A reagent, method and kit for colorimetric detection of nucleic acid amplification reactions

Abstract

The present invention belongs to the field of rapid biological detection technology, and specifically relates to a reagent, method and kit for colorimetric detection of nucleic acid amplification reaction. Specifically, the reagent includes a metal ion and a complex indicator, and the ability of the metal ion to form a complex with the complex indicator is between the ability of the metal ion and P2O7 4‑ Complex formation ability and Mg 2+ The ability to form a complex with the complex indicator. The present invention utilizes P2O7 generated by nucleic acid amplification 4‑ By regulating the reaction between metal ions and complex indicators and realizing "non-opening the lid" readout of nucleic acid amplification signals based on the color change of the complex indicator, aerosol contamination during the detection process can be effectively avoided, which meets the actual needs of the community for large-scale screening of infectious diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of rapid biological detection, and in particular relates to a reagent, a method and a kit for colorimetric detection of nucleic acid amplification reactions. Background Art

[0002] Nucleic acid is the genetic material of all pathogens, and qualitative detection of pathogen marker nucleic acid is an effective means of pathogen screening. The polymerase chain reaction (PCR) invented by Mullis can amplify the target gene signal millions of times through semi-conservative replication, thereby achieving highly specific nucleic acid analysis at the single molecule level. After decades of development, PCR has become the gold standard for detecting nucleic acids in various biomedical fields. Among them, fluorescent quantitative PCR (qPCR) realizes real-time dynamic monitoring of the DNA amplification process by introducing fluorescent dyes or labeled probe DNA, further improving the accuracy of nucleic acid screening. However, the commercial qPCR instrument integrates complex optical components including high-precision excitation light sources and high-sensitivity detectors, and its operation is usually limited to the laboratory environment. Based on this, the development of portable signal readout technology and the improvement of the accessibility of PCR detection technology are expected to break through the current dilemma that qPCR is limited to laboratories, thereby promoting it to play a greater role in the field of pathogenic microorganism screening.

[0003] Colorimetry is favored for its advantages such as visualization of detection results, strong portability, and low cost. In theory, the combination of colorimetric detection and a portable temperature-variable device can realize the function of qPCR and avoid dependence on complex equipment, which is conducive to the promotion of PCR technology in resource-limited environments. However, the existing colorimetric methods used in conjunction with PCR technology are difficult to achieve real-time monitoring. Most methods require complex operations, and some technologies even require product transfer after amplification, which can easily cause serious aerosol contamination and produce false positive results.

[0004] Therefore, a new colorimetric detection technology is needed in this field to solve the problem that most current colorimetric technologies require the "opening" operation, which can easily lead to cross-contamination of amplified nucleic acids. Although some studies have used hydroxynaphthol blue (HNB) as an indicator, using Mg in the isothermal amplification reaction system 2+ The complex reaction between Mg and Mg is used to monitor the amplification reaction in real time, but this is difficult to achieve in other nucleic acid amplification reaction systems such as PCR systems. 2+ (2 ~ 5 mM) participate, and the P2O7 produced by PCR theoretically 4- Only 0.4 ~ 0.8 mM (limited by the initial dNTPs concentration of the system), much less than free Mg 2+ Therefore, the P2O7 4-Will directly react with free Mg 2+ The reaction generates Mg2P2O7, which is difficult to replace with Mg 2+ Pre-bound complexing agents. Changing the dNTPs or Mg in the existing PCR system 2+ Concentration will cause a sharp decrease in its amplification specificity or efficiency.

[0005] In addition, the absorption spectra of the same concentration solutions under different buffer pH conditions showed that Mg 2+ The complex strength with HNB is stronger at pH 9.0-10.0. As the pH decreases, the complex strength decreases. At pH 8.0-8.5, the complex strength is very low. The pH of the PCR system is around 8.0. At this time, Mg 2+ The complexing ability with HNB is very low (almost no complexing), which also limits the application of HNB in ​​PCR systems.

[0006] Therefore, there is an urgent need to develop a new colorimetric detection method that is compatible with the PCR amplification system and "non-opening", so as to provide a new option for large-scale on-site screening in resource-poor areas. Summary of the invention

[0007] In order to solve the above problems, considering that nucleic acid amplification is accompanied by P2O7 4- The present invention utilizes P2O7 4- The present invention introduces a complex indicator (such as hydroxynaphthol blue (HNB)) and a metal ion (such as scandium ion (Sc)) that can form a complex into the nucleic acid amplification reaction. 3+ ) and a new colorimetric detection method was constructed. Before nucleic acid amplification, the complex indicator (such as HNB) and the metal ion (such as Sc 3+ ) forms a complex that exhibits a color (such as a violet complex (Sc-HNB)). As nucleic acid amplification proceeds, the generated P2O7 4- The complex indicator will be replaced to generate metal ions and P2O7 4- The free complex indicator will make the system appear in another color (such as blue), and the colorimetric detection of nucleic acid amplification can be achieved through color change (such as violet → blue).

