Method and application of CsERF1 gene to improve resistance to citrus canker

Abstract

The invention discloses a method and application of CsERF1 gene for improving resistance to citrus canker, and relates to the field of agricultural biological genes. Application of CsERF1 gene in improving resistance to citrus canker, the nucleotide sequence of CsERF1 gene is shown as SEQ ID No.1. The method of CsERF1 gene for improving resistance to citrus canker comprises the following steps: (1) cloning citrus CsERF1 coding sequence; (2) constructing CsERF1 overexpression vector; (3) transforming citrus with CsERF1 overexpression vector, and obtaining transgenic plants after cultivation. The invention improves resistance to citrus canker based on CsERF1 overexpression, by cloning citrus CsERF1 coding sequence, constructing overexpression vector, and then transforming citrus, the obtained transgenic plants can greatly reduce the incidence of canker, significantly reduce the incidence of canker, and reduce the area of ​​lesions.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological genes, and in particular to a method and application of CsERF1 gene to improve resistance to citrus canker. Background Art

[0002] Citrus canker has seriously hindered the healthy development of the citrus industry (Hu Junhua et al., 2015). Citrus canker is caused by Xanthomonas citrisubsp.citri (Xcc). The canker bacteria mainly infect citrus leaves, branches, fruits, etc., among which seedlings and young trees are more seriously affected (He Xiuling et al., 2007). Diseased trees will experience leaf drop, dead branches, weak tree vigor, and fruit drop, which seriously affects the yield and quality of citrus. There are dozens of Rutaceae plants affected by citrus canker, most of which are economic cultivars. Studies have found that sweet oranges are most susceptible to the disease, followed by sour oranges and grapefruits (Yuan Chengdong et al., 1997; Li Min et al., 2013).

[0003] At present, comprehensive prevention and control strategies are usually adopted to control the damage of citrus canker, with chemical control as the main method and biological control as the auxiliary method. However, since chemical control measures are not environmentally friendly, they are very likely to cause environmental pollution, and require a lot of manpower and material resources, and biological control has poor effects and high costs, it is urgent to reduce the losses caused by canker by breeding new disease-resistant varieties (Chen Li et al., 2008; Zhu Xuemei et al., 2017). The long hybrid breeding cycle makes breeding efficiency low. With the rise of molecular biology, people began to study the pathogens themselves and the disease resistance of plants from the direction of disease-resistant genetic engineering. Genetic engineering methods have also been tried in the study of anti-ulcer disease (Duan Minjie et al., 2016; Jia Ruirui et al., 2017), and some transgenic materials resistant to canker disease have been obtained. For example, Chen Shanchun et al. obtained Jincheng, Xinhuicheng and Navelcheng orange lines that were resistant to citrus canker by carrying the antimicrobial peptide D gene of the silkworm (Chen Shanchun et al., 1996); the exogenous genes NLS, chit42, Xa21 and PthA were resistant to citrus canker after being transferred to Bingtangcheng, Ponkan and Sweet Orange (Mendes et al., 2010; Yang et al., 2011); CsBZIP40 is an important transcription factor that responds to citrus canker infection, and it is speculated that it affects the resistance of citrus varieties through the SA pathway (Li et al., 2017); the CsLOB1 gene, as a target protein of the canker pathogen gene PthA, makes citrus more sensitive to canker (Li et al., 2014); CRISPR / Cas9 targeted knockout of the promoter of the citrus canker susceptible gene CsLOB1 can obtain plants with improved resistance to citrus canker (Penget al., 2017).

[0004] Ethylene-responsive factor (ERF) transcription factors are one of the largest classes of transcription factors in eukaryotes (Zhang Qi et al., 2018), and play an important role in plant growth, development, and response to abiotic and biotic stresses. For example, poplar PtaERF003 has a positive effect on adventitious root and lateral root proliferation (Trupiano et al., 2013); overexpression of ZmEREBP60 in corn can improve the tolerance of transgenic plants to drought stress (Zhu et al., 2022); overexpression of StERF94 in potato enhances potato resistance to solanum wilt (Charfeddin et al., 2019). At present, there is no research and application of using ERFs to improve citrus resistance to citrus canker. Summary of the invention

[0005] The technical problem to be solved by the present invention is that the existing citrus fruit trees have poor resistance to ulcer disease. The purpose is to provide a method and application of CsERF1 gene to improve the resistance of citrus canker disease, thereby solving the problem of poor resistance to citrus canker disease.

