraries were sequenced using the Illumina NovaSeq 6000 platform (150 bp * 2, Shanghai Biozeron Biotechnology Co., Ltd).

[0235] Read quality control and mapping:

[0236] The raw paired-end reads were trimmed and quality-controlled using Trimmomatic software with the specified parameters (SLIDINGWINDOW:4:15 MINLEN:75) (version 0.36 http: / / www.usadellab.org / cms / uploads / supplementary / Trimmomatic). The resulting clean reads were individually aligned to the reference genome in the stranded mode using hisat2 (https: / / ccb.jhu.edu / software / hisat2 / index.shtml) software with default parameters. The data were quality-assessed using qualimap_v2.2.1 (http: / / qualimap.bioinfo.cipf.es / ). Gene reads were then determined using htseq (https: / / htseq.readthedocs.io / en / release_0.11.1 / ).

[0237] Differential gene expression and functional enrichment analysis:

[0238] To identify differentially expressed genes (DEGs) between two different samples, the expression level of each gene was quantified using Fragments Per Kilobase of exon per Million reads mapped (FPKM) method. Differential expression analysis was performed using the R statistical software package edgeR (Empirical analysis of Digital Gene Expression in R, available at http: / / www.bioconductor.org / packages / release / bioc / html / edgeR.html / ). The criteria for selecting DEGs were as follows: fold change greater than 2 and false discovery rate (FDR) less than 0.05. To gain insights into the functions of the identified differentially expressed genes, functional enrichment analysis of Gene Ontology (GO) terms and KEGG pathways was performed.

[0239] Identification of alternative splicing events:

[0240] Alternative splicing events occurring in the samples were detected using Multivariate Analysis of Transcript Splicing (MATS, available at http: / / rnaseq-mats.sourceforge.net / ). Specifically, only isoforms similar to the reference or containing novel splicing junctions were considered. This analysis revealed various types of splicing differences, including exon inclusion, exclusion, alternative 5' and 3' splice sites, and intron retention events.

[0241] Results of microalgae transcriptome analysis:

[0242] Compared with CK, the functions involved in genes significantly upregulated in the Low MlCA treatment included ( Figure 17: Containing kelch domain, rae1, hypothetical protein CEUSTIGMA_g3362.t1, Ankyrin repeat domain, histone-lysine N-methyltransferase ATX2-like, DNA-directed RNA polymerase II subunit 1, Interferon-induced 44 family, glutathione peroxidase, melanotransferrin isoform X1, transcriptional regulator isoform A, 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase isoform B, ribulose-1,5-bisphosphate carboxylase / oxygenase, 4-toluenesulfonate uptake permease, DEAD-box ATP-dependent RNA helicase 7, cobalamin synthesis, nicked-like protein, 200 kDa antigen p200, UPF0187 chloroplast, PSII polypeptide, ribulose-1,5-2-phosphate carboxylase / oxygenase, phosphate transporter, lectin heavy chain, epimerase isoform C, metallothionein-like protein type 2B, phosphatidic acid phosphatase-related, TATA-binding associated factor 172. The functions involved in the genes significantly up-regulated in the high CA treatment include: rae1, DNA-directed RNA polymerase II subunit 1, melanotransferrin isoform X1, uncharacterized protein LOC100092203, histone-lysine N-methyltransferase ATX2-like, hypothetical protein Lal_00015036, ATP-binding kinase, GM16910, mitochondrial uncoupling 1-like, phosphate transporter, basic proline-rich protein-like, Kelch domain-like.

[0243] In addition, through the Venn analysis of the up-regulated genes ( Figure 18 a), a total of 1949 core genes were identified. Two genes significantly up-regulated after MlCA treatment (P < 0.01) were also compared and functionally annotated, and the top 50 logFC are as Figure 18As shown in Figure b. These genes are mainly involved in the following functions: BRAE1, DNA-directed RNA polymerase II subunit 1, melanotransferrin isoform X1, histone-lysine N-methyltransferase ATX2-like, ATP-binding kinase, mitochondrial uncoupling 1-like, phosphate transporter, kelch domain-containing, glutathione peroxidase, hypothetical protein CEUSTIGMA_g3362.t1, Ankyrin repeat domain, hypothetical protein C2E21_8597, ABC multidrug resistance-related, cobalamin synthesis, dopamine beta-monooxygenase (ISS), transcriptional regulator isoform A, interferon-induced 44 family, hypothetical protein PILCRDRAFT_805525, 200 kDa antigen p200, TATA-binding associated factor 172, LOV domain-containing, UPF0187 chloroplast, ATP-binding cassette sub-family G member 2, HD repeat domain-containing isoform B, importin subunit alpha-7, chloroplast UPF0187, H(+) hexose cotransporter 2, plant late embryogenesis abundant (LEA)-related, DUF563 domain, phosphatidylcytidylate transferase, UDP pyrophosphorylase, DNA repair rad18, late embryogenesis abundant family, putative LOV domain-containing protein, DEAD-box ATP-dependent RNA helicase 7, nicked-like protein, domain-containing protein, NAD-dependent aldehyde dehydrogenase, and UPF0187 chloroplast protein.

