Lipase mutants
By directing the evolution of lipase and recombinantly expressing it in Pichia pastoris, the 163rd amino acid Arg of the lipase was mutated to Thr, which improved the specific activity of the lipase, solved the problems of its limited application and high cost, and promoted its application in the fields of medicine and oil processing.
Patent Information
- Application Number
- CN202411242219.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-05
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-09-05
AI Technical Summary
The application of existing lipases in pharmaceuticals and oil processing is not widespread, and their production costs are relatively high.
By directing the evolution of the amino acid sequence of lipase, especially by mutating the 163rd amino acid Arg of lipase to Thr, a lipase mutant with higher specific activity was constructed and recombinantly expressed in Pichia pastoris or Aspergillus niger.
It increased the specific activity of lipase by 37.1%, reduced production costs, and promoted its application in the fields of pharmaceuticals and oil processing.
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and protein engineering technology, and specifically to a lipase mutant. Background Technology
[0002] Lipases are a class of hydrolytic enzymes that can hydrolyze triglycerides to produce free fatty acids and glycerol of varying chain lengths. The main sources of lipases are plants, animals, and microorganisms. Microorganisms are characterized by their diversity, rapid reproduction, and high variability, secreting a wide variety of lipases with broad substrate diversity. They can adapt to different pH and temperature ranges, and some microbial strains obtained from extreme environments exhibit even more pronounced enzymatic characteristics. Currently, lipase-producing microorganisms are widely distributed, with over 60 genera identified, including 10 genera of yeasts, 23 genera of other fungi, 4 genera of actinomycetes, and 28 genera of bacteria. High-producing lipase fungal strains are mostly derived from Rhizopus, Aspergillus, Penicillium, Mucor, Geotrichum, and others.
[0003] From a catalytic perspective, lipases exhibit mild reaction conditions, produce few byproducts, and do not require coenzymes. They also possess high chemoselectivity and stereoisomerism. Furthermore, lipases can catalyze ester hydrolysis, ester synthesis, transesterification, ammonolysis, alcoholysis, and drug synthesis.
[0004] Currently, lipases are not widely used in pharmaceuticals, oil processing, biodiesel, and other fields. Therefore, developing high-performance lipases and reducing their production costs is of great significance for promoting their application. Summary of the Invention
[0005] The purpose of this invention is to provide a lipase mutant and its applications. The specific activity of the lipase mutant is significantly increased compared to the wild type, which helps reduce production costs and promotes its widespread application.
[0006] This invention provides a lipase mutant in which the 163rd amino acid of the lipase with the amino acid sequence SEQ ID NO:1 is mutated from Arg to Thr.
[0007] In some embodiments of the present invention, the amino acid sequence of the mutant is SEQ ID NO: 3.
[0008] The present invention also relates to DNA molecules encoding the above-mentioned lipase mutants.
[0009] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.
[0010] The present invention also relates to a host cell comprising the above-described recombinant expression vector.
[0011] When the plasmids were transferred into host cells, the specific activity of the recombinant lipase mutant was significantly increased.
[0012] The host cell is Pichia pastoris ( Pichia pastoris ) or Aspergillus niger ( Aspergillus niger ) or Trichoderma reesei ( Trichoderma reesei ).
[0013] Compared to wild-type lipase, the lipase mutant containing the R163T single-point mutation provided by this invention exhibits a 37.1% higher specific activity, reaching 3986 U / mg. This higher specific activity of the lipase mutant is beneficial for reducing its production costs and promoting its widespread application in oil processing, biodiesel, and pharmaceuticals. Detailed Implementation
[0014] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLSIN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention:
[0015] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.
[0016] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.
[0017] Culture medium formulation:
[0018] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;
[0019] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;
[0020] Yeast selection medium (MD medium): 2% peptone, 2% agarose;
[0021] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 1% Biotin, 1% Glycerin;
[0022] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 % Biotin, 0.5% Methanol;
[0023] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;
[0024] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;
[0025] The present invention will be further illustrated below with reference to the embodiments:
[0026] Example 1: Optimized synthesis of lipase gene and construction of recombinant plasmid
[0027] The lipase gene was optimized according to the codon preference of Pichia pastoris, with 6 bases added before the start codon ATG (GAATTC, an EcoRI cleavage site) and after the stop codon TAA (GCGGCCGC, a Not I cleavage site). The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. The lipase was named RL, its amino acid sequence is SEQ ID NO: 1, and its encoding nucleotide sequence is SEQ ID NO: 2.
