Multiplex PCR Amplification of MNP Markers of Hericium erinaceus Strain Huhou 28 and Its Genotype Identification Method
By using MNP marker primers for multiple PCR amplification and genotype identification in the prior art, the problem of insufficient accuracy and specificity of the selection of "Shanghai Monkey No. 28" Monkey No. 28 was solved, and higher identification accuracy and specificity were achieved.
Patent Information
- Application Number
- CN202410922773.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-10
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-07-10
AI Technical Summary
When selecting the "Shanghou Monkey No. 28" monkey head bacteria, the prior art has low accuracy and poor specificity, resulting in poor practicality.
Multiple PCR amplification of the MNP-marked MNP-marked MNP-28 strain Hu Monkey No. 28 was used to amplify and identify the genome of the Monkey No. 28 10 MNP-marked primers to determine whether its genotype is consistent with the ‘Shanghai Monkey No. 28’ strain.
The identification accuracy, specificity, repeatability and specificity of the 'Shanghai Monkey No. 28' monkey head bacteria were improved.
Smart Images

Figure CN118773292B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of the detection of Hericium erinaceus strains, and specifically relates to a multiplex PCR amplification of MNP markers of Hericium erinaceus strain Huhou No. 28 and a method for genotype identification. Background Art
[0002] Hericium erinaceus has tender flesh, delicious taste, and rich nutrition. A long time ago, it was listed among the "four famous dishes" together with bear's paw, sea cucumber, and shark fin, and had the laudatory name of "mountain delicacy Hericium erinaceus, sea delicacy bird's nest", and became a tribute in ancient times. Since the mycelium of Hericium erinaceus has strong resistance to miscellaneous bacteria and wide adaptability, it is very suitable for extensive cultivation. With the rapid development of China's edible mushroom industry, and coupled with the good stomach-nourishing effect of Hericium erinaceus, it is favored by consumers. "Huhou No. 28" is a new variety of Hericium erinaceus identified in Shanghai in 2023. It is a wild strain systematically selected, with high mushroom emergence uniformity, round mushroom shape, few deformed fruiting bodies, and strong adaptability, and is suitable for factory bottle cultivation.
[0003] In order to facilitate people to cultivate Hericium erinaceus "Huhou No. 28", currently, conventional morphological detection, antagonism test, and fruiting test are usually used to select Hericium erinaceus "Huhou No. 28". However, when this method is actually used, the accuracy is low and the specificity is poor, resulting in poor practicability. Summary of the Invention
[0004] The purpose of this part is to outline some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Simplifications or omissions may be made in this part, as well as in the abstract and title of the present application, to avoid obscuring the purpose of this part, the abstract, and the title, and such simplifications or omissions shall not be used to limit the scope of the present invention.
[0005] To solve the problems of low accuracy, poor specificity, and poor practicability in the actual use of the method of selecting Hericium erinaceus "Huhou No. 28" by using conventional morphological detection, antagonism test, and fruiting test as mentioned in the above background art, the present invention adopts the following technical solutions.
[0006] A method for multiplex PCR amplification of MNP markers of Hericium erinaceus strain Huhou No. 28 and genotype identification thereof includes the following steps:
[0007] S1. Mycelium culture: Transfer the Hericium erinaceus mycelium to a PDA plate and culture it in the dark at 25°C. After 15 days, collect the mycelium;
[0008] S2. Extraction of genomic DNA: Extract the genomic DNA of the above mycelium by the CTAB method, detect the concentration and purity of the total genomic DNA by ultraviolet spectrophotometry, and adjust the concentration of the sample DNA to 100 - 200 ng / μL;
[0009] S3. Multiplex PCR amplification: Equal amounts of the 10 pairs of primers in the MNP-labeled primer set were mixed and used for multiplex PCR amplification of the above-extracted DNA; the 10 pairs of MNP-labeled genotype combinations were for the strain with GT007 / GT007 / GT001 / GT008 / GT009 / GT001 / GT002 / GT009 / GT005 / GT002. The strain was identified as the Hericium erinaceus 'Huhou 28' strain. The sequences of the 10 pairs of MNP-labeled primer sets were SEQ ID NO.1 to SEQ ID NO.20;
[0010] S4. Sequencing: The products of the above multiplex PCR were added with Illumina sequencing adapters and barcodes and sequenced using an Illumina sequencer;
[0011] S5. Perform MNP-labeled genotype identification on the sequencing results in step S4;
[0012] The MNP-labeled primer set of the Hericium erinaceus 'Huhou 28' strain is a mixture of 10 pairs of MNP-labeled primers developed using multiple nucleotide polymorphisms in the Hericium erinaceus genome. Multiplex PCR amplification and genotype identification were performed on the Hericium erinaceus strains. The obtained genotypes were compared with the MNP genotypes of the 'Huhou 28' strain. If they are consistent with this MNP genotype, it is the Hericium erinaceus 'Huhou 28' strain.
