Molecular Markers of Aortic Dissection and Their Applications
The expression levels of genes OLAH, KIF19, METTL7B, FXYD2 and NPIPB9 were detected by peripheral blood, and the problem of differentiation between ATAAD and AMI was solved, which achieved rapid and sensitive diagnosis and identification, reduced the risk of misdiagnosis, and provided effective treatment guidance.
Patent Information
- Application Number
- CN202410987472.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-23
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2044-07-23
AI Technical Summary
The prior art is difficult to quickly, sensitively and specifically diagnose acute Stanford type A aortic dissection (ATAAD), and it is difficult to distinguish from acute myocardial infarction (AMI), resulting in a high risk of misdiagnosis and limited application of RNA markers that are difficult to obtain by aortic tissue.
The expression of these genes were evaluated to diagnose and differentiate ATAAD from AMI by peripheral blood detection and real-time fluorescence quantitative PCR using primers and kits.
It has achieved rapid, sensitive and specific diagnosis of ATAAD, reduced the risk of misdiagnosis, provided effective treatment guidance, and significantly improved the diagnostic efficacy and differentiation ability of gene combinations.
Smart Images

Figure CN118755816B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological detection, and particularly relates to an aortic dissection molecular marker and its application. Background Art
[0002] Cardiovascular diseases (CVDs) are the leading cause of death in many countries, causing 16.7 million deaths annually. Aortic dissection (abbreviated as AD) is one of the most dangerous diseases in cardiovascular diseases. It is caused by the rupture of the aortic intima for various reasons, and blood enters the media, causing the aortic vessel wall to tear and form true and false lumens. According to the Stanford classification, AD can be divided into Stanford type A and Stanford type B. Among them, acute Stanford type A aortic dissection (ATAAD) is a critically ill emergency clinically and has a very high mortality rate. The mortality rate within 2 days after its onset increases by about 1% per hour, and the mortality rate of patients without surgical treatment is as high as 74% within 2 weeks.
[0003] ATAAD patients usually present with severe chest and back pain when they get sick. Similarly, acute myocardial infarction (AMI) patients can also present with chest pain when they get sick. It is not easy to distinguish between the two, and misdiagnosis is very likely. Although ATAAD can be clearly diagnosed by enhanced CT of the aorta and differentiated from AMI, many hospitals perform empirical emergency percutaneous coronary intervention to save time because ATAAD is relatively rare. Once acute myocardial infarction is misdiagnosed, preoperative antiplatelet therapy will lead to catastrophic consequences. At present, there is no blood test index that can specifically and sensitively diagnose ATAAD. For clinicians, quickly differentiating these two diseases in the emergency room is a huge challenge because both are very dangerous and have completely different treatment plans. Once misdiagnosed and given the wrong treatment plan, the consequences are often catastrophic. Therefore, it is particularly important to find markers that can sensitively and specifically diagnose ATAAD or predict the occurrence of ATAAD through simple and rapid blood tests.
[0004] With the completion of the human genome sequencing project and the development of high-throughput sequencing technology, scientific researchers in the medical field have a deeper understanding of the human genome, and their understanding of disease-related genetic variations, the functions of related genes, and regulatory networks has gradually deepened. High-throughput sequencing has been widely used. In recent years, more and more studies have found genes related to ATAAD through high-throughput sequencing. However, most of the studies are based on RNA expressed in aortic tissue. Since obtaining aortic tissue causes great trauma to the human body and is difficult to apply clinically, it may not be appropriate to use differentially expressed RNA in aortic tissue as a biomarker for AD.
[0005] ATAAD has a high disability and mortality rate and is not easily detected early. Although enhanced CT of the aorta is the gold standard for diagnosing ATAAD, it is costly, time-consuming for patients, and many primary hospitals do not have the conditions to complete this examination. Moreover, it is difficult to obtain aortic tissue, and it is difficult to use differentially expressed RNA as a biomarker. Therefore, differentially expressed RNA screened from peripheral blood can be more conveniently used as a biomarker for ATAAD in clinical practice. Summary of the Invention
[0006] Technical problems to be solved: In view of the above technical problems, the present invention provides an aortic dissection molecular biomarker and its application, which can effectively solve the deficiencies of the existing methods in the long detection time for type A aortic dissection and the difficulty in differentiating it from acute myocardial infarction.
