Application of Lipocyclohexanephenol in the Treatment of Colorectal Cancer

Abstract

The present invention discloses the application of cycloprofol in the treatment of colorectal cancer. The present invention proves the therapeutic effect of cycloprofol on colorectal cancer through in vivo and in vitro experiments, and proves the inhibitory effect of cycloprofol on glycolysis and EMT of colorectal cancer cells, revealing the interaction between cycloprofol and the Wnt / β-catenin pathway. It provides a new direction for the treatment of colorectal cancer and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of cycloprofol in the treatment of cancer. Background Art

[0002] Colorectal cancer is one of the most common malignant tumors in the digestive system, and it is characterized by high incidence and high mortality. At present, colorectal cancer has become the third most common malignant tumor globally. The current main treatment methods for colorectal cancer are endoscopic resection, surgery, neoadjuvant chemotherapy, adjuvant chemotherapy, radiotherapy, and targeted therapy, etc. Although many new drugs have significant efficacy in the treatment of colorectal cancer, due to the recurrence and metastasis of advanced patients and the drug resistance of patients, the five-year survival rate of patients is still poor. Therefore, finding new drugs for the treatment of colorectal cancer is crucial in this field. Summary of the Invention

[0003] To make up for the deficiencies of the prior art, the present invention provides the application of cycloprofol in the treatment of colorectal cancer.

[0004] To achieve the above object, the present invention adopts the following technical solutions:

[0005] The first aspect of the present invention provides the application of cycloprofol or a pharmaceutically acceptable salt thereof in the preparation of a pharmaceutical composition for the treatment of colorectal cancer.

[0006] Furthermore, the treatment of colorectal cancer includes at least one of the following:

[0007] (1) Activating APC protein;

[0008] (2) Inhibiting the Wnt / β-catenin signaling pathway;

[0009] (3) Inhibiting the EMT process;

[0010] (4) Inhibiting the glycolysis process;

[0011] (5) Inhibiting the proliferation, migration, and / or invasion of colorectal cancer cells.

[0012] Furthermore, the marker of the Wnt / β-catenin signaling pathway described in (2) includes β-catenin.

[0013] Furthermore, the inhibition of the EMT process described in (3) includes upregulating epithelial markers and / or inhibiting mesenchymal markers.

[0014] Furthermore, the epithelial marker includes E-cadherin.

[0015] Further, the mesenchymal markers include one or more of MMP2, MMP9, and N-cadherin.

[0016] Further, the markers of the glycolysis process in (4) include one or more of lactic acid, glucose, ATP, HK2, and LDHA.

[0017] The second aspect of the present invention provides a pharmaceutical composition for treating colorectal cancer, and the pharmaceutical composition includes cycloprofol or a pharmaceutically acceptable salt thereof.

[0018] Further, the pharmaceutical composition further includes a pharmaceutically acceptable carrier.

[0019] Further, the pharmaceutically acceptable carrier includes one or more of a diluent, a binder, a surfactant, a humectant, an adsorption carrier, a lubricant, a filler, and a disintegrant.

[0020] Further, the pharmaceutical composition further includes other drugs for treating colorectal cancer.

[0021] Further, the other drugs for treating colorectal cancer include one or more of platinum drugs, targeted therapy drugs, antitumor antibiotics, antitumor drugs of plant origin, and antimetabolic drugs.

[0022] The third aspect of the present invention provides the use of cycloprofol or a pharmaceutically acceptable salt thereof in the preparation of a product for activating the APC protein / inhibiting the Wnt / β-catenin signaling pathway / inhibiting the EMT process / inhibiting the glycolysis process / inhibiting the proliferation, migration, or invasion of colorectal cancer cells.

[0023] Further, the marker of the Wnt / β-catenin signaling pathway includes β-catenin.

[0024] Further, the markers of the EMT process include epithelial markers and / or mesenchymal markers.

[0025] Further, the epithelial marker includes E-cadherin.

[0026] Further, the mesenchymal markers include one or more of MMP2, MMP9, and N-cadherin.

[0027] Further, the markers of the glycolysis process include one or more of lactic acid, glucose, ATP, HK2, and LDHA.