[0008] Specifically, in one aspect, the present invention provides a method for colorimetric detection of nucleic acid amplification reaction, the method comprising adding a metal ion and a complex indicator to a nucleic acid amplification reaction system, wherein the ability of the metal ion to form a complex with the complex indicator is between the ability of the metal ion to form a complex with P2O7 generated during the nucleic acid amplification reaction. 4- Complex formation ability and Mg 2+The ability of the metal ion to form a complex with the complex indicator is such that in the nucleic acid amplification reaction system, when there is no amplification reaction, a complex of the metal ion and the complex indicator is preferentially formed (and Mg is not formed). 2+ and the complex indicator), and when there is an amplification reaction, the metal ion is preferentially formed with P2O7 produced during the nucleic acid amplification reaction. 4- The complex is then freed to produce a free complex indicator, thereby indicating the occurrence of the amplification reaction through the color change of the complex indicator.

[0009] Furthermore, the complex indicator exhibits different colors in a complexed state and in a free state.

[0010] Furthermore, the method includes adding metal ions and complex indicators to the nucleic acid amplification reaction system before or after performing the amplification reaction, thereby achieving real-time monitoring or endpoint detection of the amplification reaction.

[0011] Therefore, the method for colorimetric detection of nucleic acid amplification reaction includes adding the metal ion and the complex indicator to the nucleic acid amplification reaction system before performing the amplification reaction, then performing the amplification reaction, and monitoring (e.g., colorimetric detection) the color change of the reaction system in real time during the process to determine the occurrence of the nucleic acid amplification reaction. Alternatively, the method for detecting nucleic acid amplification reaction includes first performing the nucleic acid amplification reaction, adding the metal ion and the complex indicator to the nucleic acid amplification reaction system after the reaction is completed, and then detecting (e.g., colorimetric detection) the color change of the reaction system to determine the occurrence of the nucleic acid amplification reaction.

[0012] Further, the addition of metal ions and complex indicators to the nucleic acid amplification reaction system after the amplification reaction is performed can be performed without exposing the nucleic acid amplification reaction system to air. This can be, for example, provided in a container containing the nucleic acid amplification reaction system, with a second chamber containing reagents containing metal ions and complex indicators separated from the nucleic acid amplification reaction system, so that after the amplification reaction is completed, the reagents containing metal ions and complex indicators in the second chamber can be mixed with the nucleic acid amplification reaction system. For example, the reagent containing metal ions and complex indicators can be a lyophilized reagent, which can adhere to the second chamber by its own adhesion, thereby being separated from the amplification reaction system in the first chamber, and when mixing is required, it is only necessary to allow the amplification reaction system in the first chamber to flow into the second chamber. Alternatively, the second chamber is separated from the first chamber containing the nucleic acid amplification reaction system by a destructible isolation structure (for example, it can be composed of paraffin that can melt and fall off under heating conditions or can be composed of PEG to encapsulate the reagent containing metal ions and complex indicators in the second chamber, and the volume of the second chamber can be reduced so that the second chamber can be stably adhered and not easy to fall during the amplification process), thereby separating the amplification reaction system in the first chamber from the reagent containing metal ions and complex indicators in the second chamber. When mixing is required, it is only necessary to destroy the destructible isolation structure (for example, heating, dissolving with the amplification system solution). Furthermore, the first chamber can be a chamber or a part of a tube body of a reaction vessel for performing a nucleic acid amplification reaction, and the second chamber can be a chamber or a part of a tube cover of a reaction vessel for performing a nucleic acid amplification reaction. Those skilled in the art can think of other technologies to achieve this effect.

[0013] Furthermore, the metal ion and the complex indicator can be selected from any suitable metal ion and complex indicator capable of forming a complex, as long as the ability of the metal ion and the complex indicator to form a complex is between the ability of the metal ion and the P2O7 4- Complex formation ability and Mg 2+ The ability to form a complex with the complex indicator can be between.

[0014] Further, the metal ion and the complex indicator may be selected from, but not limited to, scandium ion and hydroxynaphthol blue, zinc ion and hydroxynaphthol blue, calcium ion and arsenazo III, or lead ion and arsenazo III.

