Application of padC gene in controlling L-tyrosine production in Bacillus sp.
By knocking out or editing the padC gene, the problem of insufficient L-tyrosine production in Bacillus licheniformis was solved, and a significant increase in L-tyrosine production was achieved, reaching a yield increase of 25%-37.6%.
Patent Information
- Application Number
- CN202411078034.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-07
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2044-08-07
AI Technical Summary
There is no effective method in the prior art to increase the production of L-tyrosine in Bacillus, especially in Bacillus licheniformis, where there is a lack of research on the correlation between the padC gene and L-tyrosine.
By knocking out or editing the padC gene, the padC gene in Bacillus is not expressed or is expressed at a low level, thereby increasing the production of L-tyrosine. Bacillus licheniformis DC5 is preferably used as the research object, and the fermentation medium is glucose, peptone, yeast powder, NaCl, phosphate and A5 mix, pH 6.5-7.5.
The L-tyrosine production of Bacillus licheniformis was significantly improved, with the yield increased by at least 25% and up to 37.6%, providing a new strategy for high L-tyrosine production by microorganisms.
Smart Images

Figure BDA0004982915960000051 
Figure HDA0004982915970000011
Abstract
Description
Technical Field
[0001] The invention belongs to the fields of genetic engineering and microbial technology, and particularly relates to application of a padC gene in controlling L-tyrosine production in Bacillus. Background Art
[0002] L-Tyrosine (L-Tyr), chemically known as 2-amino-3-p-hydroxyphenylpropionic acid, is an aromatic polar α-amino acid containing a phenolic hydroxyl group. Tyrosine is an essential amino acid that not only plays a crucial role in the metabolism, growth, and development of humans and animals but also serves as a key precursor for the synthesis of a variety of high-value-added compounds. Therefore, it is widely used in the food, feed, pharmaceutical, and chemical industries. With the rapid development of metabolic engineering and biotechnology, rationally designing and modifying microbial metabolic pathways to achieve high L-tyrosine production has become increasingly feasible. Strategies to increase L-tyrosine production primarily focus on improving the flux of the shikimate pathway, including increasing precursor supply and expression levels of intermediate enzymes, and relieving product feedback inhibition. For example, Munoz et al. knocked out tyrR in wild-type and PTS-deficient Escherichia coli, increasing L-tyrosine production by 1.7-fold and 1.9-fold, respectively. Ikeda et al. achieved L-tyrosine production of 4.3 g / L by knocking out the tyrosine internalization protein gene aroP in Corynebacterium glutamicum. Juminaga et al. optimized the 11 key enzyme genes of the two modules of shikimic acid synthesis and tyrosine synthesis, including promoters, terminators and codons, and the optimal strain produced 2.6 g / L of L-tyrosine after 24 hours of fermentation.
[0003] Currently, there is no research on the correlation between padC and L-tyrosine in Bacillus. This application uses Bacillus licheniformis as an example and finds that knocking out padC in Bacillus licheniformis can significantly increase L-tyrosine production, which has important scientific research significance and application value in the high production of L-tyrosine in Bacillus. Summary of the Invention
[0004] The purpose of the present invention is to provide an application of the padC gene in controlling the L-tyrosine production of Bacillus.
[0005] In order to achieve the above object, the present invention adopts the following technical measures:
[0006] The padC gene is used to control the L-tyrosine production in Bacillus. The protein encoded by the padC gene is shown in SEQ ID NO.2.
[0007] The above application, specifically, is to increase the production of L-tyrosine by silencing, knocking out or editing the padC gene so that the padC gene in Bacillus is not expressed or is under-expressed.
[0008] Specifically, the above-mentioned application can be completed by using only Bacillus that can produce L-tyrosine.
[0009] In the above application, preferably, the Bacillus is Bacillus licheniformis.
[0010] In the above application, preferably, the Bacillus is Bacillus licheniformis DC5.
[0011] The protection scope of the present invention also includes:
[0012] The above-mentioned application, preferably, is a process of microbial fermentation of Bacillus with silenced, knocked out or edited padC gene, wherein the fermentation medium used in the fermentation process is: glucose 40-60 g / L, peptone 3-10 g / L, yeast powder 1-5 g / L, NaCl 8-12 g / L, dipotassium hydrogen phosphate 17-19 g / L, potassium dihydrogen phosphate 4-6 g / L, A5 mix 0.5-1.5 ml / L, pH 6.5-7.5.
[0013] In the above application, preferably, the fermentation medium is:
[0014] Glucose 50 g / L, peptone 5 g / L, yeast extract 5 g / L, NaCl 10 g / L, dipotassium hydrogen phosphate 18.6 g / L, potassium dihydrogen phosphate 5.2 g / L, A5 mix 1 ml / L, pH 7.0.