[0028] The fourth aspect of the present invention provides a method for regulating any one of the following substances, the method including administering cycloprofol or a pharmaceutically acceptable salt thereof, and the substances include:

[0029] (1) APC protein;

[0030] (2) Wnt / β - catenin signaling pathway marker;

[0031] (3) EMT process marker;

[0032] (4) Glycolysis process marker;

[0033] Furthermore, the Wnt / β - catenin signaling pathway marker includes β - catenin.

[0034] Furthermore, the EMT process marker includes epithelial marker and / or mesenchymal marker.

[0035] Furthermore, the epithelial marker includes E - cadherin.

[0036] Furthermore, the mesenchymal marker includes one or more of MMP2, MMP9, and N - cadherin.

[0037] Furthermore, the glycolysis process marker includes one or more of lactic acid, glucose, ATP, HK2, and LDHA.

[0038] Furthermore, the method is a method for non - therapeutic purposes.

[0039] Advantages and beneficial effects of the present invention:

[0040] The present invention proves the therapeutic effect of propofol cyclic on colorectal cancer through in - vivo and in - vitro experiments, and proves the inhibitory effect of propofol cyclic on glycolysis and EMT of colorectal cancer cells, revealing the interaction between propofol cyclic and the Wnt / β - catenin pathway. It provides a new direction for the treatment of colorectal cancer and has broad application prospects. Brief Description of the Drawings

[0041] Figure 1 It is the inhibition diagram of propofol cyclic on the migration and invasion of HT29 cells. Among them, 1A is the molecular structure and relative molecular mass diagram of propofol cyclic, 1B is the influence diagram of propofol cyclic on the proliferation of HT29 cells, 1C is the influence diagram of propofol cyclic on the migration of HT29 cells measured by the scratch method, 1D is the influence diagram of propofol cyclic on the invasion of HT29 cells measured by the Transwell method, and 1E is the expression level diagram of E - cadherin;

[0042] Figure 2 It is the inhibition diagram of propofol cyclic on the glycolysis of HT29 cells. Among them, 2A is the diagram of HK2 mRNA level, LDHA mRNA level, ATP level, glucose production amount, and lactic acid production amount, and 2B is the relative protein expression level diagram of HK2 and LDHA;

[0043] Figure 3 It is a diagram showing the effects of lipopropofol on inhibiting APC protein on glycolysis and invasion of HCT116 cells. Among them, 3A is a diagram of the relative protein level of APC in normal and colorectal cancer cells, 3B is a diagram of the relative expression level of APC protein in HCT116 cells, 3C is a diagram of the expression level of APC mRNA in HCT116 cells, 3D is a diagram of the change in cell invasion ability, and 3E is a diagram of the measurement of ECAR (extracellular acidification rate) and OCR (oxygen consumption rate) in colorectal cancer cells;

[0044] Figure 4 It is a diagram showing the effects of lipopropofol on inhibiting APC protein on glycolysis and EMT process of HCT116 cells. Among them, 4A is a diagram of the expression levels of HK2 mRNA and LDHA mRNA, 4B is a diagram of ATP level, glucose production, and lactate production, 4C is a diagram of the protein expression levels of E-cadherin, N-cadherin, MMP9, and MMP2, and 4D is a diagram of the protein expression levels of HK2 and LDHA;

[0045] Figure 5 It is a diagram showing that derivative 83 counteracts the inhibitory effect of lipopropofol on the Wnt / β-catenin signal in HT29 cells. Among them, 5A is a diagram of the change in cell invasion ability, 5B is a diagram of the protein expression levels of p-GSK3β, GSK3β, β-catenin, and β-actin, and 5C is a diagram of the levels of HK2 mRNA, LDHA mRNA, ATP level, glucose production, and lactate production;

[0046] Figure 6 It is a diagram of the experiment on the inhibitory effect of lipopropofol on the growth of mouse xenografts. Among them, 6A is a diagram of the establishment process of the mouse HT29 xenograft model, 6B is a top view of the xenograft mouse and a diagram of the tumor tissue, 6C is a diagram of the volume and weight of the xenograft, 6D is a line graph of the tumor volume of the xenograft mouse, 6E is a diagram of the protein expression levels of E-cadherin, N-cadherin, MMP9, MMP2, HK2, and LDHA in the xenograft tissue, and 6F is a diagram of the protein expression levels of GSK3β, p-GSK3β, and β-catenin in the xenograft tissue. Detailed implementation mode

[0047] The following provides the definitions of some terms used in this specification. Unless otherwise specified, all technical and scientific terms used herein generally have the same meaning as commonly understood by those of ordinary skill in the art to which this invention belongs.