[0244] As Figure 19 shown, compared with CK, the enriched pathways obtained by the two CA treatments include the following: nucleocytoplasmic transport, alpha-linolenic acid metabolism, beta-alanine metabolism, pentose and glucuronate interconversions, non-homologous end joining, microbial metabolism in different environments, carbon metabolism, autophagy - others, fatty acid degradation, biosynthesis of nucleotide sugars, glycolysis / glycogenesis, glutathione metabolism, nitrogen metabolism, other sugar degradations, base excision repair, citric acid cycle, carbon fixation in photosynthesis, niacin and nicotinamide metabolism, ascorbate and aldarate metabolism, phagosome, arginine biosynthesis, sulfur relay system, amino sugar and nucleotide sugar metabolism, nucleotide excision metabolism, glycerophospholipid metabolism, thiamine metabolism, arginine and proline metabolism, photosynthesis - antenna proteins, homologous recombination, DNA replication.

[0245] As Figure 20 shown, through the co-occurrence network, 923 associations were successfully discovered among 767 core enriched metabolites / genes. The analysis indicates that these taxa may play a key role in the CO 2 fixation process of microalgae, forming six ecological modules composed of sub-networks of mutually symbiotic metabolites / genes.

[0246] As Figure 21As shown, although the research results indicate that the correlation coefficient between the relative abundance of metabolites / genes and the CO 2 fixation rate is not significant (r = 0.34, P > 0.05), modules 1 and 3 show a positive correlation with a significant correlation coefficient (r = 0.81, P < 0.001; r = 0.50, P < 0.05). Therefore, it is considered that the effective fixation rate of CO 2 mainly depends on the combination and interaction of various symbiotic metabolites / genes in modules 1 and 3.

[0247] As Figure 22 shown, the analysis of taxa indicates that six network hubs and module hubs, namely TRINITY_ / DN627_c0_g3, DN9032_c0_g1, DN15612_c0_g1, DN331_c0_g1, DN2698_c0_g1, and DN121_c0_g2, are involved in these functions: peroxisome biogenesis 7, hypothetical protein C2E21_5977, metal-dependent phosphatase, hybrid sensor histidine kinase response regulator, hypothetical protein C2E21_5737, and glutathione peroxidase.

[0248] Through in-depth analysis of transcriptome and metabolome data, genes and metabolites showing differential expression were identified. Then, a detailed correlation analysis was performed on these different genes and metabolites, and finally 106 genes / metabolites with a correlation coefficient equal to or greater than 0.99 were selected. As shown in Table 2, these specific genes and metabolites played a key role in the CO 2 sequestration process in microalgae. For example, regulators of CO 2 response genes, Rubisco activase, ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit N-chloroplast, recombinant carbonic anhydrase, acetyl-CoA, photosystem II, Rieske iron-sulfur subunit of cytochrome b6f chloroplast precursor, cytochrome b6-f complex iron-sulfur chloroplast, light harvesting of photosystem I, reaction center subunit of photosystem I chloroplast, ferredoxin-dependent glutamate synthase isoform B, ferritin chloroplast, Fe-S oxidoreductase, NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 8-B-like, ADP, ATP carrier, chlorophyll a b binding, chlorophyll a oxygenase, and putative plastid lipid-associated chloroplast. This comprehensive analysis provides valuable insights into the complex molecular network related to the CO 2 sequestration process in microalgae, revealing the key regulatory factors and components contributing to this important biological mechanism.