[0006] The present invention is achieved through the following technical solutions:

[0007] The present invention provides an application of a CsERF1 gene in improving resistance to citrus canker. The nucleotide sequence of the CsERF1 gene is shown in SEQ ID No.1.

[0008] As a possible design, the protein encoded by the above-mentioned CsERF1 gene is a citrus ethylene response factor.

[0009] The present invention also provides a method for improving the resistance of citrus to ulcer disease by using CsERF1 gene, comprising the following steps:

[0010] (1) Cloning the coding sequence of citrus CsERF1;

[0011] (2) Construction of CsERF1 overexpression vector;

[0012] (3) The CsERF1 overexpression vector was used to transform citrus and transgenic plants were obtained after cultivation.

[0013] As a possible design, in the above step (1), the cloning method of the citrus CsERF1 coding sequence is: extracting citrus total RNA, reverse transcribing it into cDNA as a template, using primers OE-CsERF1-F and OE-CsERF1-R to perform PCR amplification and recover the CsERF1 coding sequence DNA fragment, wherein the nucleotide sequences of the primers OE-CsERF1-F and OE-CsERF1-R are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

[0014] As a possible design, in the above step (2), the method for constructing the CsERF1 overexpression vector is as follows: the CsERF1 coding sequence DNA fragment recovered by KpnⅠ and SaLI digestion is ligated to the pLGNe vector recovered by KpnⅠ and SaLI digestion to construct the overexpression vector pLGNe-CsERF1.

[0015] As a possible design, in the above step (3), the method for transforming citrus with the CsERF1 overexpression vector is as follows: the overexpression vector pLGNe-CsERF1 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens.

[0016] As a possible design, the citrus explant cells after the above genetic transformation were also identified by GUS staining, PCR identification and qRT-PCR analysis of CsERF1 expression.

[0017] As a possible design, the primers for PCR identification of transgenic plants are: ID-CsERF1-F and ID-CsERF1-R, wherein ID-CsERF1-F is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsERF1-R is designed based on the terminal sequence of the CsERF1 gene. The nucleotide sequences of ID-CsERF1-F and ID-CsERF1-R are shown in SEQ ID No. 4 and SEQ ID No. 5, respectively.

[0018] As a possible design, the primers for the above qRT-PCR analysis of CsERF1 expression are: RT-CsERF1-F and RT-CsERF1-R, and the nucleotide sequences of RT-CsERF1-F and RT-CsERF1-R are shown in SEQ ID No. 6 and SEQ ID No. 7, respectively.

[0019] As a possible design, the above transgenic plants were also evaluated for resistance, and it was determined that CsERF1 overexpression improved resistance to citrus canker.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0021] The invention improves the resistance to citrus canker based on overexpression of CsERF1. By cloning the citrus CsERF1 coding sequence, constructing an overexpression vector, and then transforming the citrus, the obtained transgenic plants can greatly reduce the incidence of canker. Specifically, the disease index can be reduced to 71.6% of the existing citrus, and the diseased area can be reduced to 65.6% of the existing citrus, significantly reducing the incidence of canker and reducing the area of ​​lesions. The technology of the invention is a potential bioengineering technology for improving the resistance to citrus canker, and has great value for molecular breeding of citrus resistance to canker. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings:

[0023] Figure 1 This is the electrophoresis diagram of PCR amplification of the CsERF1 gene clone according to the embodiment of the present invention: M is a DNA molecular weight standard, the same below.

[0024] Figure 2 This is a diagram of the structure of the CsERF1 plant overexpression vector of an embodiment of the present invention: GUS, β-glucosidase gene; CaMV 35S, plant constitutive promoter derived from cauliflower mosaic virus; NOS, opine synthase gene terminator.

[0025] Figure 3 This is a flow chart of citrus genetic transformation according to an embodiment of the present invention.

[0026] Figure 4 This is a GUS staining image of the transgenic plant of the embodiment of the present invention: OE-ERF1-1 and OE-ERF2-2 represent two transgenic plants respectively, WT is a wild-type Wanjin Orange plant, + is a plasmid pLGNe-CsERF1, the same below.