[0048] The present invention provides a pharmaceutical composition for treating colorectal cancer, and the pharmaceutical composition includes lipopropofol or a pharmaceutically acceptable salt thereof.

[0049] In one embodiment of the present invention, a pharmaceutically acceptable salt refers to a salt of the compound cyclopropanol, which is pharmaceutically acceptable and has (or can be converted into a form that has) the desired pharmacological activity of the parent compound. Pharmaceutically acceptable salts are generally considered to be safe and suitable for use without excessive toxicity, irritation, allergic reactions, etc., and have a reasonable benefit / risk ratio. These salts can be acid addition salts involving inorganic or organic acids, or in the case of the compounds of the present invention in acidic form, the salts can be prepared from inorganic or organic bases. Generally, the compounds are prepared as or used in the preparation of pharmaceutically acceptable salts which are addition products of pharmaceutically acceptable acids or bases. Suitable pharmaceutically acceptable acids and bases are well known in the art, such as hydrochloric acid, sulfuric acid, hydrobromic acid, acetic acid, lactic acid, citric acid or tartaric acid for forming acid addition salts, and potassium hydroxide, sodium hydroxide, ammonium hydroxide, caffeine, various amines, etc. for forming basic salts. Methods for preparing appropriate salts are well established in the art.

[0050] Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2 - optionally substituted hydroxy - ethanesulfonate, lactobionate, lactate, laurate, laurylsulfate, malate, maleate, malonate, methanesulfonate, 2 - naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 - phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate, etc. Representative alkali metal or alkaline earth metal salts include sodium salt, lithium salt, potassium salt, calcium salt, magnesium salt, etc., and non - toxic ammonium, quaternary ammonium and amine cations, including (but not limited to) ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, etc.

[0051] The pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0052] In one embodiment of the present invention, the pharmaceutically acceptable carrier may comprise inert ingredients which do not unduly inhibit the biological activity of the compound. The pharmaceutically acceptable carrier should be biocompatible, for example, non - toxic, non - inflammatory, non - immunogenic or without other undesirable reactions or side effects when administered to a subject. Standard pharmaceutical formulation techniques can be used.

[0053] Pharmaceutically acceptable carriers are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995), including but not limited to diluents, binders, surfactants, humectants, adsorbent carriers, lubricants, fillers, and disintegrants. These substances are used as needed to assist in the stability of the formulation or to enhance the activity or its bioavailability or to produce an acceptable taste or odor in the case of oral administration. The formulations that can be used in such pharmaceutical compositions can be in the form of the original compound itself or optionally in the form of its pharmaceutically acceptable salts. The pharmaceutical compositions so formulated can be administered in any suitable manner known to those skilled in the art as needed.

[0054] Among them, diluents include but not limited to lactose, sodium chloride, glucose, urea, starch, and water.

[0055] Binders include but not limited to starch, pregelatinized starch, dextrin, maltodextrin, sucrose, gum arabic, gelatin, methylcellulose, carboxymethylcellulose, ethylcellulose, polyvinyl alcohol, polyethylene glycol, polyvinylpyrrolidone, alginic acid and its salts, xanthan gum, hydroxypropylcellulose, and hydroxypropylmethylcellulose.

[0056] Surfactants include but not limited to polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, monoglyceride stearate, and cetyl alcohol.

[0057] Humectants include but not limited to glycerol and starch.

[0058] Adsorbent carriers include but not limited to starch, lactose, bentonite, silica gel, kaolin, and saponite.