[0015] As used herein, the nucleic acid amplification reaction system is not limited as long as it can perform a nucleic acid amplification reaction on a nucleic acid sample and there is P2O7 during amplification. 4- Just generate it.

[0016] Generally speaking, a nucleic acid amplification reaction system includes primers, DNA polymerase, dNTPs, and a buffer.

[0017] Furthermore, the buffer contains magnesium salt required for the activity of DNA polymerase.

[0018] Furthermore, the pH of the buffer is 7.5-9.0, such as 7.5-8.5, such as 8.0.

[0019] Furthermore, the nucleic acid amplification reaction system may also include other reagents for performing nucleic acid amplification.

[0020] Further, such a nucleic acid amplification reaction system may include, for example, a method for performing a polymerase chain reaction (PCR) (i.e., a conventional typical PCR including denaturation, annealing, and extension steps), a rolling circle amplification (RCA), a loop-mediated isothermal amplification (LAMP), a recombinase polymerase amplification (RPA), or other P2O7 4- The generated amplification reaction system.

[0021] In another aspect, the present invention provides a reagent for colorimetric detection of nucleic acid amplification reaction, the reagent comprising a metal ion and a complex indicator, wherein the ability of the metal ion to form a complex with the complex indicator is between the ability of the metal ion to form a complex with P2O7 4- Complex formation ability and Mg 2+ The ability to form a complex with the complex indicator.

[0022] Further, the metal ion and the complex indicator may be selected from, but not limited to, scandium ion and hydroxynaphthol blue, zinc ion and hydroxynaphthol blue, calcium ion and Arsenazo III, or lead ion and Arsenazo III.

[0023] Furthermore, the reagent includes the metal ion and the complex indicator dissolved in a buffer solution, thereby forming a complex of the metal ion and the complex indicator.

[0024] Furthermore, the buffer is Tris buffer or other suitable buffer.

[0025] Furthermore, the pH of the buffer solution is 7.5-9.0, such as 7.5-8.5, such as 8.0.

[0026] Furthermore, the metal ions exist in the form of metal salts thereof.

[0027] Furthermore, the reagent is obtained by uniformly mixing the complex indicator and the salt of the metal ion in a buffer solution to allow the complex indicator to fully complex with the metal ion (by leaving it in place for a sufficient time in advance).

[0028] In another aspect, the present invention provides a kit for colorimetric detection of nucleic acid amplification reactions, the kit comprising reagents for detecting nucleic acid amplification reactions as described herein.

[0029] Furthermore, the kit also includes reagents for performing nucleic acid amplification reactions.

[0030] Furthermore, the nucleic acid amplification reaction system includes primers, DNA polymerase, dNTPs, and a buffer.

[0031] Furthermore, the buffer contains magnesium salt required for the activity of DNA polymerase.

[0032] Furthermore, the pH of the buffer is 7.5-9.0, such as 7.5-8.5, such as 8.0.

[0033] Furthermore, the nucleic acid amplification reaction system may also include other reagents for performing nucleic acid amplification.

[0034] Further, such a nucleic acid amplification reaction system may include, for example, a method for performing a polymerase chain reaction (PCR) (i.e., a conventional typical PCR including denaturation, annealing, and extension steps), a rolling circle amplification (RCA), a loop-mediated isothermal amplification (LAMP), a recombinase polymerase amplification (RPA), or other P2O7 4- The generated amplification reaction system.

[0035] Beneficial effects of the present invention

[0036] In this aspect, the P2O7 generated during nucleic acid amplification is used 4- Regulation of metal ions (such as Sc 3+ The reaction between the MgCl2 and the complex indicator (such as HNB) is realized based on the color change of the complex indicator, and the nucleic acid amplification signal can be read out without opening the cover, which can effectively avoid aerosol contamination during the detection process and meet the actual needs of the community for large-scale screening of infectious diseases. In addition, the constructed colorimetric method does not require the addition of MgCl2. 2+ , which has little effect on the activity of polymerase; HNB and Sc 3+ The reagents are cheap and will not significantly increase the reagent cost of PCR; the colorimetric process is monitored in real time without additional operation. Therefore, the colorimetric detection method of the present invention combined with a portable temperature-changing device is expected to become a new option for on-site screening of pathogens in resource-poor areas. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The complex (Sc-HNB) of the method of the present invention and the ions (Mg 2+ 、P2O7 4-)'s complexing ability comparison.

[0038] Figure 2 The indicator (HNB) of the method of the present invention and the complex of other metal ions (Zn-HNB) and the ions (Mg 2+ 、P2O7 4- )'s complexing ability comparison.