[0027] Figure 5 This is the PCR identification diagram of the transgenic plant of the present invention, + represents the plasmid pLGNe-CsERF1, the same below.

[0028] Figure 6 This is a graph showing the expression level of CsERF1 in the transgenic plants of the present invention: ** indicates a significant difference compared with WT (P=0.01), the same below.

[0029] Figure 7 This is a phenotype diagram of the transgenic plant of the present invention.

[0030] Figure 8 This is a symptom diagram of the transgenic plant leaves of the present invention 14 days after inoculation of ulcer bacteria.

[0031] Fig. 9 This is a statistical diagram of the size of lesions on the leaves of the transgenic plants of the present invention 14 days after being inoculated with canker bacteria.

[0032] Fig.10 This is a statistical graph of the disease index 14 days after the leaves of the transgenic plants of the present invention were inoculated with canker bacteria. DETAILED DESCRIPTION

[0033] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0034] Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] It should be noted that: the embodiment of the present invention uses Wanjin orange as the test object. In practical applications, the method can also be used to improve the resistance of other citrus varieties to ulcer disease.

[0036] Example 1

[0037] Cloning of the coding sequence of Citrus CsERF1

[0038] 1. RNA Extraction and cDNA Synthesis

[0039] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0040] 2. PCR Amplification of CsERF1 Coding Sequence

[0041] The CsERF1 coding sequence was amplified from citrus cDNA using primers OE-CsERF1-F (SEQ ID No. 2), OE-CsERF1-R (SEQ ID No. 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The length of the DNA fragment was 879 bp (including the restriction site) (refer to Figure 1 ), the amplified DNA fragment was sequenced and confirmed to be the coding sequence of the citrus CsERF1 gene (SEQ ID No. 1). Under ultraviolet light, a clean blade was used to cut out the agarose gel block containing the target fragment, and a kit (BioFlux, CAT: BSC02M1) was used to recover the DNA fragment.

[0042] PCR amplification program: 94°C, 5 min; 94°C, 30 s, 58°C, 30 s, 72°C, 1 min, 35 cycles; extension at 72°C for 10 min.

[0043] The nucleotide coding sequence of the citrus CsERF1 gene, SEQ ID No. 1, is as follows:

[0044] ATGTATGGACAGAGTAGGTGTGGTGGGAGTACGAATATGATGCCGTCGGATTATGCGGTGCTGGATTCAGTTCGCCAGCACTTACTCGACGAATCGGAGACTGGACTGAGCAGCGTGTCATCAGCGAGTTCCAAGTCCAACGGGGCTCCCCCTACTTATTGCAGGAGCTCAAGCTTTAGCCGATTGTACCCTTGTCTAACTGACAACTGGGGGGACCTCCCTTTGAGGGAGAACGACTCCGAGGACATGCTTGTCTTTAATTTCTTGCGTGATGCCCTAACAGTTGGATGGGTTCCACAGGAGCAGTTAGCTGAATCTGATCGCCATCAGGTGGCGGAGGCGGCGCCGGCACCGGCGTTACCGGAGGAGCGAGGTGCTCCGGCTCCTGCAGTGGTGCCTTCTAGGGGGAAGCATTACAGGGGGGTGAGGCAGAGACCTTGGGGGAAGTTTGCGGCCGAAATACGTGACCCGGCTAAGAATGGGGCTCGGGTTTGGCTCGGGACTTTCGAGACGGCTGAGGATGCGGCTCTGGCTTATGACCGAGCCGCTTACAGGATGAGGGGATCAAGGGCTCTTTTGAATTTTCCCCTAAGGATCAACTCGGGTGAGCCCGAGCCGGTCAGAATTAAGTCGAAGCGGTCCACGCCGGAGCCGTCTTCGTCCACGGATAGTGGCAGTGTGTCCCCCAAGAGGAGGAGAAAGGTGGCTGCCTTGGCGTCGGTGCCAGTACAAGCCGGGATGAAAATGGAAAGTGGAGTTGGACAAGTGGCGCAAGTGGCCTCCTGTACACGTGGTGACCAGCCATTGGTAAGCTGA

[0045] The nucleotide sequence of primer OE-CsERF1-F, SEQ ID No.2, is as follows:

[0046] GCGGTACCATGTATGGACAGAGTAGGTG

[0047] The nucleotide sequence of primer OE-CsERF1-R, SEQ ID No.3, is as follows:

[0048] GCGTCGACTCACTTATCATCATCATCCTTGTAATCCTTATCATCATCCTTGTAATCGCTTACCAATGGCTGGTC

[0049] Example 2

[0050] Construction of CsERF1 overexpression vector

[0051] Construction of overexpression vector

[0052] The CsERF1 coding sequence DNA fragment and the overexpression vector pLGNe were double digested with restriction endonucleases KpnⅠ and SaLI (ThermoFisher), recovered from the gel and ligated overnight at 4°C using T4 DNALigase kit (Promega, CAT: M1801). The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsERF1 overexpression vector pLGNe-CsERF1 (refer to Figure 2 ).

[0053] Example 3

[0054] Genetic transformation of citrus with CsERF1 overexpression vector

[0055] according to Figure 3 The process shown in the figure is used for citrus genetic transformation, and the specific operations are as follows:

[0056] 1. Obtaining epicotyls of citrus seedlings

[0057] Fresh citrus fruits were washed and surface disinfected with 75% alcohol. The seeds were taken out under sterile conditions, the seed coats were peeled off, and the seeds were germinated on seed germination medium. The seeds were cultured in the dark at 28°C for 2 weeks, and then cultured under 16 h light / 8 h dark conditions for 1 week. The epicotyls of the germinated seedlings were taken under sterile conditions and cut into 1 cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0058] 2. Transformation of Agrobacterium with Overexpression Vector

[0059] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: pre-thaw frozen Agrobacterium competent cells EHA105 (50 μL) on ice; add 2 μL of the plasmid of the overexpression vector to the competent cells, blow and mix, and place on ice for 5 minutes; transfer the mixed solution to the bottom of the pre-dried electric shock cup, put the electric shock cup into the card slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL of LB liquid culture medium to the electric shock cup, blow and mix with a pipette, transfer to a sterile centrifuge tube, and shake and culture at 260 r / min and 28°C for 60 minutes; centrifuge the bacterial solution at 10000 r / min for 1 minute, discard the supernatant (about 100 μL of resuspended bacteria remains), resuspend and apply, and invert and dark culture at 28°C for 2 days; after the growth of plaques, use primers OE-CsERF1-F (SEQ ID No. 2) and OE-CsERF1-R (SEQ ID No.3) PCR verification was performed on single colonies.

[0060] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0061] 3. Preparation of Agrobacterium tumefaciens

[0062] Before transfection, streak the Agrobacterium (containing the pLGNe-CsERF1 vector) for transfection on LB solid medium containing 50 mg / L kanamycin; pick a single colony and inoculate it into 25 mL LB liquid medium containing the same antibiotics, and culture it at 28°C with shaking overnight; dilute the bacterial solution to OD=0.1 and continue to culture it to OD=0.5, centrifuge it at 5000r / min for 10 min, discard the supernatant, and resuspend it in MS liquid medium at pH 5.4 for transfection.

[0063] 4. Transformation of Citrus Epicotyls

[0064] Soak the citrus epicotyl stem segments in Agrobacterium solution for 13 minutes and then wipe them dry. Transfer the stem segments to co-cultivation medium and culture them in the dark at 26°C for 2 days. After the co-cultivation is completed, transfer the epicotyls to the screening medium and culture them in the dark at 28°C for 7 days. Culture the epicotyls at 28°C, 16h light / 8h dark conditions, subculture every two weeks, and then identify them by GUS staining.

[0065] 5. Seedling Culture of Transformants

[0066] When the seedlings grow to more than 1 cm, they are cut and grafted onto late orange seedlings in sterile test tubes and cultured in seedling medium; when the seedlings grow to about 5 cm, they are grafted onto citrus aurantium seedlings and cultured in a 28°C greenhouse.

[0067] The culture medium used in this embodiment is as follows:

[0068] Seed germination medium: MS + 30g / L sucrose + 2.5g / L Gelrite, PH 5.8.

[0069] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4–D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0070] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0071] Seedling medium: MS + 30g / L sucrose, PH 5.8.