[0007] Technical solution: In a first aspect, the present invention provides an application of a substance for detecting an aortic dissection molecular biomarker, including one or more of the following applications:
[0008] 1) Application in the preparation of a product for diagnosing aortic dissection;
[0009] 2) Application in the preparation of a product for screening aortic dissection;
[0010] 3) Application in the preparation of a product for evaluating the risk of aortic dissection;
[0011] 4) Application in the preparation of a product for differentiating aortic dissection from acute myocardial infarction;
[0012] The aortic dissection molecular biomarker includes gene OLAH (Gene ID: 55301) and gene KIF19 (Gene ID: 124602).
[0013] Preferably, the aortic dissection molecular biomarker further includes gene METTL7B (Gene ID: 196410).
[0014] Furthermore, the aortic dissection molecular biomarker further includes gene FXYD2 (Gene ID: 486) and / or gene NPIPB9 (Gene ID: 100507607).
[0015] Preferably, the substance is a reagent for detecting the expression level of the aortic dissection molecular biomarker, or a reagent for specifically recognizing the aortic dissection molecular biomarker, or a reagent for detecting the content of the aortic dissection molecular biomarker.
[0016] Preferably, the substance for detecting the aortic dissection molecular biomarker is one of the following a), b), or c):
[0017] a) Primers for detecting the expression level of molecular markers of aortic dissection; or primers specifically recognizing molecular markers of aortic dissection;
[0018] b) A reagent set containing the a) above;
[0019] c) A kit containing the a) or the b) above.
[0020] Furthermore, the primers include upstream and downstream primers for amplifying the gene OLAH, and their nucleotide sequences are shown as SEQ ID No.1 - SEQ ID No.2; upstream and downstream primers for amplifying the gene KIF19, and their nucleotide sequences are shown as SEQ ID No.3 - SEQ ID No.4; upstream and downstream primers for amplifying the gene METTL7B, and their nucleotide sequences are shown as SEQ ID No.5 - SEQ ID No.6; upstream and downstream primers for amplifying the gene FXYD2, and their nucleotide sequences are shown as SEQ ID No.7 - SEQ ID No.8; upstream and downstream primers for amplifying the gene NPIPB9, and their nucleotide sequences are shown as SEQ ID No.9 - SEQ ID No.10:
[0021] SEQ ID No.1: CCTGGCATCGCATTCCCAA;
[0022] SEQ ID No.2: GGTACGTTAGAGGTGCAACTTC;
[0023] SEQ ID No.3: GGAGATGGTGTATCAGGCCAC;
[0024] SEQ ID No.4: CGTTGAGGGTCTGAACATAGATG;
[0025] SEQ ID No.5: TGGAGAGGACATGAGACAGC;
[0026] SEQ ID No.6: TGCTCCCAGAAAAAGAGCACA;
[0027] SEQ ID No.7: CGTGGACCCGTTCTACTATGACTA;
[0028] SEQ ID No.8: GCGCTTCTTATTGCCCCCAC;
[0029] SEQ ID No.9: CCTTGAGAGAAACTGAATGACGA;
[0030] SEQ ID No.10: GCTTCAGAAAAGGACAGAACCA。
[0031] Beneficial effects: 1) The genes OLAH, KIF19, METTL7B, FXYD2, and NPIPB9 protected by the present invention can be used as biomarkers for AD;
[0032] 2) The genes OLAH, KIF19, METTL7B, FXYD2, and NPIPB9 protected by the present invention can be used as one of the indicators for evaluating the disease severity of AD patients;
[0033] 3) The biomarker composed of the genes OLAH, KIF19, METTL7B, FXYD2, and NPIPB9 protected by the present invention has good potential for diagnosing AD patients and has good diagnostic efficacy, differentiating AD patients from AMI patients, enabling effective treatment of the patients. Description of the Drawings
[0034] Figure 1 Are the volcano plot (A) and clustering heat map (B) of differentially expressed genes, where L represents the aortic dissection case group and HC represents the normal control group;
[0035] Figure 2 Are the qPCR results of specific verification of the mRNA expression levels of each gene between the aortic dissection and acute myocardial infarction case groups and the normal control group in the present invention, where CON: normal control group (n = 64); AMI: acute myocardial infarction case group; ATAAD: aortic dissection case group (n = 64), *: P < 0.05; **: P < 0.01; ***: P < 0.001; ns: no statistically significant difference;