[0028] The lipase gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, plasmid pPIC9K was digested with the same restriction endonucleases. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α Escherichia coli (Invitrogen) and selected using ampicillin. To ensure accuracy, several clones were sequenced (Sangon).
[0029] The plasmid was purified from the correctly sequenced E. coli clone using the Plasmid Mini-Preparation Kit (Omega) to obtain one recombinant plasmid, which was named pPIC9K-RL.
[0030] Example 2 Screening of lipase mutants
[0031] To further improve the specific activity of wild-type lipase RL, the applicant conducted extensive mutation screening on the enzyme using directed evolution technology.
[0032] Design PCR primers RL-F1 and RL-R1:
[0033] RL-F1: GGA gaattc GTCCCTGTCGCTGGCCATAAA (The underlined part is the EcoRI restriction enzyme recognition site).
[0034] RL-R1: ATA GGCGGCCG TTACAGGCAGGAGCCCTCGTT (The underlined part is the NotI restriction enzyme recognition site).
[0035] Using the RL gene (SEQ ID NO: 1) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The resulting product was transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing lipase.
[0036] The lipase activity was determined at 37°C and pH 7.5. 20 μL of the lysis buffer was transferred to a new 96-well plate, and 80 μL of substrate solution (prepared fresh by slowly mixing solution A and solution B in a 1:9 ratio; solution A: accurately weigh 18 mg of p-nitrophenol palmitate and dissolve it in 30 mL of isopropanol; solution B: 50 mmol / L phosphate buffer, pH 7.5) was added. The reaction was incubated at 37°C for 10 min, and then 80 μL of anhydrous ethanol was added to terminate the reaction. The absorbance was measured at 410 nm.
[0037] Experimental results showed that some mutations had no effect on the specific activity of lipase RL, while others even worsened its specific activity, which did not meet the requirements. Ultimately, the applicant screened a mutation site that could significantly improve the specific activity of lipase RL without affecting its original enzymatic properties: R163T.
[0038] This invention provides a mutant containing a single R163T mutation site, the amino acid sequence of which is SEQ ID NO: 3.
[0039] Example 3 Expression of lipase in Pichia pastoris
[0040] 3.1 Construction of expression vector
[0041] Based on the codon preference of Pichia pastoris, the gene sequences of lipase RL and its single-point mutant were optimized and synthesized by Shanghai Jereh Biotechnology Co., Ltd., with EcoRI and NotI restriction sites added at the 5' and 3' ends of the synthesized sequences, respectively.
[0042] Following the method described in Example 1, the gene sequences of the synthesized lipase RL and its single-point mutant were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The ligation was then performed on E. coli DH5α, plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μl, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM): 0.5 μL, 3' AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clone was verified, and the correct recombinant expression plasmid was obtained after sequencing.
[0043] 3.2 Construction of Pichia pastoris engineered strains
[0044] 3.2.1 Preparation of competent yeast cells
[0045] Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30℃ for 48 h. Activated GS115 single clones were then inoculated into 6 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 12 h. The culture was then transferred to Erlenmeyer flasks containing 30 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 5 h. Cell density was measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, 4 mL of cells were collected by centrifugation at 4℃ and 9000 rpm for 2 min, and transferred to sterile EP tubes. The supernatant was gently discarded, and the remaining supernatant was blotted dry with sterile filter paper. The cells were resuspended in 1 mL of pre-cooled sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were washed once more with 1 mL of sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were then resuspended in 1 mL of pre-cooled sorbitol (1... Resuspend the bacterial cells in sorbitol (1 mol / L); centrifuge at 4℃ and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the bacterial cells in 100-150 μl of pre-cooled sorbitol (1 mol / L).
[0046] 3.2.2 Conversion and Screening
[0047] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL-8 mg / mL) containing different concentrations of genimycin.
[0048] The obtained transformants were transferred to BMGY medium and cultured at 30℃ and 250 rpm for 1 day with shaking. They were then transferred to BMMY medium and cultured at 30℃ and 250 rpm with shaking. 0.5% methanol was added daily to induce expression for 4 days. The cells were removed by centrifugation at 9000 rpm for 10 min to obtain fermentation supernatants containing lipase RL and lipase mutants, respectively.
[0049] 3.3 Lipase activity assay
[0050] (1) Definition of lipase activity unit
[0051] Under conditions of 40°C and pH 7.5, the amount of enzyme required to hydrolyze a substrate to produce 1 μmol of titratable fatty acid in 1 minute is defined as one unit of enzyme activity, U.