[0039] Figure 3 The complex (Ca-Arsenazo III) of other indicators (e.g., Arsenazo III) of the method of the present invention and the ions (Mg 2+ 、P2O7 4- )'s complexing ability comparison.

[0040] Figure 4 The other complex (Pb-Arsenazo III) of the method of the present invention and the ions (Mg 2+ 、P2O7 4- )'s complexing ability comparison.

[0041] Figure 5 The RGB values ​​of the blank and sample of the endpoint detection amplification system of the complexes (Sc-HNB, Zn-HNB, Ca-Arsenazo III, Pb-Arsenazo III) used in the method of the present invention were compared.

[0042] Figure 6 The method of the present invention (taking Sc-HNB as an example) can cause ion replacement within the pH range (8.0 to 9.0) of the PCR system.

[0043] Figure 7 The complex of the method of the present invention (taking Sc-HNB as an example) can detect the target DNA in the PCR system. By testing the absorption spectrum of the mixed system of the complex and PCR before and after amplification, it can be seen from the change of the absorption peak that the absorbance value at the maximum absorption wavelength of Sc-HNB decreases after amplification, while the absorbance value at the maximum absorption wavelength of free HNB increases. This experimental result strongly shows that in the presence of target DNA, a large amount of P2O7 generated by amplification 4- Can replace Sc 3+ This makes HNB free, so that the peak value at the maximum absorption wavelength of Sc-HNB decreases and the peak value at the maximum absorption wavelength of HNB increases in the absorption spectrum.

[0044] Figure 8The complex of the method of the present invention (taking Sc-HNB as an example) has the ability to realize endpoint detection in the actual amplification system. After the PCR system is amplified, it is mixed with the complex to detect the amplification product P2O7 with different initial concentrations of the target DNA. 4- The initial concentration increases and the amplification produces P2O7 4- The amount of ions also increases, and the degree to which the system color changes from blue to violet increases, proving that it has the ability to achieve endpoint detection in an actual amplification system.

[0045] Fig. 9 The absorption spectrum of the complex (taking Sc-HNB as an example) of the method of the present invention before and after thermal cycling. The experimental data results show that after thermal cycling, the peak shape of the absorption peak has no obvious change, which proves that it has good thermal stability and indicates that it has the potential for real-time monitoring.

[0046] Fig.10 The method of the present invention (taking Sc-HNB as an example) has the ability of real-time monitoring. Under the condition that the complex (Sc-HNB) is mixed with the PCR system before amplification, and then the target DNA of the same concentration is amplified in different cycles, the color of the system has a corresponding change in intensity. This shows that the complex system can be compatible with the PCR amplification system to achieve real-time monitoring, and by increasing the number of amplification cycles, the sensitivity of real-time monitoring can be improved.

[0047] Fig.11 The method of the present invention (taking Sc-HNB as an example) has good detection stability. By real-time monitoring of 11 samples and 11 blanks, the RGB signal values ​​(blue / red) are read and the relative standard deviation is calculated.

[0048] Fig.12 The method of the present invention (taking Sc-HNB as an example) detects the Salmonella genome, and the RGB signal value (blue / red) is used as the signal output result.

[0049] Fig.13 The method of the present invention (taking Sc-HNB as an example) detects the human papillomavirus type 16 (HPV 16) genome, and the RGB signal value (blue / red) is used as the signal output result.

[0050] Fig.14 The method of the present invention (taking Sc-HNB as an example) detects the human papillomavirus type 18 (HPV 18) genome, and the RGB signal value (blue / red) is used as the signal output result.

[0051] Fig.15 The method of the present invention (taking Sc-HNB as an example) detects the human papillomavirus type 33 (HPV 33) genome, and the RGB signal value (blue / red) is used as the signal output result.

[0052] Fig.16 The method of the present invention (taking Sc-HNB as an example) detects the human papillomavirus type 45 (HPV 45) genome, and the RGB signal value (blue / red) is used as the signal output result.

[0053] Fig.17 The method of the present invention (taking Sc-HNB as an example) detects the human papillomavirus type 52 (HPV 52) genome, and the RGB signal value (blue / red) is used as the signal output result.

[0054] Fig.18 The method of the present invention (taking Sc-HNB as an example) detects the human papillomavirus type 58 (HPV 58) genome, and the RGB signal value (blue / red) is used as the signal output result.

[0055] Fig.19 The results of the method of the present invention (taking Sc-HNB as an example) for detecting clinical samples infected with human papillomavirus type 16 (HPV16) were analyzed by using confusion matrix to compare the differences with clinical test results.