[0036] Figure 3 Is the restricted cubic spline regression analysis curve of the association between the mRNA expression level of specific genes and ATAAD;
[0037] Figure 4 Is the ROC curve of the molecular biomarker of different gene combinations for diagnosing aortic dissection in the present invention;
[0038] Figure 5 Is the ROC curve of the molecular biomarker of different gene combinations for differentiating aortic dissection from acute myocardial infarction in the present invention. Detailed Embodiments
[0039] The present invention will be described in detail below with reference to the drawings and specific embodiments: Example 1
[0040] First, high-throughput transcriptome sequencing was performed on 8 cases of ATAAD and 20 normal controls to screen for differentially expressed gene mRNAs in ATAAD cases. Twenty upregulated and twenty downregulated genes with the most significant differential expression in the sequencing results were included in the validation work. Immediately afterwards, a three-group case-control study design was adopted. In the first stage, 84 pairs of ATAAD cases and control samples were used for validation. Gene mRNAs with consistent validation results and statistical significance with the sequencing direction were included in the second-stage validation; in the second stage, 94 pairs of ATAAD cases and control samples were used for validation. Gene mRNAs with consistent validation results and statistical significance with the sequencing direction were included in the specificity validation. For the specificity validation, 64 cases each of AMI and controls were used, and gene mRNAs with differential expression between the ATAAD and AMI case groups were used as the specific gene mRNAs of ATAAD. The expression levels of the gene mRNAs to be validated were detected by quantitative real-time polymerase chain reaction (qRT-PCR). Finally, the relative quantification method 2-ΔΔCT was used to calculate the mRNA expression levels. The Mann-Whitney U test was used to compare the gene expression differences between the case group and the control group. Restricted cubic spline (RCS) was used to explore the dose-response relationship between the gene mRNA expression levels and ATAAD; the receiver operating characteristic curve (ROC curve) was used to evaluate the discriminative ability of the specific gene mRNAs for ATAAD and normal populations and the discriminative ability between ATAAD and AMI, analyze their sensitivity, specificity, and the area under the ROC curve (AUC), and construct different models to analyze their discriminative value for ATAAD onset. The specific data are as follows:
[0041] Association between specific mRNA expression and acute Stanford type A aortic dissection: A case-control study.
[0042] 1. Clinical samples:
[0043] Peripheral blood was collected from 178 patients hospitalized in the Department of Cardiovascular Surgery of Nanjing First Hospital from 2019 to 2022 with a primary diagnosis of AD. 1.5 mL of peripheral blood was collected using an EDTA anticoagulant tube, and 4.5 mL of whole blood RNA preservation solution (Nanjing Yining Fusheng Biotechnology Co., Ltd.) was added and thoroughly mixed, then stored in a -20°C refrigerator for RNA extraction. Inclusion criteria:
[0044] Inclusion criteria for ATAAD cases: ① Han population aged 18 - 85 years old; ② Patients with ATAAD diagnosed by enhanced whole aorta scan and confirmed during the operation. Exclusion criteria for cases: ① Exclude cardiovascular diseases caused by genetic diseases or genetic cardiovascular diseases such as Marfan syndrome, Ehlers - Danlos syndrome, familial thoracic aortic aneurysm, dissection caused by trauma, etc.; ② Patients proven not to have ATAAD during the operation; ③ Suffering from malignant tumors; ④ Patients considered by the researcher to have other situations not suitable for inclusion in this study, etc.