[0013] Preferably, the amplification system for PCR in step S3 is: The total volume is 20 μL, including: 10 μL of Premix TaqTM, and the Premix TaqTM includes 1.25 U / 25 μL Taq DNA polymerase, 0.4 mM / L dNTP, 0.3 mM / L PCR buffer, 4 μmol / L mixed primers of the MNP-labeled primer set, 4 μL of ddH2O, and 2 μL of the extracted template DNA with a concentration of 100 - 200 ng / μL.
[0014] Preferably, pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 45 s, annealing at 60 °C for 5 min, extension at 72 °C for 5 min, 30 cycles; extension at 72 °C for another 7 min; preservation at 4 °C.
[0015] Preferably, the steps for MNP-labeled genotype identification in step S5 are: (1). Use the fastp software to filter the sequencing adapters;
[0016] (2). Use the BWA software to align with the GCA_016906435.1 genome, and use the samtools tool to sort the sam file and convert it into a bam file;
[0017] (3). Use bcftools for variant detection;
[0018] (4) Method for identifying MNP marker genotypes using the R package geneHapR.
[0019] Beneficial effects
[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0021] Through multiplex PCR amplification of the Hericium erinaceus 'Huhou 28' strain and identification of its MNP marker genotypes, the present invention can identify the 'Huhou 28' strain, which has the advantages of high accuracy, strong specificity, good repeatability, and strong specificity compared with conventional morphological detection, antagonism test, and fruiting test. Description of the drawings
[0022] Figure 1 It is the MNP genotype map of Huhou 28 of the present invention;
[0023] Figure 2 It is the MNP genotype map of the primer MNP1 of the present invention in 17 selected Hericium erinaceus materials;
[0024] Figure 3 It is the MNP genotype map of the primer MNP2 of the present invention in 17 selected Hericium erinaceus materials;
[0025] Figure 4 It is the MNP genotype map of the primer MNP3 of the present invention in 17 selected Hericium erinaceus materials;
[0026] Figure 5 It is the MNP genotype map of the primer MNP4 of the present invention in 17 selected Hericium erinaceus materials;
[0027] Figure 6 It is the MNP genotype map of the primer MNP5 of the present invention in 17 selected Hericium erinaceus materials;
[0028] Figure 7 It is the MNP genotype map of the primer MNP6 of the present invention in 17 selected Hericium erinaceus materials;
[0029] Figure 8 It is the MNP genotype map of the primer MNP7 of the present invention in 17 selected Hericium erinaceus materials;
[0030] Figure 9 It is the MNP genotype map of the primer MNP8 of the present invention in 17 selected Hericium erinaceus materials;
[0031] Figure 10 It is the MNP genotype map of the primer MNP9 of the present invention in 17 selected Hericium erinaceus materials;
[0032] Figure 11MNP genotype map of primer MNP10 of the present invention in 17 selected Hericium erinaceus materials. Detailed implementation manners
[0033] To make the above objects, features and advantages of the present invention more obvious and understandable, the following detailed description of the specific implementation manners of the present invention will be given in conjunction with the accompanying drawings of the specification.