[0072] Example 4

[0073] Verification of CsERF1 overexpressing transgenic plants

[0074] 1. GUS staining identification of transgenic plants

[0075] The leaves of the transgenic plants obtained in the initial screening were cut into small pieces and subjected to GUS histochemical staining (24 h). The edges of the leaves of the positive plants showed blue color, while the leaves of the WT plants did not show color (refer to Figure 4 ).

[0076] 2. PCR Identification of Transgenic Plants

[0077] 100 mg of transgenic plant leaves were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsERF1 coding sequence in the citrus genome. The detection primers were ID-CsERF1-F (SEQ ID No. 4) and ID-CsERF1-R (SEQ ID No. 5).

[0078] The results showed that the positive plants could obtain an amplified fragment of 2574 bp, while the WT plants did not amplify (refer to Figure 5 ).

[0079] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0080] The nucleotide sequence of primer ID-CsERF1-F, SEQ ID No. 4, is as follows:

[0081] TCGTTGAAGATGCCTCTGCCGACAG

[0082] Among them, the front primer ID-CsERF1-F for PCR identification of transgenic plants was within 35S.

[0083] The nucleotide sequence of primer ID-CsERF1-R is shown below:

[0084] GCGTCGACTCACTTATCATCATCATCCTTGTAATCCTTATCATCATCCTTGTAATCGCTTACCAATGGCTGGTC

[0085] Among them, the primer ID-CsERF1-R was within the CDS after PCR identification of transgenic plants.

[0086] 3. qRT-PCR Analysis of Transgenic Plants

[0087] Total RNA (Adlai, CAT No: RN09) was extracted from the leaves of transgenic plants, and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsERF1-F (SEQ ID No. 6) and RT-CsERF1-R (SEQ ID No. 7). -△△Ct The relative expression of CsERF1 gene in transgenic plants was calculated by the following method: the water-treated sample was defined as the reference factor, i.e., its CsERF1 expression level was 1, and then the multiple of the gene expression in transgenic citrus relative to the reference factor was calculated. -△△Ct , is its relative expression level.

[0088] The results showed that the CsERF1 gene was expressed at a higher level in the transgenic plants than in the wild-type plants, and was more than 400 times that of the control (refer to Figure 6 ).

[0089] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0090] The nucleotide sequence of primer RT-CsERF1-F is shown in SEQ ID No.6:

[0091] ATGGACAGAGTAGGTGTGGTG

[0092] The nucleotide sequence of primer RT-CsERF1-R is shown in SEQ ID No.7:

[0093] CCGATTCGTCGAGTAAGTGCT

[0094] 4. Phenotypic observation of transgenic plants

[0095] The phenotypes of the two transgenic plants were observed and analyzed, and no obvious abnormalities were found in their appearance and growth (refer to Figure 7 ). This indicates that overexpression of the CsERF1 gene has no significant effect on the phenotype and development of the plant.

[0096] Example 5

[0097] Evaluation of resistance of CsERF1 overexpressing transgenic plants

[0098] The mature leaves of the transgenic plants were washed and disinfected with 75% alcohol and rinsed with sterile water, and placed on a clean bench. The leaves were punctured with needles in the center of the veins, with six needles in a group and two groups on each side. The ulcer pathogen liquid was applied with a pipette, and 1 μL (1X 10 5 CFU / mL); cultured in a 28°C constant temperature and light incubator (16 h light / 8 h dark); photos were taken 10 days after the leaves were spotted with bacteria, and the lesion area was counted using Image J V1.47 software.

[0099] The disease is divided into grades 0-7 according to the area of ​​the lesions, with the letter R representing the lesion area, grade 0 (R ≤ 0.25 mm 2 ), Level 1 (0.25mm 2 <R≤0.5mm 2 ), Level 2 (0.5mm 2 <R≤0.75mm 2 ), Level 3 (0.75mm 2 <R≤1mm 2 ), 4 levels (1.0mm 2 <R≤1.25mm 2 ), 5 levels (1.25mm 2 <R≤1.5mm 2 ), 6 levels (1.5mm 2 <R≤1.75mm 2 ), 7th level (R>1.75mm 2 ); calculate the disease index according to the formula: DI = 100XΣ [number of lesions at each level X corresponding level value] / (total number of lesions X maximum level).