[0015] Compared with the prior art, the present invention has the following advantages:
[0016] This study significantly increased L-tyrosine production in Bacillus licheniformis by deleting the padC gene. The results demonstrate that deleting the padC gene is a highly effective method for enhancing a microorganism's ability to synthesize L-tyrosine. The Bacillus licheniformis DC5ΔpadC strain obtained using the method provided by this invention increased tyrosine production by at least 25% and as much as 37.6% under different fermentation media. This study provides a new strategy for microorganisms to efficiently produce L-tyrosine using glucose. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 This is a gel image of PCR verification of the padC knockout strain in Example 2;
[0018] Lane 1: DC5 colony PCR verification gel image; Lane 2: padC knockout strain colony PCR verification gel image; Lane M: 5K DNA marker, from top to bottom: 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp. DETAILED DESCRIPTION
[0019] The present invention is further illustrated with reference to the following examples, which should not be construed as limiting the scope of the present invention. The contents disclosed in the present invention can be improved in terms of materials, methods, and reaction conditions at the same time, and all such improvements should fall within the spirit and scope of the present invention. The technical solutions described in the present invention, unless otherwise specified, are conventional solutions in the art; the reagents or materials, unless otherwise specified, are all from commercial sources.
[0020] Example 1:
[0021] Construction of padC knockout vector in Bacillus licheniformis
[0022] Step 1: According to the upstream and downstream sequences of the padC gene in the genomic DNA sequence of Bacillus licheniformis DW2 (CN117402802A) (the gene sequence is shown in SEQ ID NO.1, and the protein encoded by the padC gene is shown in SEQ ID NO.2), the upstream homology arm primers (AF and AR) and downstream homology arm primers (BF and BR) of the padC gene were designed; and the genomic DNA of Bacillus licheniformis DW2 was used as a template, and the upstream homology arm primers and downstream homology arm primers of the padC gene were used for PCR amplification to obtain the upstream homology arm (520 bp) of the padC gene (the upper homology arm sequence is SEQ ID NO.3) and the downstream homology arm (558 bp) of the padC gene (the lower homology arm sequence is SEQ ID NO.4);
[0023] Among them, the sequence of AF, AR, BF, and BR is:
[0024] AF: CTGCAGCCCGGGGGATCCGCAAACTCTTCTGTCAGCAG
[0025] AR: GCCTTGCTGCATGACTTAACGATCATATGGCTTCCGAC
[0026] BF:GTCGGAAGCCATATGATCGTTAAGTCATGCAGCAAGGC
[0027] BR:GATCTTTTCTACGAGCTCACCAGCCTTTCTCGATCACG
[0028] Step 2: The upstream homology arm of the padC gene and the downstream homology arm of the padC gene were connected together by overlap extension PCR (primers AF and BR were used) to form the target gene fragment;
[0029] Step 3: The above fusion fragment was connected to the T2(2)-Ori plasmid backbone via Gibison ligation and transformed into Escherichia coli DH5α. The transformation product was spread on LB solid medium containing kanamycin resistance and cultured at 37°C for 18 hours. Transformants were picked on the LB solid medium and the plasmids of the transformants were verified by colony PCR (primers used were: T2-F and T2-R). If the PCR verification result of the transformant is: an electrophoresis band appears at 1556 bp, it means that the integrated expression vector was successfully constructed, and the above transformant is a positive transformant, named integrated expression vector T2(2)-padC;
[0030] T2-F:ATGTGATAACTCGGCGTA
[0031] T2-R: GCAAGCAGATTACGC.
[0032] Example 2:
[0033] Construction of padC gene knockout strain:
[0034] Step 1: The recombinant vector T2(2)-padC is transformed into Bacillus licheniformis DC5 (Zheng Pengling. Metabolic Engineering of Bacillus licheniformis for Efficient Synthesis of L-Tyrosine [D]. Hubei University, 2023. DOI: 10.27130 / d.cnki.ghubu.2023.000692.) competent cells, and screened at 37°C using a culture medium containing kanamycin resistance to obtain transformants. The transformants are then subjected to colony PCR verification of the plasmids (primers used are: T2-F and T2-R). If the PCR verification result of the transformant is: an electrophoretic band appears at 1556 bp, it proves that the knockout expression vector T2(2)-padC has been successfully transformed into Bacillus licheniformis DC5;
[0035] Step 2: The positive transformants obtained in step 1 were cultured three times on a kanamycin-resistant medium at 45°C for 12 hours each time, and single-crossover strains were detected by colony PCR using primers T2-F and padC-YR.
