Macrobrachium nipponense insulin-like peptide gene MnILP2 and its application

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a Japanese prawn insulin-like peptide gene MnILP2 and an application thereof. The nucleotide sequence of the Japanese prawn insulin-like peptide gene MnILP2 is shown in SEQ ID NO.1. The gene can be used to regulate ovarian maturation during the ovarian development of female Japanese prawn. The gene can be used to promote ovarian maturation during the ovarian development of female Japanese prawn.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a Macrobrachium nipponense insulin-like peptide gene MnILP2 and an application thereof. Background Art

[0002] Insulin-like peptides (ILPs) are the most widely distributed peptides in invertebrates and are important regulators of animal growth, development, metabolism and reproduction. In invertebrates, a variety of ILPs are believed to regulate not only animal growth, but also reproduction and development via the PI3K / AKT signaling pathway.

[0003] Macrobrachium japonica ( macrobrachium nipponense ), commonly known as green shrimp and river shrimp, is one of the important freshwater farmed shrimps in my country.

[0004] Female Japanese swamp shrimp have the characteristic of "short sexual maturity period". They can reach sexual maturity about 45 days after entering the breeding season, and can reproduce multiple generations in the same year. When the water temperature reaches above 28°C during the breeding season, female shrimps can complete an ovarian maturation cycle in about 15 days. According to the external characteristics and material composition of the different stages of ovarian development of Japanese swamp shrimp, the ovarian development stage can be divided into five periods: proliferation period, small growth period, large growth period, maturity period and recovery period. Among them, the ovaries in the growth period are grass green, the volume increases rapidly, and its outline is more obvious when observed from its back. Tissue section observation found that the ovarian wall gradually began to thin, the ovarian cavity became narrow, a layer of vacuoles appeared around the oocytes, and the oocytes began to deposit yolk. The oocytes were round or oval. The mature ovaries are dark green, and the volume basically reaches the maximum state. The external morphology of the ovaries can be seen very clearly. The ovaries are full and fill the entire cephalothorax area, and the back is reddish brown. Tissue section observation shows that the ovarian wall becomes extremely thin during this period, the oocyte is fully developed and nearly round, the cytoplasm is filled with a large number of granules, the nuclear vesicles rupture, the cell nuclei disappear, and the follicular cell layer separates from the oocyte.

[0005] TGF-β is one of the important members of the TGF-β superfamily and plays an important role in various physiological processes such as cell proliferation, differentiation, migration, and apoptosis. Usually, the downstream effector transcription factor of the TGF-β signaling pathway is Smad. The TGF-β family ligand dimer forms a complex with the corresponding type II receptor and type I receptor on the membrane, inducing type II receptor to phosphorylate type I receptor and activate its kinase activity. Then type I receptor recruits and activates downstream Smad protein, thereby inducing Smad protein to aggregate in the cell nucleus and play a transcriptional regulatory role as a transcription factor. Therefore, Smad protein is a signal transduction molecule downstream of TGF-β family receptors. Smad protein can bind to different transcription factors or auxiliary proteins in the cell nucleus to regulate the expression of different target genes.

[0006] In addition, in the ovarian transcriptome during the breeding period, the expression levels of vitellogenin and vitelline membrane outer layer protein genes increased significantly. Vitellogenin plays an important role in the development of crustacean ovaries. The development of crustacean ovaries is mainly due to the accumulation of nutrients in oocytes. This process mainly includes the pre-vitellogen formation period and the vitellogenin formation period. The vitellogenin formation period mainly includes the formation, accumulation, degradation and processing of vitellogenin. After the formation of vitellogenin, it is hydrolyzed to accumulate yolk protein in oocytes, which provides energy for embryonic development.

[0007] In recent years, the Japanese swamp shrimp has experienced resource degradation, such as early maternal development and miniaturization of individuals. The shrimps have spawned prematurely, leading to a series of problems such as multiple generations living together in the pond and excessive stocking density, which seriously restricts the sustainable and healthy development of the industry. In the early stage, a lot of research work has been conducted on the regulation of ovarian development in Japanese swamp shrimp from the tissue level, cellular level and molecular level, mainly focusing on various regulatory factors such as eyestalk neuropeptides, hormones and neurotransmitters, involving various complex biological processes such as germ cell cycle regulation and yolk generation. At present, there has been no gene identification and functional analysis of its insulin-like peptide regulation of ovarian development. Summary of the invention

[0008] The present invention provides a Japanese prawn insulin-like peptide gene MnILP2 and its application. The gene can be used to regulate the ovarian maturation during the ovarian development of female Japanese prawn. The gene can be used to promote the ovarian maturation during the ovarian development of female Japanese prawn.