[0059] Lubricants include but not limited to zinc stearate, monoglyceride stearate, polyethylene glycol, talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, hydrogenated vegetable oil, sodium stearyl fumarate, polyoxyethylene monostearate, sucrose monolaurate, sodium lauryl sulfate, magnesium lauryl sulfate, and sodium dodecyl sulfate.

[0060] Fillers include but not limited to mannitol (granular or powdered), xylitol, sorbitol, maltose, erythritol, microcrystalline cellulose, polydextrose, coupled sugar, glucose, lactose, sucrose, dextrin, starch, sodium alginate, laminarin powder, agar powder, calcium carbonate, and sodium bicarbonate.

[0061] Disintegrants include but not limited to cross-linked vinylpyrrolidone, sodium carboxymethyl starch, low-substituted hydroxypropylmethyl cellulose, cross-linked sodium carboxymethyl cellulose, and soy polysaccharide.

[0062] In one embodiment of the present invention, the pharmaceutical composition can be in a dosage form suitable for parenteral administration, a dosage form suitable for oral administration (such as solid dosage forms, liquid dosage forms, emulsions, suspensions), an ointment, cream or lotion form suitable for topical administration, a delivery dosage form suitable for use as an eye drop, an aerosol form suitable for administration by inhalation (such as by intranasal inhalation or oral inhalation), and a dosage form suitable for parenteral administration, namely subcutaneous, intramuscular or intravenous injection.

[0063] Solid dosage forms for oral administration may contain binders, sweeteners, disintegrants, diluents, flavoring agents, coating agents, preservatives, lubricants and / or timedelay agents acceptable in human and veterinary medical practice. Suitable binders include gum arabic, gelatin, corn starch, gum tragacanth, sodium alginate, carboxymethyl cellulose or polyethylene glycol. Suitable sweeteners include sucrose, lactose, glucose, aspartame or saccharin. Suitable disintegrants include corn starch, methyl cellulose, polyvinylpyrrolidone, guar gum, xanthan gum, bentonite, alginic acid or agar. Suitable diluents include lactose, sorbitol, mannitol, dextrose, kaolin, cellulose, calcium carbonate, calcium silicate or dicalcium phosphate. Suitable flavoring agents include peppermint oil, wintergreen oil, cherry, citrus or raspberry flavoring agents. Suitable coating agents include polymers or copolymers of acrylic acid and / or methacrylic acid and / or their esters, waxes, fatty alcohols, zein, shellac or gluten. Suitable preservatives include sodium benzoate, vitamin E, α-tocopherol, ascorbic acid, methyl paraben, propyl paraben or sodium bisulfite. Suitable lubricants include magnesium stearate, stearic acid, sodium oleate, sodium chloride or talc. Suitable timedelay agents include glyceryl monostearate or glyceryl distearate.

[0064] In addition to the above-mentioned drugs, liquid dosage forms for oral administration may further contain a liquid carrier. Suitable liquid carriers include water, oils such as olive oil, peanut oil, sesame oil, sunflower oil, safflower oil, peanut oil, coconut oil, liquid paraffin, ethylene glycol, propylene glycol, polyethylene glycol, ethanol, propanol, isopropanol, glycerol, fatty alcohols, triglycerides or mixtures thereof.

[0065] Suspensions for oral administration may further include dispersing agents and / or suspending agents. Suitable suspending agents include sodium carboxymethyl cellulose, methyl cellulose, hydroxypropyl methyl cellulose, polyvinylpyrrolidone, sodium alginate or acetyl ethanol. Suitable dispersing agents include lecithin, polyoxyethylene esters of fatty acids such as stearic acid, polyoxyethylene sorbitan mono- or di-oleate, -stearate or -laurate, polyoxyethylene dehydrated sorbitol mono- or di-oleate, -stearate or -laurate and the like.

[0066] The pharmaceutical composition further includes other drugs for treating colorectal cancer.

[0067] The other drugs for treating colorectal cancer include platinum drugs, targeted therapy drugs, antitumor antibiotics, antitumor drugs derived from plants, and antimetabolic drugs.