[0100] The results showed that 10 days after inoculation with the ulcer pathogen, the overexpression plants and the WT plants grafted at the same time developed disease to varying degrees, and there were certain differences in the size of the lesions (refer to Figure 8). According to statistics and analysis, the lesion area of ​​transgenic plants was significantly smaller than that of wild-type controls, accounting for 63.6%-65.3% of the controls (refer to Fig. 9 The disease index of transgenic plants was significantly lower than that of wild-type controls, which was 71.1%-71.6% of the controls (refer to Fig.10 ). It can be seen that overexpression of CsERF1 can significantly reduce the lesion area of ​​citrus bacterial canker and alleviate the severity of citrus bacterial canker.

[0101] Therefore, overexpression of CsERF1 can greatly reduce the lesion area of ​​ulcer disease and alleviate the severity of ulcer disease. This gene can be used independently for disease resistance molecular breeding, or it can be used together with other disease resistance or disease susceptibility genes for molecular breeding of citrus ulcer disease resistance.

[0102] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of overexpressing CsERF1 gene in improving resistance to citrus canker, characterized in that: The nucleotide sequence of the CsERF1 gene is shown in SEQ ID No.

1.

2. The use of the overexpressed CsERF1 gene in improving resistance to citrus canker according to claim 1, characterized in that: The protein encoded by the CsERF1 gene is a citrus ethylene response factor.

3. A method for improving citrus resistance to ulcer disease by using CsERF1 gene, characterized in that: The steps include: (1) cloning the citrus CsERF1 coding sequence, wherein the CsERF1 coding sequence is shown in SEQ ID No. 1; (2) Construction of CsERF1 overexpression vector; (3) The CsERF1 overexpression vector was used to transform citrus and transgenic plants were obtained after cultivation.

4. The method for improving citrus resistance to ulcer disease by using CsERF1 gene according to claim 3, characterized in that: In step (1), the cloning method of the citrus CsERF1 coding sequence is: extracting citrus total RNA, reverse transcribing it into cDNA as a template, using primers OE-CsERF1-F and OE-CsERF1-R to perform PCR amplification and recover the CsERF1 coding sequence DNA fragment, wherein the nucleotide sequences of the primers OE-CsERF1-F and OE-CsERF1-R are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

5. The method for improving citrus resistance to ulcer disease by using CsERF1 gene according to claim 3, characterized in that: In step (2), the method for constructing the CsERF1 overexpression vector is as follows: the CsERF1 coding sequence DNA fragment recovered by digestion with KpnⅠ and SaLI is ligated to the pLGNe vector recovered by digestion with KpnⅠ and SaLI to construct the overexpression vector pLGNe-CsERF1.

6. The method for improving citrus resistance to ulcer disease by using CsERF1 gene according to claim 3 or 5, characterized in that: In step (3), the method for transforming citrus with the CsERF1 overexpression vector is as follows: the overexpression vector pLGNe-CsERF1 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens.

7. The method for improving citrus resistance to ulcer disease by using CsERF1 gene according to claim 6, characterized in that: The genetically transformed citrus explant cells were also identified by GUS staining, PCR and qRT-PCR analysis of CsERF1 expression.

8. The method for improving citrus resistance to ulcer disease by using CsERF1 gene according to claim 7, characterized in that: The primers for PCR identification of transgenic plants are: ID-CsERF1-F and ID-CsERF1-R, wherein ID-CsERF1-F is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsERF1-R is designed based on the terminal sequence of the CsERF1 gene. The nucleotide sequences of ID-CsERF1-F and ID-CsERF1-R are shown in SEQ ID No. 4 and SEQ ID No. 5, respectively.

9. The method for improving citrus resistance to ulcer disease by using CsERF1 gene according to claim 7, characterized in that: The primers for qRT-PCR analysis of CsERF1 expression are: RT-CsERF1-F and RT-CsERF1-R, and the nucleotide sequences of RT-CsERF1-F and RT-CsERF1-R are shown in SEQ ID No. 6 and SEQ ID No. 7, respectively.

10. The method for improving citrus resistance to ulcer disease by using CsERF1 gene according to claim 3 or 7, characterized in that: The transgenic plants were also evaluated for resistance, and it was determined that overexpression of CsERF1 improved resistance to citrus canker.

Images