[0009] In order to achieve the above technical purpose, the technical solution adopted in the present invention is as follows:

[0010] The nucleotide sequence of the Macrobrachium nipponense insulin-like peptide gene MnILP2 is shown in SEQ ID NO.1.

[0011] The application of the Japanese prawn insulin-like peptide gene MnILP2 in regulating the ovarian development of female Japanese prawn via the Tgf-β signaling pathway.

[0012] In another aspect, the present invention provides the use of the Macrobrachium nipponense insulin-like peptide gene MnILP2 in regulating ovarian maturation during ovarian development of female Macrobrachium nipponense.

[0013] According to the above application, the present invention also provides the application of the Japanese prawn insulin-like peptide gene MnILP2 in the preparation of an ovarian maturation preparation for regulating the ovarian development process of female Japanese prawn.

[0014] According to the above application, the present invention also provides the application of the Japanese prawn insulin-like peptide gene MnILP2 in the preparation of an ovarian maturation preparation for promoting the ovarian development process of female Japanese prawn.

[0015] The present invention also provides dsRNA obtained by transcription based on the complete sequence of MnILP2 gene as a template.

[0016] The above dsRNA, its upstream sequence is shown in SEQ ID NO.2, and its downstream sequence is shown in SEQ ID NO.3,

[0017] SEQ ID NO.2: 5'-GCAGUUGUAUAGCGUUAAAGA-3',

[0018] SEQ ID NO. 3: 5'-UUUAACGCUAUACAACUGCGA-3'.

[0019] The present invention also provides the use of the above dsRNA in inhibiting ovarian maturation during the ovarian development of female Macrobrachium nipponense.

[0020] The beneficial effects of the present invention are as follows: The present invention provides a Japanese prawn insulin-like peptide gene MnILP2 and its application. The gene can be used to regulate the ovarian maturation during the ovarian development of female Japanese prawn. The gene can be used to promote the ovarian maturation during the ovarian development of female Japanese prawn. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Figure 2 shows the enrichment analysis of the TGF-β signaling pathway of DEGs in the ovary of Macrobrachium nipponense at different developmental stages.

[0022] In the figure, red represents up-regulated gene expression during the mature stage, and green represents down-regulated gene expression;

[0023] Figure 2 is the expression diagram of Mnilp2 in different tissues;

[0024] Figure 3 This is a diagram showing the expression of the Mnilp2 gene in Macrobrachium nipponense at different developmental stages;

[0025] Figure 4 Figure 2 is the expression of different genes after RNAi;

[0026] Figure 5 This is the ovarian development inhibition chart after two weeks of dsRNA1 interference

[0027] In the figure, A is the control group and B is the interference group. DETAILED DESCRIPTION

[0028] Example 1 Transcriptome sequencing of Macrobrachium nipponense ovaries during growth and maturity

[0029] The ovarian development of Macrobrachium nipponense was detected. According to the size, color and tissue anatomy of the ovaries, the ovaries of the growth and mature stages were taken respectively, with 3 replicates in each group, and the transcriptome high-throughput sequencing was performed on 6 samples of the growth and mature stages. The sequencing results showed that the effective data volume of each sample was distributed in 5.98~7.07 G, the Q30 base was distributed in 93.95~94.72%, and the average GC content was 43.36%. By aligning the reads to the reference genome, the genome alignment of each sample was obtained, and the alignment rate was 87.38~92.54%. Based on the alignment results, the expression of protein-coding genes was analyzed. According to the expression of protein-coding genes in different samples, differential screening was performed, and a total of 5801 genes with significant differences in expression were detected, of which 3543 were significantly downregulated and 2258 were significantly upregulated.

[0030] like Figure 1 As shown in the figure, the enrichment analysis of differentially expressed genes in the KEGG pathway found that in the transforming growth factor-β (TGF-β) signaling pathway, compared with the Japanese swamp shrimp in the growth period, in the ovaries of the mature period, the expression level of activin gene was significantly downregulated, the expression level of BMP and activin membrane-bound inhibitor gene was significantly downregulated, and the expression level of smad2 / 3 gene was significantly upregulated. In the TGF-β signaling pathway, smad protein plays a key role in transmitting TGF-β signals. Smad2 / 3 belongs to the receptor-regulated Smad. After being activated, smad2 / 3 forms a complex with co-Smad (Smad4) and is transported to the cell nucleus to regulate the expression of target genes.

[0031] The present invention uses high-throughput sequencing to discover insulin-like peptide 2 ( MnILP2 ) gene. Compared with the growth period, the expression of MnILP2 gene in the mature ovary was significantly increased. At the same time, it was found that in the TGF-β signaling pathway, the expression of Smad2 and Smad3 genes was significantly increased ( Figure 1 ).

[0032] According to the transcriptome sequencing results, MnILP2 regulated the synthesis of vitellogenin via the TGF-β signaling pathway.