[0068] Among them, the antimetabolic drugs include, but are not limited to, 5-fluorouracil, also known as 5-FU, which is an antimetabolic drug that can act on DNA synthesis by inhibiting nucleotide synthase, thereby causing tumor cell death. The commonly used oral preparation capecitabine is often used clinically.

[0069] Platinum drugs include, but are not limited to, oxaliplatin, which easily covalently binds to G on the DNA strand to form interstrand associations, thereby blocking DNA replication.

[0070] Antitumor drugs include, but are not limited to, mitomycin, which is an antibacterial antitumor drug that exerts cytotoxic effects in vivo through the reduced bifunctional alkylating agent and can inhibit DNA synthesis.

[0071] Targeted therapy drugs include, but are not limited to, bevacizumab, which is classified as a targeted therapy drug that can inhibit microvascular angiogenesis, limit the blood supply of tumor cells, and thereby promote tumor cell death.

[0072] In one embodiment of the present invention, the pharmaceutical composition further includes adjuvant drugs, and the adjuvant drugs include, but are not limited to: hematopoietic stimulants (including, but not limited to, G-CSF, GM-CSF, interleukin-11, EPO), antiemetic drugs (including, but not limited to, ondansetron, granisetron hydrochloride), analgesics (including, but not limited to, aspirin, paracetamol, codeine, tramadol, morphine, fentanyl).

[0073] It is obvious to those skilled in the art that the pharmaceutical composition of the present invention will vary according to the desired effect. Therefore, the optimal content of the pharmaceutical composition of the present invention can be easily determined by those skilled in the art and can be adjusted according to various factors including: the type and severity of the disease, the content of other components contained in the pharmaceutical composition, the type of formulation, the age, weight, general health status, gender and diet of the patient, the administration time, the administration route, the secretion rate of the drug, the duration of treatment, and the drugs used simultaneously. The amount of the pharmaceutical composition should be determined considering the above factors and can be administered once a day or in several divided doses. However, it should be understood that the actual dose of the active ingredient should be determined considering various relevant factors, including the disease being treated, the severity of the disease, the administration route, and the weight, age, and gender of the patient. Therefore, the dose does not limit the scope of the present invention in any way.

[0074] In one embodiment of the present invention, treatment refers to a clinical intervention that attempts to alter the natural course of the individual being treated and can be carried out for prevention or during the clinical pathological process. Desirable treatment effects include, but are not limited to, preventing the occurrence or recurrence of a disease, alleviating symptoms, attenuating any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, improving or alleviating the disease state, and ameliorating or improving the prognosis.

[0075] In one embodiment of the present invention, administration refers to a method of delivering a dose / effective amount of a drug or compound or pharmaceutical composition to a subject (such as a patient). Administration can be by any suitable means, including parenteral, intranasal, and intrapulmonary, and, if desired for local treatment, intra-lesional administration. Parenteral infusion includes, for example, intramuscular, intravenous, intra-arterial, intraperitoneal, or subcutaneous administration. Depending in part on whether the administration is short-term or long-term, the drug can be administered by any suitable route, such as by injection, such as intravenous or subcutaneous injection. A variety of dosing schedules are contemplated in the present application, including but not limited to single administration or multiple administrations at multiple time points, bolus administration, and pulsed infusion.

[0076] The subject refers to any animal, including both human and non-human animals. Non-human animals include all vertebrates, such as mammals, such as non-human primates (especially higher primates), sheep, dogs, rodents (such as mice or rats), guinea pigs, goats, pigs, cats, rabbits, cattle, and any domestic or pet animal; and non-mammals, such as chickens, amphibians, reptiles, etc.

[0077] In one embodiment of the present invention, an effective amount refers to the amount of a pharmaceutical composition that is effective in treating a disease or disorder in a mammal, either alone or in combination with other drugs or treatment regimens. In the case of cancer, a therapeutically effective amount of a drug can reduce the number of cancer cells; reduce the size of a tumor; inhibit (i.e., slow down to a certain extent and preferably prevent) the infiltration of cancer cells into surrounding organs; inhibit (i.e., slow down to a certain extent and preferably prevent) tumor metastasis; inhibit tumor growth to a certain extent; and / or alleviate one or more symptoms associated with the disorder to a certain extent. To the extent that the pharmaceutical composition can prevent the growth of existing cancer cells and / or kill existing cancer cells, it can be cytostatic and / or cytotoxic. For cancer therapy, in vivo efficacy can be measured, for example, by evaluating survival duration, progression-free survival (PFS) duration, response rate (RR), response duration, and / or quality of life.