[0052] (2) Enzyme activity assay method
[0053] Weigh 40g of polyvinyl alcohol (PVA: degree of polymerization 1750±50), add 800ml of water, soak for 4-6 hours, heat in a boiling water bath, stir until completely dissolved, stir and cool, then bring the volume to 1000ml, filter with 6-8 layers of clean gauze, and keep the filtrate for later use.
[0054] Take 150ml of the above filtrate, add 50ml of olive oil, and process with a high-speed homogenizer for 10 minutes (divided into 4 processes, 5 minutes apart, each process lasting 2-3 minutes) to obtain a milky white PVA emulsion. Prepare fresh before use.
[0055] Take two 100ml Erlenmeyer flasks, add 4ml of substrate solution and 5ml of pH7.5 phosphate buffer to the blank flask (A) and the sample flask (B) respectively, and add 15ml of 95% ethanol to the blank flask (A). Preheat in a 40℃ water bath for 5min.
[0056] Add 1 ml of the enzyme solution to be tested to both the blank bottle (A) and the sample bottle (B), mix well immediately and start timing. After reacting for 15 minutes, use a pipette to immediately add 15 ml of 95% ethanol to the sample bottle (B) to stop the reaction and remove it.
[0057] Pour the above reaction solution into a 50ml beaker, add 5ml of pure water to the Erlenmeyer flask, shake well and then pour it into the 50ml beaker, add 2 drops of phenolphthalein indicator;
[0058] Using a pH meter calibrated for alkaline conditions, add 0.05 mol / L sodium hydroxide solution to a beaker with stirring, and titrate until the pH value is 9.92; titrate until the pH value no longer changes in 20 seconds as the endpoint, and record the volume of sodium hydroxide standard solution consumed.
[0059] Enzyme activity calculation formula: X=[(V1-V2)×C×50×n] / (0.05×15).
[0060] X – Lipase activity, u / ml;
[0061] V1—Volume of sodium hydroxide standard solution consumed during sample titration, in ml;
[0062] V2—Volume of sodium hydroxide standard solution consumed during blank titration, in ml;
[0063] C – Concentration of sodium hydroxide standard solution, mol / L;
[0064] 1 ml of 50-0.05 mol / L sodium hydroxide solution is equivalent to 50 μmol of fatty acid;
[0065] n—Enzyme solution dilution factor;
[0066] 0.05 — Conversion factor for sodium hydroxide standard solution concentration;
[0067] 15 — Time conversion factor.
[0068] (3) Results of enzyme activity assay
[0069] The enzyme activity was detected using the above method. The results showed that the enzyme activity of the fermentation supernatant of the Pichia pastoris strain that recombinantly expressed lipase RL was 436 U / mL, and the enzyme activity of the fermentation supernatant of the Pichia pastoris strain that recombinantly expressed lipase mutant was 613 U / mL.
[0070] 3.4 Calculation of specific activity of lipase
[0071] The protein content of the fermentation supernatant of the recombinant lipase RL and its single-point mutant Pichia pastoris strains obtained above was detected by Coomassie brilliant blue method, and the specific activity was calculated.
[0072] Specific activity (U / mg) = enzyme activity / protein content.
[0073] The results showed that, compared with wild-type lipase RL, the lipase mutant containing the R163T single-point mutation provided by the present invention had a 37.1% higher specific activity, reaching 3986 U / mg, achieving unexpected technical effects.
[0074] In summary, the lipase mutant provided by this invention has higher specific activity, which is beneficial for reducing its production cost and promoting its widespread application in the fields of pharmaceuticals and functional oils production.
Claims
1. A lipase mutant, characterized in that, The amino acid sequence of the mutant is SEQ ID NO:
3.
2. A DNA molecule encoding the lipase mutant of claim 1.
3. A recombinant expression vector comprising the DNA molecule of claim 2.
4. A host cell comprising the recombinant expression vector of claim 3, characterized in that, The host cell is neither a plant nor an animal species.
5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris ( Pichia pastoris ).
6. The host cell as described in claim 4, characterized in that, The host cell is Aspergillus niger ( Aspergillus niger ).
7. The host cell as described in claim 4, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).
Citation Information
Patent Citations
Rhizopuschinensis lipase mutant with high activity
CN102604912A
Methods for producing lipases
CN106459937A