[0056] Fig. 20 The results of the method of the present invention (taking Sc-HNB as an example) for detecting clinical samples infected with human papillomavirus type 18 (HPV18) were analyzed by using confusion matrix to compare the differences with clinical test results.

[0057] Fig.21 The results of the method of the present invention (taking Sc-HNB as an example) for detecting clinical samples infected with human papillomavirus type 33 (HPV33) were analyzed by using confusion matrix to compare the differences with clinical test results.

[0058] Fig. 22 The results of the method of the present invention (taking Sc-HNB as an example) for detecting clinical samples infected with human papillomavirus type 45 (HPV45) were analyzed by using confusion matrix to compare the differences with clinical test results.

[0059] Fig.23 The results of the method of the present invention (taking Sc-HNB as an example) for detecting clinical samples infected with human papillomavirus type 52 (HPV52) were analyzed by using confusion matrix to compare the differences with clinical test results.

[0060] Fig.24 The results of the method of the present invention (taking Sc-HNB as an example) for detecting clinical samples infected with human papillomavirus type 58 (HPV58) were analyzed by using confusion matrix to compare the differences with clinical test results.

[0061] Fig.25 Schematic diagram of the process of the present invention (taking Sc-HNB as an example). DETAILED DESCRIPTION

[0062] Feasibility verification of the method of the present invention

[0063] First, the feasibility of the method of the present invention was demonstrated by comparing the complexing ability. ① First, the absorption of 40 μM HNB dissolved in Tris buffer solution (100 mM, pH = 8.0) was measured (wavelength range: 400 ~ 750 nm); ② Second, 1 mM Mg was added to ① 2+ , after mixing, place at room temperature for 48 hours, and measure its absorption (wavelength range: 400 ~ 750nm); ③ Then, add 1 mM Sc 3+ After mixing, place at room temperature for 48 hours, the color changes from blue to purple, and its absorption is measured (wavelength range: 400 ~ 750 nm); ④ Add 2 mM P2O7 to ③ 4- After mixing, place at room temperature for 48 hours, the color changes from purple to blue, and the absorption is measured (wavelength range: 400 ~ 750 nm). According to the addition and combination of different ions, the visible spectrum absorption is measured after each component is stable ( Figure 1 ), according to the absorption spectrum, the relationship between the complexing ability is: Sc-P2O7>Sc-HNB>Mg-HNB. This result proves that P2O7 can be detected by adding Sc-HNB. 4- , and the Mg in the system 2+ No effect on Sc-HNB.

[0064] Furthermore, by repeating the above experimental steps, it was found that in addition to Sc-HNB, other complexes (such as Zn-HNB, Ca-Arsenazo III, Pb-Arsenazo III) also have the same complexing capacity relationship. Using M to represent the metal ion and Y to represent the indicator, the above complexing capacity relationship can be expressed as M-P2O7>MY>Mg-Y ( Figure 2 - 4). This indicates that complexes with similar complexing capacity have the potential to achieve "non-opening" detection. P2O7 can be detected by adding MY 4- , and the Mg in the system 2+ No impact on MY.

[0065] Next, we use freeze drying (or drying, etc.) to load MY on the top of the amplification reagent tube cap. Then, amplify the blank and sample separately. After the amplification is completed, shake the amplification tube up and down to fully mix the detection system and the amplification system, and then use a mobile phone to take a photo to read the RGB value of the test result ( Figure 5). The results show that the four complexes listed (Zn-HNB, Ca-Arsenazo III, Pb-Arsenazo III) have obvious distinction between the color response (RGB value) of blank and sample, which means that "non-opening" detection can be achieved through this form of ion replacement.

[0066] Next, in order to explore whether this method can achieve real-time monitoring of the amplification process, we used Sc-HNB as an example to illustrate the method.

[0067] First, by performing ion exchange reactions in different pH ranges, it was proved that this study is compatible with the pH of the PCR amplification system. According to step (1), it can be concluded that the maximum absorption of HNB is at 649 nm. Therefore, we repeated ①②③④ in step (1) within the pH range of PCR amplification (8.0 ~ 9.0), tested 3 groups in parallel, and detected their absorption at 649 nm ( Figure 6 ). The results show that the method of the present invention can successfully detect P2O7 in the range of pH 7.5 to 9.0. 4- .