[0034] In the following description, many specific details are set forth to fully understand the present invention. However, the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar generalizations without departing from the connotation of the present invention. Therefore, the present invention is not limited by the specific embodiments disclosed below.
[0035] Secondly, the so-called "one embodiment" or "embodiment" herein refers to a specific feature, structure or characteristic that can be included in at least one implementation manner of the present invention. The "in one embodiment" appearing in different places in this specification does not all refer to the same embodiment, nor is it a separate or selectively exclusive embodiment from other embodiments. The present invention provides the following embodiments.
[0036] A set of MNP marker primers for the Hericium erinaceus strain 'Huhou 28' of the present invention. This set of marker primers is composed of an equal mixture of 10 pairs of MNP marker primers, and is an MNP marker primer developed based on the continuous nucleotide polymorphisms of the Hericium erinaceus genome, with high identification accuracy, strong specificity and good repeatability. The detailed information of the markers is shown in Table 1 Table 1 List of MNP marker primer information
[0037]
[0038]
[0039] The present invention also provides multiplex PCR amplification of the Hericium erinaceus strain 'Huhou 28' and identification of its MNP marker genotypes. It uses 10 pairs of MNP marker primers developed based on the continuous nucleotide variations of the Hericium erinaceus genome to identify the MNP genotypes of the Hericium erinaceus strains, and compares the obtained genotypes with the genotypes of the 'Huhou 28' strain. If they are consistent, it is the Hericium erinaceus strain 'Huhou 28'.
[0040] Through the identification of the MNP marker genotypes of 17 collected Hericium erinaceus varieties, the present invention determined the number of allelic genotypes identified by 10 pairs of MNP marker primer sets in 17 Hericium erinaceus varieties and the number of consecutive variable nucleotide sites and numbered them (Table 2). By combining the numbers of different MNP allelic sites, the Hericium erinaceus strain 'Huhou 28' can be effectively identified ( Figure 2-11 ). The genotype combination of the Hericium erinaceus strain 'Huhou 28' is shown in Table 3.
[0041] Table 2 MNP Allelic Genotypes
[0042]
[0043] Table 3 MNP Genotypes of 'Huhou 28'
[0044]
[0045]
[0046] Marker and Premix TaqTM were both purchased from: Takala Bio Takara Biotechnology Co., Ltd.; the remaining materials and reagents were all ordinary commercially available products. The sources of 17 strains are shown in Table 4
[0047] Table 4 Sources of Strains
[0048]
[0049]
[0050] Please refer to Figure 1-11 , an embodiment provided by the present invention: a multiplex PCR amplification and genotype identification method for MNP markers of the Hericium erinaceus strain Huhou 28, comprising the following steps:
[0051] S1. Mycelium culture: Transfer the Hericium erinaceus mycelium onto a PDA plate and culture it in the dark at 25°C. After 15 days, collect the mycelium.
[0052] S2. Extraction of genomic DNA: Extract the genomic DNA of the above mycelium by the CTAB method, detect the concentration and purity of the total genomic DNA by ultraviolet spectrophotometry, and adjust the concentration of the sample DNA to 100 ng / μL.
[0053] S3. Multiplex PCR amplification: Mix 10 pairs of primers in the MNP marker primer set equally and perform multiplex PCR amplification on the above-extracted DNA. The PCR amplification system is as follows: The total volume is 20 μL, including: 10 μL of Premix TaqTM, and Premix TaqTM contains 1.25 U / 25 μL Taq DNA polymerase, 0.4 mM / L dNTP, 0.3 mM / L PCR buffer, 4 μmol / L mixed primer of the MNP marker primer set, 4 μL of ddH2O, 2 μL of the extracted template DNA with a concentration of 150 ng / μL. The reaction conditions of PCR are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at 60°C for 5 min, extension at 72°C for 5 min, 30 cycles; extension at 72°C for 7 min again; store at 4°C.