[0045] Inclusion criteria for AMI cases: ① Han population aged 18 - 85 years old; ② Patients hospitalized with AMI in the First Hospital of Nanjing. The diagnosis of acute myocardial infarction (type I myocardial infarction) adopts the criteria of the fourth edition of "Global Definition of Myocardial Infarction", that is, acute myocardial injury [serum cardiac troponin (cTn) increased and / or decreased, and at least 1 time higher than the upper limit of normal value (99th percentile value of the upper limit of reference value)], and at the same time, there is clinical evidence of acute myocardial ischemia, including: I. Symptoms of acute myocardial ischemia; II. New ischemic electrocardiogram changes; III. New pathological Q waves; IV. New imaging evidence of viable myocardial loss or ventricular wall segmental motion abnormalities; V. Coronary angiography or intravascular imaging examination. Exclusion criteria for cases: ① Taking antiplatelet drugs and lipid - regulating drugs within the past 2 weeks; ② Severe hepatic and renal insufficiency (ALT > 5 times ULN, eGFR < 30 mL / min / 1.73 mm 2 );③ Suffering from malignant tumors; ④ Known hemorrhagic diseases or active bleeding; ⑤ Patients participating in other interventional clinical trials.
[0046] This invention cooperates with the School of Public Health of Nanjing Medical University, and the control source is the population of the prospective cohort study carried out in Jurong City, Jiangsu Province from 2018 to 2019.
[0047] Inclusion criteria for the control: Matched 1:1 by individual with ATAAD and AMI cases in the way of consistent age (±2 years) and gender.
[0048] Exclusion criteria for the control: Suffering from severe heart, brain, lung, kidney diseases and tumors.
[0049] 2. Experimental methods:
[0050] 2.1 RNA extraction:
[0051] The extraction of total RNA from peripheral blood adopts the magnetic bead method (Cat#Yu - BR02 - 1, Wuxi Yu'an Biotechnology Co., Ltd., China). The specific steps are as follows:
[0052] (1) Sample processing: Thaw the frozen preservation solution sample at room temperature, mix it by inverting up and down, add 800 μL of the sample to a 1.5 mL centrifuge tube, then add 600 μL of isopropanol, and mix by inverting up and down. Place it in a centrifuge at 4 °C and centrifuge at 7230 rpm for 10 min;
[0053] (2) Discard the supernatant, retain the precipitate, and sequentially add 400 μL of lysis adsorption solution, 10 μL of RNA protectant, and 10 μL of mixed magnetic beads to it. Close the lid, place the centrifuge tube on a shaker and shake for 10 min, take out the centrifuge tube, and centrifuge briefly;
[0054] (3) Place the centrifuge tube on a magnetic rack, let it stand for 2 min, open the lid, aspirate and discard the liquid with a pipette, and retain the magnetic beads;
[0055] (4) Add 600 μL of Buffer AW1, close the lid, place the centrifuge tube on a shaker and shake for 1 min;
[0056] (5) Place the centrifuge tube on a magnetic rack, let it stand for 1 min, then quickly invert the magnetic rack up and down to fully recover the magnetic beads on the centrifuge tube lid. Let it stand for another 1 min. Open the lid, aspirate and discard the liquid with a pipette, and retain the magnetic beads;
[0057] (6) Add 600 μL of 80% DEPC ethanol, close the lid, place the centrifuge tube on a shaker and shake for 1 min;
[0058] (7) Place the centrifuge tube on a magnetic rack, let it stand for 1 min, then quickly invert the magnetic rack up and down to fully recover the magnetic beads on the centrifuge tube lid. Let it stand for another 1 min. Open the lid, aspirate and discard the liquid with a pipette, and retain the magnetic beads;
[0059] (8) Repeat steps (6)-(7);
[0060] (9) Place the centrifuge tube on a foam board, put it into a 50 °C constant temperature water bath, and dry for 2 min;
[0061] (10) Retrieve the centrifuge tube, add 50 μL of elution buffer A, blow and beat the magnetic beads thoroughly to disperse them into the elution buffer, close the lid, place the centrifuge tube on a foam board, put it into a 52 °C constant temperature water bath, and water bath for 2 min;
[0062] (11) Place the centrifuge tube on a magnetic rack, let it stand for 2 min until the liquid is clear, open the lid, aspirate the liquid with a pipette and transfer it to another new centrifuge tube, and discard the magnetic beads;
[0063] (12) Use ultraviolet spectrophotometry (nucleic acid and protein analyzer Thermo Nano Drop 2000) to detect the RNA concentration and purity. The RNA purity is qualified when the OD value (260 / 280) is between 1.8 and 2.0.