[0033] To verify MnILP2 Is it regulated through the TGF-β signaling pathway? Vitellogenin and Vitelline membrane outer layer protein First, the full-length sequence of the MnILP2 gene was obtained by 5' / 3' RACE technology. The results showed that the full-length sequence of the MnILP2 gene in Macrobrachium nipponense was 1342 bp, and the sequence information was as follows:

[0034]

[0035] The sequence was submitted to the Genbank database (accession number PP957848). Bioinformatics analysis results showed that the gene contained a 377 bp 5'UTR (untranslated region), ORF (open reading frame) encoding a total of 128 amino acids, 3'UTR totaling 309 bp, and the signal peptide sequence was: LCLRFMRFIGAFALVVLLVATVAET.

[0036] Example 2 Expression profiles of MnILP2 transcripts in different tissues

[0037] Design the amplification primers of MnILP2 gene (F:AGGCATCAAGATCTGCTCCG; R:GAAGGCCGTTTTCTTCGAGC), select β-actin As an internal reference gene, each tissue sample was normalized and calculated using the 2–⊿⊿CT method. Error bars represent mean ± standard deviation. Figure 2 As shown, MnILP2 There were significant differences in expression levels among all studied tissues, with the highest expression in the mature ovary, followed by the nervous system, and relatively low expression in the intestine, gills, muscle, and heart ( p <0.05).

[0038] Example 3 Expression profile of MnILP2 transcripts at different stages of ovarian development

[0039] According to the tissue-specific expression profile, the ovary was used to detect the expression of MnILP2 mRNA at different developmental stages of the ovary, e.g. Figure 3 As shown, a low expression level was detected in the micro-growth stage, the expression level began to increase from the macro-growth stage to the mature stage, reached the maximum value in the mature stage, and then decreased significantly in the recovery stage.

[0040] Example 4 In vivo RNA interference assay

[0041] 1. Synthesis and injection of dsRNA

[0042] Based on the complete sequence of the MnILP2 gene, dsRNA and a negative control were designed.

[0043] dsRNA1:

[0044] 5'-GCAGUUGUAUAGCGUUAAAGA-3', 5'-UUUAACGCUAUACAACUGCGA-3';

[0045] dsRNA2:

[0046] 5'-CGUUACUAUGUAUGUACUACG-3', 5'-UAGUACAUACAUAGUAACGAG-3';

[0047] dsRNA3:

[0048] 5'CGAGUUAUCAGAAGCCUAAAU-3', 5'-UUAGGCUUCUGAUAACUCGGU-3';

[0049] Scrambled –siRNA:

[0050] 5'-UCUCUUCACAGCCGAAGAA-3', 5'UUCUUCGGCUGUGAAGAGA-3'

[0051] Each dsRNA and negative control were dissolved in DEPC water to obtain a final concentration of 2 µmol / mL.

[0052] 2. Select mature Macrobrachium nipponense and randomly divide them into 4 groups, 30 in each group, 3 experimental groups (injected with dsRNA) and a negative control group. Then, 25μL of dsRNA and negative control were injected into the body through the base of the third step of Macrobrachium nipponense. 48 hours after injection, the ovaries of each group were sampled and tested.

[0053] After MnILP2 was interfered, the expression of MnILP2 was effectively reduced, among which dsRNA1 had a greater inhibitory effect, reaching 75% ( p <0.05). Therefore, we used the group injected with dsRNA1 as the experimental group and the group not injected with dsRNA1 as the control group to detect the expression of genes related to ovarian development.

[0054] After RNAi treatment, the expression levels of Smad2, Smad3, Vitellogenin (Vg), and Vitelline membrane outer layer protein (Vmolp) in the ovary were also significantly reduced ( Figure 4 ), two weeks after dsRNA1 interference, ovarian development was inhibited (control group 9.1±0.53mm, interference group 5.2±0.08mm) ( Figure 5 ), further indicating that MnILP regulates ovarian maturation via the TGF-β signaling pathway in the ovarian development of Macrobrachium nipponense.

Claims

1. Application of the Japanese prawn insulin-like peptide gene MnILP2 in regulating ovarian maturation during ovarian development of female Japanese prawn, the nucleotide sequence of the Japanese prawn insulin-like peptide gene MnILP2 is shown in SEQ ID NO.1, and the regulation is to inhibit ovarian maturation during ovarian development of female Japanese prawn by interfering with MnILP2 gene expression.

2. Use of dsRNA of the insulin-like peptide gene MnILP2 of Macrobrachium nipponense in the preparation of an ovarian maturation preparation that inhibits ovarian development in female Macrobrachium nipponense. The nucleotide sequence of the gene MnILP2 is shown in SEQ ID NO.1.

Images