[0078] The present invention provides a method for regulating any one of the following substances, the method comprising administering cycloprofol or a pharmaceutically acceptable salt thereof, the substances comprising:

[0079] (1) APC protein;

[0080] (2) Wnt / β-catenin signaling pathway markers;

[0081] (3) EMT process markers;

[0082] (4) Glycolysis process markers.

[0083] In one embodiment of the present invention, APC (adenomatous polyposis coli gene) is one of the most common tumor suppressor genes in colorectal cancer. Administering propofol cyclis or a pharmaceutically acceptable salt thereof can activate the APC protein.

[0084] The Wnt / β-catenin signaling pathway markers include β-catenin. Administering propofol cyclis or a pharmaceutically acceptable salt thereof can inhibit the β-catenin protein.

[0085] The related proteins of the EMT (Epithelial-Mesenchymal Transition) process include the epithelial marker E-cadherin, and the mesenchymal markers MMP2, MMP9, and N-cadherin. The occurrence of EMT is often accompanied by a significant down-regulation of the epithelial marker gene expression and a significant up-regulation of the mesenchymal marker gene. Administering propofol cyclis or a pharmaceutically acceptable salt thereof can significantly promote the up-regulation of the epithelial marker E-cadherin and significantly inhibit the expression of the mesenchymal markers MMP2, MMP9, and N-cadherin.

[0086] The related indicators of the glycolysis process include one or more of lactic acid, glucose, ATP, HK2, and LDHA. Administering propofol cyclis or a pharmaceutically acceptable salt thereof can inhibit the production of lactic acid and glucose, reduce the ATP level, and reduce the levels of HK2 and LDHA.

[0087] The method is a non-therapeutic method. For this purpose, examples can include applying this method in laboratory research, without involving the purpose of treatment.

[0088] The present invention will be further described below with specific examples. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the present invention. Without departing from the scope of the present invention, the main features of the present invention can be used in various embodiments.

[0089] Examples

[0090] 1. Materials and Methods

[0091] Cell culture

[0092] Human normal colon epithelial cells CD841 and human colorectal cancer cells HT29, HCT116, LoVo, and LS174T were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences. The cells were cultured in high-glucose DMEM medium (Gibco, 11995) containing 10% fetal bovine serum (ExCell Bio, YSN0121) and 1% penicillin-streptomycin solution (Solarbio, P1400) in a 5% CO2 incubator (Jiemei Electronics, CI-191C) at 37°C. The growth medium was renewed every two weeks, and the cells were used for subsequent assays after entering the exponential growth phase.

[0093] CCK8 assay

[0094] When the density of HT29 cells reached 70 - 80%, the previous medium was aspirated, and the cells were washed 3 times with PBS. Subsequently, trypsin (Solarbio, P6730) was applied to digest the cells for 2 - 3 minutes. Complete DMEM medium was added to terminate the digestion, and the cells were centrifuged at 1200 rpm for 3 minutes. After suspending the cells in an appropriate amount of medium, 3000 cells / well were seeded into 96-well plates and incubated overnight. The experimental groups used DMEM solutions containing different concentrations of propofol cyclodimer (3.125, 6.25, 12.5, 25, 50, 100 μmol / L), and the control group contained an equal volume of DMSO solution. After 48 hours, 10 μL of CCK8 solution (Solarbio, CA1210) was added to each well, and the absorbance was measured at 450 nm using a microplate reader (Flash, ReadMax 1200) after incubating for 3 hours.