[0036] The sequences of primers padC-YF and padC-YR are:
[0037] padC-YF:AATTCGTACATGCCTGCG
[0038] padC-YR:ACGTATGAGTGGCTCGAAG
[0039] Step 3: The PCR test obtained in step 2 shows a 1488bp band, which is a single exchange strain. Select a single colony of one of the single exchange strains and inoculate it into liquid LB. After several transfer cultures at 37°C in a culture medium without kanamycin, select the transformants for colony PCR verification (primers are padC-YF and padC-YR). If the PCR verification result of the transformant is: when an electrophoresis band appears at 1732bp, it indicates that the gene has reversed and the transformant is Bacillus licheniformis DC5; when an electrophoresis band appears at 1231bp, it indicates that the padC gene has been successfully knocked out. Subsequently, DNA sequencing was performed on the positive transformants for further verification to obtain a padC knockout strain with successful double exchange, namely Bacillus licheniformis DC5△padC. Example 3:
[0040] Application of Bacillus licheniformis DC5△padC in high production of L-tyrosine:
[0041] 1) Seed Fermentation: Activate Bacillus licheniformis DC5 and Bacillus licheniformis DC5ΔpadC on plates, pick and inoculate into 250 mL Erlenmeyer flasks containing 50 mL of liquid LB. Incubate at 37°C, 230 rpm for 12 h. Then, inoculate the fermentation medium at a 2% (v / v) inoculum level, with 50 mL of fermentation medium in each 250 mL Erlenmeyer flask.
[0042] The applicant selected nine culture medium formulations for the fermentation medium, numbered 1-9 as tyrosine fermentation medium (Table 1). In addition, each culture medium contained 10 g / L NaCl, 18.6 g / L dipotassium hydrogen phosphate, 5.2 g / L potassium dihydrogen phosphate, 1 ml / L A5 mix, and a pH of 7.0.
[0043] Table 1 Medium formula for tyrosine fermentation
[0044] serial number Grapes (g / L) Peptone (g / L) Yeast powder (g / L) 1 40 5 1 2 40 10 2 3 40 5 5 4 50 5 5 5 50 10 5 6 50 5 2 7 60 3 5 8 60 5 5 9 60 10 5
[0045] The culture conditions were 37° C. and 230 rpm for 48 h, and the L-tyrosine production was measured after the fermentation was completed.
[0046] The L-tyrosine assay method is as follows:
[0047] Sample pretreatment: Add an appropriate amount of 6M HCl to the fermentation broth to dissolve tyrosine. Dilute the broth with water to an appropriate ratio and centrifuge at 12,000 rpm for 5 minutes to remove bacterial cells. Filter 1 mL of the supernatant through a 0.22 μm aqueous filter membrane before HPLC analysis. Detection conditions: A Dalian Elite Hypersil ODS2 C18 column (5 μm, ID 4.6 mm x 250 mm) was used, with a detection wavelength of 224 nm, an injection volume of 10 μL, and a mobile phase consisting of 100% methanol and 1 / 1000th formic acid in water in a ratio of 2:8. The flow rate was 0.6 mL / min. The tyrosine content in the fermentation broth was calculated using a standard curve generated using a tyrosine standard.
[0048] The applicant also measured tyrosine production in the aforementioned culture media numbered 1-9. As shown in Table 2, under identical seed fermentation and production fermentation conditions, the use of the Bacillus licheniformis DC5ΔpadC strain of the present invention significantly improved the strain's tyrosine synthesis capacity, with increases ranging from a minimum of 25% to a maximum of 37.6%. The technical solution of the present invention has significant scientific research significance and application value for increasing tyrosine production in Bacillus.
[0049] Table 2 Comparison of tyrosine production between Bacillus licheniformis DC5 and DC5△padC
[0050]
Claims
1. Application of padC gene in controlling L-tyrosine production in Bacillus sp. padC The protein encoded by the gene is shown in SEQ ID NO. 2, and the Bacillus is Bacillus licheniformis DC5.
2. The use according to claim 1, characterized in that The application process is through silencing, knocking out or editing padC Genetic methods have enabled the padC The gene is not expressed or is expressed at a low level, thereby increasing the production of L-tyrosine.
3. The use according to claim 1, characterized in that The application process is to silence, knock out or edit padC The fermentation medium used in the fermentation process is: glucose 40-60g / L, peptone 3-10g / L, yeast powder 1-5g / L, NaCl 8-12 g / L, dipotassium hydrogen phosphate 17-19 g / L, potassium dihydrogen phosphate 4-6 g / L, A5 mix 0.5-1.5ml / L, and the rest is water, pH 6.5-7.
5.
4. The use according to claim 3, characterized in that The fermentation medium is: Glucose 50 g / L, peptone 5 g / L, yeast extract 5 g / L, NaCl 10 g / L, dipotassium hydrogen phosphate 18.6 g / L, potassium dihydrogen phosphate 5.2 g / L, A5 mix 1 ml / L, the remainder is water, pH 7.0.
Citation Information
Patent Citations
Method for producing ectoine with high yield by bacillus licheniformis for weakening phosphoenolpyruvate carboxykinase gene and application
CN117402802A
Method for synthesizing p-hydroxyacetophenone
CN118186027A
Transformant for producing 4-hydroxystyrene and its derivatives and method of producing thereof
KR101685943B1