[0054] Among them, the sequences (5′-3′) of 10 pairs of MNP marker primers are as follows:
[0055] Forward primer of MNP1: CGCTCTTCCGATCTACCTGTCTGTGGCCAATGC
[0056] Reverse primer: TGCTCTTCCGATCTGGAGGGAATCGGAGGATGT
[0057] Forward primer of MNP2: CGCTCTTCCGATCTCACGAAGCTGACCGGCG
[0058] Reverse primer: TGCTCTTCCGATCTGTCCACTGCCGCCGAC
[0059] Forward primer of MNP3: CGCTCTTCCGATCTGAAGAATCGAGCACTGTAGAGT
[0060] Reverse primer: TGCTCTTCCGATCTGATTGCCTTTTTCGTCACTCA
[0061] Forward primer of MNP4: CGCTCTTCCGATCTTGGTTGACTTGAGGCAGTACTAAT
[0062] Reverse primer: TGCTCTTCCGATCTCAAGGCCTATCATAGCTTTCATAG
[0063] Forward primer of MNP5: CGCTCTTCCGATCTGCGGTATGGTGTATGGACCC
[0064] Reverse primer: TGCTCTTCCGATCTATCGTGTACTATCTGGCGAA
[0065] Forward primer of MNP6: CGCTCTTCCGATCTCATCCACCATCAAGAATCTTCTG
[0066] Reverse primer: TGCTCTTCCGATCTACAATGTGTCCTATCTTTGTCAG
[0067] Forward primer of MNP7: CGCTCTTCCGATCTGTGTCGACCATACGTTGCCT
[0068] Reverse primer: TGCTCTTCCGATCTCTATCATCGGGTGTGGGCAGA
[0069] Forward primer of MNP8: CGCTCTTCCGATCTGCAAAAAACCTCTGCCATAATTCT
[0070] Reverse primer: TGCTCTTCCGATCTCGTGGGGACGGACACATC
[0071] Forward primer of MNP9: CGCTCTTCCGATCTTGGTACAGCACGACAATATAGC
[0072] Reverse primer: TGCTCTTCCGATCTGAGCATCCGTCAGATTCGC
[0073] Forward primer of MNP10: CGCTCTTCCGATCTGGATATAGATAGGAAATCGGACATCTTT
[0074] Reverse primer: TGCTCTTCCGATCTGCATGTTGTTAGATGTCTGTTTCA
[0075] The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0076] S4, Sequencing: Add the Illumina sequencing adapter and barcode to the product of the above multiplex PCR and perform sequencing using an Illumina sequencer;
[0077] S5, Identify the MNP marker genotypes for the sequencing results in step S4:
[0078] (1), Use the fastp software to filter the sequencing adapter;
[0079] (2), Use the BWA software to align with the GCA_016906435.1 genome, and use the samtools tool to sort the sam file and convert it into a bam file;
[0080] (3), Use bcftools for variant detection;
[0081] (4), Use the R package geneHapR for the method of identifying MNP marker genotypes.
[0082] The genotypes of 10 pairs of MNP primer sets are as Figure 1 shown, and the genotypes are consistent with those of Hericium erinaceus 'Huhou 28'. It is determined that this strain is Hericium erinaceus 'Huhou 28', Figure 2-11 and the number HDR02 in Figure 1 is Hericium erinaceus 'Huhou 28', and its genotype is consistent with that of
[0083] In this embodiment, the MNP marker genotype combination of 10 pairs is: the bacterial strain with GT007 / GT007 / GT001 / GT008 / GT009 / GT001 / GT002 / GT009 / GT005 / GT002 is determined to be the Hericium erinaceus 'Huhou No. 28' bacterial strain. The sequences of the 10 pairs of MNP marker primer sets are SEQ ID NO.1 to SEQ ID NO.20.
[0084] In this embodiment, the MNP marker primer set of the Hericium erinaceus 'Huhou No. 28' strain is a mixture of 10 pairs of MNP markers developed based on multiple nucleotide polymorphisms in the Hericium erinaceus genome. Multiple PCR amplification and genotype identification are performed on the Hericium erinaceus bacterial strain, and the obtained genotype is compared with the MNP genotype of the 'Huhou No. 28' bacterial strain. If they are consistent, it is the Hericium erinaceus 'Huhou No. 28' bacterial strain.