[0068] Next, in order to prove that the complex (Sc-HNB) can detect the amplified product P2O7 4- We first mixed the complex system with the PCR system containing the target DNA and measured its absorption spectrum. Then we performed PCR amplification on it, and after the amplification was completed, we measured its absorption spectrum again ( Figure 7 ). Comparing the two absorption spectra, it can be seen that in the presence of target DNA, after PCR amplification, the peak value at the maximum absorption wavelength of Sc-HNB decreases, that is, the Sc-HNB content decreases; while the peak value at the maximum absorption wavelength of HNB increases, that is, the free HNB increases. This result proves that the P2O7 produced after PCR cycles 4- Can replace Sc in Sc-HNB 3+ , which makes HNB free, causing the system to change color.

[0069] Furthermore, in order to explore the detection performance of this method, we first conducted an endpoint detection sensitivity exploration experiment, using the Salmonella genome as the target gene to verify the feasibility of ion exchange-based detection. We chose to freeze-dry the complex (Sc-HNB) on the top of the amplification tube. After the amplification system is completed, shake the amplification tube up and down to fully mix the amplification system and the complex system, and then read the RGB value, with blue / red as the result output value. The results show that the P2O7 produced by amplifying different initial concentrations of target DNA 4- The amount is also different ( Figure 8), and the degree of color change is also different. According to the RGB value, the target DNA as low as a single copy can be detected. This result once again shows that the colorimetric detection method based on ion replacement is feasible.

[0070] Furthermore, the feasibility of “non-opening” real-time monitoring was further demonstrated by testing the thermal stability of the complex. In order to explore the capabilities of the present invention in actual detection, considering that the complex (Sc-HNB) may decompose during the PCR thermal cycle, we took 20 μL of 1 mM ScCl3 and 60 μL of 1 mM HNB in ​​920 μL of Tris buffer solution (100 mM, pH = 8.0), mixed them evenly, and left them at room temperature for a sufficient time to allow them to complex to the greatest extent. After seven days, 500 μL of liquid was divided into 10 PCR tubes for PCR thermal cycling. After the thermal cycle was completed, the 10 tubes of liquid were integrated into 1 tube, which was then spectrally scanned; the remaining 500 μL of liquid was not subjected to thermal cycling treatment, but was directly spectrally scanned ( Fig. 9 ). By comparing the results, it can be found that the peak shape of the solution before and after the thermal cycle did not change significantly, but the absorption at 535 nm was significantly enhanced, and the weak peak at 649 nm disappeared, which shows that after the thermal cycle, Sc-HNB complexed more thoroughly (which had no effect on the detection) and did not decompose. The above results show that Sc-HNB has good thermal stability.

[0071] Furthermore, the present invention uses the Salmonella genome as the target DNA and amplifies the target DNA of the same concentration for different cycles. After the amplification is completed, the RGB value is read as (blue / red)

[0072] The results show that the P2O7 generated by different amplification cycles 4- The amount is also different ( Fig.10 ), and the degree of color change is also different. This shows that the "non-opening" colorimetric detection based on ion replacement can detect reactions with different amplification degrees.

[0073] Furthermore, the present invention has good detection stability. By simultaneously testing 11 blanks and 11 identical samples ( Fig.11 ), the calculated relative standard deviations were 0.94% and 1.21% respectively.

[0074] Furthermore, the present invention has good detection sensitivity and can detect target DNA as low as a single copy. By testing a series of concentrations of bacterial and viral genomes, 5 μL of 200mM Sc-HNB was added to 50 μL of amplification system, mixed and then PCR amplification was performed. After amplification, RGB reading was performed ( Fig.12~ 18). The results showed that as low as 1 copy of target DNA could be distinguished using RGB readout.

[0075] Finally, the present invention was used to detect clinical samples of different types of human papillomavirus infection ( Fig.19 ~ 24), the detection results are subjected to confusion matrix analysis, and the results show that the present invention has good actual detection ability.

[0076] Fig.25 It is a schematic summary of the method described above using Sc-HNB as an example, wherein the upper figure is a schematic process of the above endpoint detection, and the lower figure is a schematic process of the above real-time monitoring.

[0077] The present invention is further described below with reference to specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0078] The primer sequences targeting different genomes (including viruses, bacteria and humans) in the following examples are partially derived from literature and partially designed by NCBI. The specific sequences are shown in the table below.