[0064] 2.2 RNA Reverse Transcription to Synthesize cDNA
[0065] Use the TAKARA reverse transcription kit (RR047A Takara PrimeScript™ RT reagent Kit with gDNA Eraser, Japan) to synthesize cDNA. The specific steps are as follows:
[0066] (1) According to the measured concentration, balance the RNA of different concentration samples to four fixed values of 10 ng / μL, 30 ng / μL, 50 ng / μL, and 100 ng / μL. Calculate the volume of eluent A to be added according to the concentration;
[0067] (2) Add 2 μL of reverse transcription system 1 to a 200 μL centrifuge tube;
[0068] (3) Add the RNA sample (the volume is calculated according to the concentration) to the centrifuge tube, centrifuge, and incubate in a water bath at 42 °C for 2 min;
[0069] (4) Add 10 μL of reverse transcription system 2 and centrifuge;
[0070] (5) PCR amplification, the program is set as 37 °C for 15 min, 85 °C for 5 s, 15 °C ∞;
[0071] (6) After reverse transcription is completed, store it in a -80 °C refrigerator for subsequent experiments.
[0072] 2.3 qRT-PCR
[0073] Design the primer sequences of mRNAs according to the primer design principle of mRNAs;
[0074] The relative quantitative detection of mRNA is completed by qPCR, and the SYBR Green method is used for detection. The experiment uses a 384-well plate, and three parallel replicates are set for each sample. GAPDH is used as the internal reference gene. The detection in the first stage is completed using the ABI QuantStudio7 fluorescence quantitative PCR system, and the second stage and specific verification are completed using the Fosheng FS384 real-time fluorescence quantitative PCR instrument. The standard deviation of the CT values between the replicates of each sample is less than 0.5, and the final reading takes the average value of the three replicates;
[0075] The system uses 1.5 μL of cDNA sample, 1.3 μL of RNase-free H2O, 2.8 μL of SYBR Green Master Mix, and 0.2 μL of forward and reverse primers each, for a total of 6 μL system;
[0076] The qPCR program was set as follows: ① Pre-denaturation: 95°C, 5 min; ② Denaturation: 95°C, 10 s; ③ Annealing: 57°C, 20 s; ④ Extension: 72°C, 20 s; ⑤ Melting curve: default settings of the instrument. Steps ② - ④ were cycled 40 times in sequence, and the other steps were performed only once.
[0077] 2.4 Method for calculating mRNA expression level
[0078] The relative quantification method (2-ΔΔCT) was used to calculate the mRNA expression levels of each gene. The specific method was as follows:
[0079] (1) ΔCT = CT value of the target gene - CT value of the internal reference gene;
[0080] (2) Batch coefficient fn = average ΔCT value of the control groups in each batch / average ΔCT value of the total control;
[0081] (3) ΔCT core = ΔCT / fn;
[0082] (4) ΔΔCT core = ΔCT core - average ΔCT value of the total control;
[0083] (5) mRNA expression level = 2(-ΔΔCT core).