[0085] The above content is a further detailed description of the present invention in combination with specific embodiments. It cannot be determined that the specific implementation of the present invention is only limited to these descriptions. For those of ordinary skill in the technical field to which the present invention belongs, without departing from the concept of the present invention, several simple deductions or substitutions can be made, which should all be regarded as falling within the protection scope determined by the claims submitted for the present invention.
Claims
1. A multiplex PCR amplification and genotype identification method of Hericium erinaceus strain 28 MNP marker, characterized in that: The following steps are involved: S1. Mycelial culture: transfer the mycelium of Hericium erinaceus to a PDA plate, culture at 25°C in the dark, and collect the mycelium after 15 days; S2. Extraction of genomic DNA: The genomic DNA of the hyphae was extracted by CTAB method, and the total genomic DNA concentration and purity were detected by UV spectrophotometry. The concentration of the sample DNA was adjusted to 100-200 ng / uL. S3. Multiplex PCR amplification: The 10 pairs of primers in the MNP marker primer set were mixed in equal amounts and then subjected to multiplex PCR amplification on the above-extracted DNA; the genotype combinations of the 10 pairs of MNP markers were: strains of GT007 / GT007 / GT001 / GT008 / GT009 / GT001 / GT002 / GT009 / GT005 / GT002, and the strain was determined to be Hericium erinaceus 'Shanghai Monkey 28' strain, and the sequences of the 10 pairs of MNP marker primer sets were SEQ ID NO.1 to SEQ ID NO.20; S4, sequencing: the products of the above multiplex PCR are added with Illumina sequencing adapters and barcodes and sequenced using an Illumina sequencer; S5, using the sequencing results in step S4 to identify the MNP marker genotype; The MNP marker primer set of the Hericium erinaceus 'Shanghai Hou 28' strain is a mixture of 10 pairs of MNP marker primers developed using multiple nucleotide polymorphisms of the Hericium erinaceus genome. Multiple PCR amplification and genotype identification are performed on the Hericium erinaceus strains, and the obtained genotype is compared with the MNP genotype of the 'Shanghai Hou 28' strain. The strain that is consistent with the MNP genotype is the Hericium erinaceus 'Shanghai Hou 28' strain.
2. The method for multiplex PCR amplification and genotype identification of Hericium erinaceus strain No. 28 MNP marker according to claim 1, characterized in that: The PCR amplification system in the S3 step is: a total volume of 20 μL, including: 10 uL of Premix TaqTM, the Premix TaqTM contains 1.25 U / 25 μL Taq DNA enzyme, 0.4 mM / L dNTP, 0.3 mM / L PCR buffer, 4 μmol / L MNP labeled primer set mixed primers, 4 ul ddH2O, and 2 μL of template DNA extracted with a concentration of 100-200 ng / μL.
3. The method for multiplex PCR amplification and genotype identification of Hericium erinaceus strain No. 28 MNP marker according to claim 2, characterized in that: The reaction conditions of PCR in the step S3 are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at 60°C for 5 min, extension at 72°C for 5 min, 30 cycles; further extension at 72°C for 7 min; and storage at 4°C.
4. The method for multiplex PCR amplification and genotype identification of Hericium erinaceus strain No. 28 MNP marker according to claim 1, characterized in that: The steps of MNP marker genotype identification in step S5 are: (1) filtering sequencing adapters using fastp software; (2) Use BWA software to align the GCA_016906435.1 genome, and use the samtools tool to sort the sam file and convert it into a bam file; (3) Use bcftools for mutation detection; (4) The R package geneHapR was used to perform the MNP marker genotype identification method.
Citation Information
Patent Citations
Development and application of MNP labeling method for identifying shiitake mushroom varieties
CN117106941A
MNP marker combination of yersinia pestis, primer pair combination, kit, and application thereof
WO2023077489A1