[0079] Table 1 Primer sequences used for each genome

[0080] Genome Forward primer (5'®3') Length (bp) Reverse primer (5'®3') Length (bp) References salmonella CTTGATTGAAGCCGATGC 18 GATAAACTGGACCACGGTG 19 [1] HPV 16 GACAAGCAGAACCGGACAGAG 21 ATGTCTACGTGTGTGCTTTGTA 22 HPV 18 GTCACGAGCAATTAAGCGACT 21 TTGTGTGACGTTGTGGTTCG 20 HPV 33 GACGTGTAAAAACGCCATGAGA 22 TCCAAGCCTTCATCCTCATCTG 22 HPV 45 CGGTGCCAGAAACCATTGAA 20 AAGTCTTTCTTGCCGTGCCT 20 HPV 52 ATGTTCCAGGACGCAGAGGA 22 ATACCTCAGATCGCTGCAAAGT 20 HPV 58 CCTACCCTGTGTCCTACTTTGT 20 ACCAAAGTTGTGCCAAGACC 22

[0081] In Table 1, reference 1 refers to: Li, X.; Zheng, T.; Xie, YN et al., Recombinasepolymerase amplification coupled with a photosensitization colorimetric assay for fast salmonella spp. Testing. Anal Chem. 2021, 93 (16), 6559-6566.

[0082] The above primers were purchased from Sangon Biotechnology (Shanghai) Co., Ltd. and dissolved in ultrapure water for later use.

[0083] The PCR kit and qPCR kit used in the following examples were purchased from TaKaRa. In addition, the following descriptions are worth noting:

[0084] In the following examples, the concentrations of genomic DNA are all quantitative results of qPCR;

[0085] Under the same analytical conditions, the comparative examples serve as reference standards for determining the qualitative analytical performance of the examples.

[0086] Example 1

[0087] (1) Prepare a specific concentration of Salmonella genome sample based on the qPCR quantitative results;

[0088] (2) According to the operating instructions of the PCR reagent, add the PCR amplification reagent, primers (300 nM) and Sc-HNB (20 μM) to the reaction tube, add 2uL of a series of concentration gradients of Salmonella genome (1, 10, 100, 1000, 10000, 100000 copies), mix well, and centrifuge for 1 minute. Place the reaction tube in the PCR instrument and set the PCR amplification program: 95 ℃ denaturation for 2 min, amplification cycle (95 ℃ denaturation for 0.25 min, 60 ℃ annealing for 0.5 min, 72 ℃ extension for 1 min), and stop the reaction after 50 cycles.

[0089] (3) Take out the amplification tube and place it in a specific photography box to take a photo. Use the photo to directly read the RGB value and draw a data analysis chart based on (blue / red). Fig.12 ).

[0090] Embodiment 2-7

[0091] (1) Based on the qPCR quantitative results, prepare human papillomavirus genome samples of specific concentrations;

[0092] (2) According to the operating instructions of the PCR reagent, add the PCR amplification reagent, primers (300 nM) and Sc-HNB (20 μM) to the reaction tube, add 2uL of a series of concentration gradient human papillomavirus genomes (1, 10, 100, 1000, 10000 copies), mix well, and centrifuge for 1 minute. Place the reaction tube in the PCR instrument and set the PCR amplification program: 95 ℃ denaturation for 2 minutes, amplification cycle (95 ℃ denaturation for 0.25 min, 60 ℃ annealing for 0.5 min, 72 ℃ extension for 1 min), and stop the reaction after 50 cycles.

[0093] (3) Take out the amplification tube and place it in a specific photography box to take a photo. Use the photo to directly read the RGB value and draw a data analysis chart based on (blue / red). Figure 13-17 ).

[0094] (4) This method was used to detect clinical samples (cervical cells), and the test results were compared with the clinical results to perform confusion matrix analysis ( Figure 19-24 ), the results show that this method has good detection performance.

[0095] Comparative Example 1

[0096] The method steps and conditions used in this comparative example are the same as those in Example 1, except that the Salmonella genome is not added in the comparative example, and the addition of the same volume of H2O is used to replace the sample addition step in the example.

[0097] Fig.11 Comparative Example 1 (Blank) and Example 1 (1-10) for detecting the genome of Salmonella using the method of the present invention 5 copies). Fig.11 It can be seen that: 1) for the PCR blank group (Blank) without the added target (Salmonella genome), the (blue / red) signal value is low; 2) after adding the Salmonella genome, a large amount of P2O7 is generated during the amplification process 4- Sc is replaced from Sc-HNB. At this time, the color of the system changes from violet (Sc-HNB) to blue (free HNB). And the greater the concentration of target DNA, the more P2O7 is produced. 4- The more there is, the greater the degree to which the system shifts from violet to blue.

[0098] Comparative Examples 2-7

[0099] The method steps and conditions used in Comparative Examples 2-7 are the same as those in the corresponding Examples 2-7, except that the human papillomavirus genome is not added in the Comparative Examples, and the addition of the same volume of H2O is used instead of the sample addition step in the Examples.