[0084] 2.5 Data collation and statistical analysis
[0085] All experimental data were independently collated by two persons and their consistency was verified. The mRNA expression levels of each gene were calculated using the relative quantification method. Before analysis, the extreme values were corrected with the mean ± three standard deviations of the ΔCT values. The differences in the mRNA expression levels between the case group and the control group were compared using the Mann-Whitney U test. The dose-response relationship between the mRNA expression level and the incidence of ATAAD was analyzed using the Restricted cubic spline (RCS). The receiver operating characteristic (ROC) curve was plotted to analyze the discriminative ability of specific mRNAs between ATAAD patients and normal populations and between ATAAD and acute myocardial infarction (AMI), and their sensitivity, specificity, and area under the curve (AUC) were obtained. All of the above analyses were performed using the statistical software SPSS 24 or R 4.2.2. The results of the statistical analysis were considered statistically significant when the two-sided P < 0.05.
[0086] 3. Experimental results:
[0087] As Figure 1Shown: A total of 19,548 mRNAs were detected by RNA-Seq, among which 3,634 mRNAs were significantly dysregulated (Padj < 0.05, |log2FC| > 1); compared with the normal control group, 1,923 mRNAs were significantly upregulated and 1,711 mRNAs were significantly downregulated in the ATAAD group. The volcano plot ( Figure 1 A) and heatmap ( Figure 1 B) showed the expression profiles of mRNAs between ATAAD and normal controls.
[0088] As Figure 2 shown: Compared with the normal control group, the genes OLAH and KIF19 were differentially upregulated in the AMI case group (P < 0.05), and there was no significant difference in METTL7B, FXYD2, and NPIPB9 (P > 0.05); compared with the AMI case group, OLAH and METTL7B were differentially upregulated in the ATAAD case group (P < 0.05), and FXYD2, NPIPB9, and KIF19 were differentially downregulated (P < 0.05); compared with the control group, the mRNAs of each gene were differentially expressed in the ATAAD case group.
[0089] As Figure 3 shown: Overall, the mRNAs of upregulated genes all showed that the risk of ATAAD increased with the increase in expression level. Among them, with the increase in the expression level of METTL7B, the risk of ATAAD showed an increase in disease risk. When the expression level reached a certain level, the risk no longer increased; the initial risk of OLAH increased with the increase in expression level, and then decreased slightly with the further increase in expression level, but the risk was still much higher than that at the low expression level; overall, the mRNAs of downregulated genes all showed that the risk of ATAAD decreased with the increase in expression level. Among them, the risk of FXYD2 decreased with the increase in expression level, and finally the OR tended to 1; the risk of NPIPB9 decreased with the increase in expression level, and finally showed a protective effect (OR < 1); the risk of KIF19 first decreased with the increase in expression level, then increased slightly with the further increase in expression level, and finally showed a harmful effect (OR > 1).
[0090] As Figure 4Shown as follows: The AUC values of gene OLAH and gene KIF19 are > 0.94, the AUC values of gene OLAH, gene KIF19 and gene METTL7B are > 0.94, the AUC values of gene OLAH, gene KIF19, gene METTL7B and gene FXYD2 are > 0.97, the AUC values of gene OLAH, gene KIF19, gene METTL7B and gene NPIPB9 are > 0.97, the AUC values of gene OLAH, gene KIF19, gene METTL7B, gene FXYD2 and gene NPIPB9 are > 0.98, indicating that the above gene combinations have good potential for diagnosing AD and good diagnostic efficiency, and the greater the ACU value, the greater the diagnostic efficiency of the corresponding gene combination.
[0091] As Figure 5 Shown as follows: The AUC values of gene OLAH and gene KIF19 are > 0.90, the AUC values of gene OLAH, gene KIF19 and gene METTL7B are > 0.98, the AUC values of gene OLAH, gene KIF19, gene METTL7B and gene FXYD2 are > 0.97, the AUC values of gene OLAH, gene KIF19, gene METTL7B and gene NPIPB9 are > 0.97, the AUC values of gene OLAH, gene KIF19, gene METTL7B, gene FXYD2 and gene NPIPB9 are > 0.98, indicating that the above gene combinations have good potential for differentiating aortic dissection from acute myocardial infarction, and the greater the AUC value, the greater the differentiating ability of the corresponding gene combination.
[0092] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.