[0249] As Figure 23 , 24 shown, based on transcriptomics and metabolite profiling, a simplified recombinant MlCA condition for CO 2The carbon metabolism process scheme with a fixed rate involves 79 pathways. This scheme reasonably and clearly shows the process of carbon metabolism, mainly including photosynthesis, the TCA cycle, nitrogen metabolism, pantothenic acid and CoA, amino acid, and fatty acid biosynthesis. Specifically, the carbon metabolic pathway includes eight metabolites: citric acid, α-ketoglutaric acid, L-glutamic acid, O-phospho-L-serine, mesocarbonic acid, D-erythrose-4-phosphate, phosphoenolpyruvate, and 10-formyl-THF, involving a total of 255 genes. In the α-linolenic acid metabolic pathway, three metabolites - methyl jasmonate, jasmonic acid, 13(S)-HOTrE:C16316 - and 22 genes were found. The citric acid cycle (TCA cycle) involves four metabolites: citric acid, α-ketoglutaric acid, cis-aconitic acid, and phosphoenolpyruvate, with a total of 61 related genes. In terms of carbon fixation in photosynthetic organisms, there are two metabolites - D-erythrose-4-phosphate and phosphoenolpyruvate, involving 79 genes. The carbon metabolic pathway includes citric acid, α-ketoglutaric acid, L-glutamic acid, O-phospho-L-serine, mesocarbonic acid, D-erythrose-4-phosphate, phosphoenolpyruvate, and 10-formyl-THF, involving a total of 255 genes. This comprehensive analysis reveals the intricate connection between gene expression differences and plant growth.

[0250] As Figure 25 shown, the increase in photocurrent caused by the recombinant MlCA treatment may be attributed to the fact that CA promotes the CO 2 fixation of microalgae and increases the electron extraction rate. As Figure 26 shown, the larger photosynthetic current intensity of High MlCA may be attributed to stronger biofilm adhesion or more efficient extracellular electron transfer paths. Compared with CK, the extracellular photosynthetic electron transfer ability of Chlorella vulgaris grown under the High MlCA condition is stronger.

[0251] The recombinant Escherichia coli of the present invention uses Escherichia coli BL21(DE3) as the host cell to construct a novel whole-cell biocatalyst. First, using the green fluorescent protein gene (sfGFP) as the reporter gene, under the regulation of the promoter library synthesized by the pSB1C3 vector, the strength characteristics of the promoter in initiating transcription in Escherichia coli were detected using the promoter library synthesized by the pSB1C3 vector. Subsequently, the Top1 - Top4 plasmids with the best transcriptional performance were transformed into Escherichia coli to obtain four CA engineering strains, namely the recombinant Escherichia coli Top1 - Top4 in the present invention, and the optimal characteristics were further determined by studying the enzyme activity at different times, temperatures, and pH values. Finally, the recombinant MlCA was used to promote the CO 2It was fixed, and biosynthesis indexes, key enzymes, and electron extraction rates were measured. Meanwhile, transcriptome and metabolome were used to explore specific enrichment pathways, and verification experiments were carried out. It provides rich gene components for constructing high-expression Escherichia coli vectors and offers an environmentally friendly and low-cost alternative method for future carbon capture and storage (CCS).

[0252] The above content gives a schematic description of the present invention and its implementation manners. This description is not restrictive. What is shown in the embodiments is only one of the implementation manners of the present invention, and the actual implementation manners are not limited thereto. Therefore, if those of ordinary skill in the art are inspired by it and, without departing from the gist of the present invention, design implementation manners and embodiments similar to this technical solution without creative efforts, they shall fall within the protection scope of the present invention.

[0253] Table 2 Select 106 differentially expressed genes with a correlation coefficient ≥ 0.99 and involved in the microalgae CO 2 sequestration process for correlation analysis with metabolites

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

Claims

1. The use of a promoter in expressing recombinant M1CA, characterized in that: The application comprises the following steps: P1, constructing an expression vector, using the promoter to construct the vector, and using the CA gene MlCA of Interrhizobium truncatum as the target gene; the nucleotide sequence of the MlCA is shown in SEQ ID: NO 97; P2, constructing engineered bacteria, transforming the expression vector in P1 into Escherichia coli to obtain engineered bacteria; P3, inducing the expression of recombinant MlCA, culturing the engineered bacteria in P2, using IPTG as an inducer to induce the engineered bacteria to express recombinant MlCA; The promoter is selected from one of the following nucleic acids: (1) a nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 85; (2) a nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 80; (3) A nucleic acid having a nucleotide sequence as shown in SEQ ID: NO 62.

2. The use according to claim 1, characterized in that: The promoter has a nucleotide sequence as shown in SEQ ID: NO 80.

3. The use according to claim 1 or 2, characterized in that: The concentration of IPTG is 0.2-1 mM.

Images