[0100] Figure 13-18 Comparative Example 2-7 (Blank) and Example 2-7 (1-10) for detecting human papillomavirus by the method of the present invention 4 The Blue / Red signal value of Figure 13-18 It can be seen that: 1) for the PCR blank group (Blank) without the addition of the target (human papillomavirus genome), the (blue / red) signal value is low; 2) after adding the human papillomavirus genome, a large amount of P2O7 is generated during the amplification process 4- , replacing Sc from Sc-HNB 3+ At this time, the color of the system changes from violet (Sc-HNB) to blue (free HNB). And the greater the concentration of target DNA, the more P2O7 is produced. 4- The more there is, the greater the degree to which the system shifts from violet to blue.

[0101] Table 2 Performance of “non-opening” detection of bacterial and viral genomes based on ion exchange

[0102]

[0103] According to the results of Examples 1-7 and Comparative Examples 1-7, it can be shown that this method has the following two advantages:

[0104] (1) The present invention can be applied to the detection of most pathogen genomes by only changing the designed specific primers;

[0105] (2) Considering the issue of amplification efficiency, the detection sensitivity can be increased by changing the number of amplification cycles.

[0106] Moreover, the entire detection process only requires the addition of the complex (Sc-HNB) during the preparation of the amplification reagent to achieve "non-opening" visual detection, which greatly reduces the difficulty of the detection operation.

[0107] It should be noted that the preferred embodiments of the present invention are given in the specification of the present invention, but the present invention can be implemented in many different forms and is not limited to the embodiments described in this specification. These embodiments are not intended to be additional limitations on the content of the present invention. The purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive. In addition, the above-mentioned technical features continue to be combined with each other to form various embodiments not listed above, which are all considered to be within the scope of the present invention specification; further, for ordinary technicians in this field, they can be improved or transformed according to the above description, and all these improvements and transformations should belong to the protection scope of the claims attached to the present invention.

Claims

1. A method for colorimetric detection of nucleic acid amplification reactions, characterized in that: The method comprises adding metal ions and a complex indicator into a nucleic acid amplification reaction system, wherein the ability of the metal ions to form a complex with the complex indicator is between the ability of the metal ions to form a complex with P2O7 generated during the nucleic acid amplification reaction. 4- Complex formation ability and Mg 2+ The ability to form a complex with the complex indicator is such that in the nucleic acid amplification reaction system, when there is no amplification reaction, the complex of the metal ion and the complex indicator is preferentially formed, and the Mg is not formed. 2+ The complex of the complex indicator, and when there is an amplification reaction, the metal ion is preferentially formed with P2O7 produced during the nucleic acid amplification reaction. 4- The complex of the present invention is to produce a free complex indicator, wherein the complex indicator exhibits different colors in the complex state and in the free state, thereby indicating the occurrence of the amplification reaction by the color change of the complex indicator, The metal ion and the complex indicator are scandium ion and hydroxynaphthol blue; and the method is not intended for disease diagnosis.

2. The method according to claim 1, characterized in that: The method comprises adding metal ions and a complex indicator into a nucleic acid amplification reaction system before or after performing an amplification reaction, thereby achieving real-time monitoring or endpoint detection of the amplification reaction.

3. The method according to claim 1, characterized in that The nucleic acid amplification reaction system comprises primers, DNA polymerase, dNTPs and a buffer, wherein the buffer comprises magnesium salt required for the DNA polymerase to exert its activity, and the pH of the buffer is 7.5-9.

0.

4. The method according to claim 1, characterized in that The nucleic acid amplification reaction system includes a method for performing polymerase chain reaction, rolling circle amplification, loop-mediated isothermal amplification, recombinase polymerase amplification or other P2O7 4- The generated amplification reaction system.

5. A reagent for colorimetric detection of nucleic acid amplification reactions, characterized in that: The reagent comprises a metal ion and a complex indicator, wherein the ability of the metal ion and the complex indicator to form a complex is between that of the metal ion and P2O7 4- Complex formation ability and Mg 2+ between the ability to form a complex with the complex indicator; The metal ion and the complex indicator are selected from scandium ion and hydroxynaphthol blue.

6. A kit for colorimetric detection of nucleic acid amplification reactions, characterized in that: The kit comprises the reagent for colorimetric detection of nucleic acid amplification reaction according to claim 5.

7. The kit according to claim 6, characterized in that The kit also includes reagents for performing a nucleic acid amplification reaction.

Images