Claims
1. An application of a substance for detecting aortic dissection molecular markers, characterized in that: Includes one or more of the following applications: 1) Application in the preparation of products for diagnosing aortic dissection; 2) Application in the preparation of products for screening aortic dissection; 3) Use in the preparation of products for assessing the risk of aortic dissection; 4) Application in the preparation of products for distinguishing aortic dissection from acute myocardial infarction; The aortic dissection is acute Stanford type A aortic dissection; The substance is the following a), b) or c): a) Primers that specifically identify molecular markers of aortic dissection; b) a reagent set containing the reagent described in a); c) a kit containing a) or b); The aortic dissection molecular marker is one of the following combinations: ① Gene OLAH and gene KIF19; ② Gene OLAH, gene KIF19 and METTL7B; ③ OLAH, KIF19, METTL7B and FXYD2 genes; ④Gene OLAH, gene KIF19, gene METTL7B and gene NPIPB9; ⑤Gene OLAH, gene KIF19, METTL7B, gene FXYD2 and gene NPIPB9.
2. The use according to claim 1, characterized in that: The primers for specifically identifying molecular markers of aortic dissection are one of the following combinations: ① The upstream primer and downstream primer for amplifying the gene OLAH, whose nucleotide sequences are shown in SEQ ID No.1-SEQ ID No.2; the upstream primer and downstream primer for amplifying the gene KIF19, whose nucleotide sequences are shown in SEQ ID No.3-SEQ ID No.4; ② The upstream primer and downstream primer for amplifying the gene OLAH, whose nucleotide sequences are shown in SEQ ID No.1-SEQ ID No.2; the upstream primer and downstream primer for amplifying the gene KIF19, whose nucleotide sequences are shown in SEQ ID No.3-SEQ ID No.4; The upstream primer and the downstream primer for amplifying the gene METTL7B, the nucleotide sequences of which are shown in SEQ ID No.5-SEQ ID No.6; ③ The upstream primers and downstream primers for amplifying the gene OLAH, whose nucleotide sequences are shown in SEQ ID No.1-SEQ ID No.2; the upstream primers and downstream primers for amplifying the gene KIF19, whose nucleotide sequences are shown in SEQ ID No.3-SEQ ID No.4; the upstream primers and downstream primers for amplifying the gene METTL7B, whose nucleotide sequences are shown in SEQ ID No.5-SEQ IDNo.6; the upstream primers and downstream primers for amplifying the gene FXYD2, whose nucleotide sequences are shown in SEQ ID No.7-SEQ IDNo.8; ④ The upstream primers and downstream primers for amplifying the gene OLAH, whose nucleotide sequences are shown in SEQ ID No.1-SEQ ID No.2; the upstream primers and downstream primers for amplifying the gene KIF19, whose nucleotide sequences are shown in SEQ ID No.3-SEQ ID No.4; the upstream primers and downstream primers for amplifying the gene METTL7B, whose nucleotide sequences are shown in SEQ ID No.5-SEQ IDNo.6; the upstream primers and downstream primers for amplifying the gene NPIPB9, whose nucleotide sequences are shown in SEQ ID No.9-SEQ IDNo.10; ⑤ The upstream primers and downstream primers for amplifying the gene OLAH, whose nucleotide sequences are shown in SEQ ID No.1-SEQ ID No.2; the upstream primers and downstream primers for amplifying the gene KIF19, whose nucleotide sequences are shown in SEQ ID No.3-SEQ ID No.4; the upstream primers and downstream primers for amplifying the gene METTL7B, whose nucleotide sequences are shown in SEQ ID No.5-SEQ IDNo.6; the upstream primers and downstream primers for amplifying the gene FXYD2, whose nucleotide sequences are shown in SEQ ID No.7-SEQ IDNo.8; the upstream primers and downstream primers for amplifying the gene NPIPB9, whose nucleotide sequences are shown in SEQ ID No.9-SEQ IDNo.10.
Citation Information
Patent Citations
Biomarker ADAMTS8 for detecting acute aortic dissection and application
CN116298282A
Nucleobase editors and uses thereof
US20170121693A1