[0095] Wound healing assay

[0096] Cells were seeded into six-well plates at a cell density of 5×10 5 cells per well and incubated overnight. Using a 10 μL pipette tip, 3 parallel vertical lines were carefully created at the bottom of the plate. Then the previous medium was aspirated, and the cells were rinsed three times with PBS. Subsequently, high-glucose DMEM medium supplemented with gradient concentrations of propofol cyclodimer (10, 20, 40 μmol / L) was introduced into the wells. After 12 hours, images were captured at the intersection of the parallel and vertical lines using a microscope (Shunyu, ICX41). The cell migration rate was analyzed using Image J software.

[0097] Transwell assay

[0098] Dilute Matrigel matrix (BD, 354234) with serum-free DMEM at a ratio of 1:8, and then coat it on the upper chamber of the Transwell insert and incubate at 4 °C for 4 hours. Introduce serum-free DMEM containing HT29 cells into a six-well plate. Before inoculation, the cells are pretreated with different concentrations of cyclopofol (10, 20, 40 μmol / L) for 24 hours. After incubation for 12 hours, the cells that invaded the lower chamber are fixed, stained and photographed under a microscope. The number of invasive cells is quantified using Image J.

[0099] Measurement of glucose, lactate and ATP levels

[0100] HT29 cells are treated with different concentrations of cyclopofol for 24 hours. The cells are collected and homogenized, and the glucose, lactate and ATP levels are measured using their respective assay kits. Absorbance is measured using a UV-visible spectrophotometer at specific wavelengths.

[0101] Measurement of extracellular acidification rate (ECAR) and oxygen consumption rate (OCR)

[0102] Digest HT29 cells in the exponential phase and seed 5×10 3 cells into a 96-well plate. After transfecting the cells with Si-APC transfection reagent for 24 hours, treat them with cyclopofol for 24 hours. According to the experimental protocol, measure the extracellular acidification rate and oxygen consumption rate using a glycolysis stress test kit (Agilent, 103346-100) and a mitochondrial stress test kit (Agilent, 103015-100). The measurement is performed using a Seahorse XF Pro analyzer from Agilent Technologies, USA.

[0103] qPCR experiment

[0104] HT29 cells in the logarithmic growth phase were treated with cycloprofol for 24 hours. The cells were collected with a sterile cell scraper, transferred to a 1.5 mL centrifuge tube, and then mixed with 1 mL of Trizol (Solarbio, 15596026). The mixture was homogenized using a pipette and then incubated at 15 - 30 °C for 5 minutes. Subsequently, 0.2 mL of chloroform was introduced. After stirring and incubating for 2 - 3 minutes, the solution was centrifuged at 12000 rpm for 30 minutes at 4 °C. The resulting aqueous phase was mixed with isopropanol and then incubated at room temperature for 10 minutes. Subsequently, it was centrifuged at 12000 rpm for 10 minutes at 4 °C. The resulting precipitate was washed with 1 mL of 75% ethanol and then centrifuged at 7500 rpm for 5 minutes at 4 °C. Finally, the precipitate was air-dried in a sterile environment for 5 - 10 minutes. The RNA precipitate was dissolved in 50 μL of DEPC water (Aladdin, W293452) and used immediately or stored at -80 °C. The RNA concentration was measured using a UV-visible spectrophotometer Q5000. Reverse transcription was performed using a reverse transcription kit (TIANGEN, KR118), and the resulting cDNA could be used immediately or stored at -80 °C. The cDNA concentration was measured, and qPCR was performed using a real-time fluorescence quantifier (Bio-RAD, CFX Connect) in combination with a qPCR detection kit (TIANGEN, FP313). The original data was retained for subsequent analysis. The APC si-RNA sequences are as follows:

[0105] NC-APC GACAAGAGCTTTAAGATAATT;

[0106] Si-APC-1 GACAAGAGCTAGAAGATAATT;

[0107] Si-APC-2 GCTACAGTGTAATAATTTACA;

[0108] Si-APC-3 GCCTATTGATTATAGTTTAAA.

[0109] The interfering RNA was synthesized by RiboBio.

[0110] Protein immunoblotting experiment

[0111] The lysis buffer was pre-melted at room temperature and 10 μL / mL PMSF (Solarbio, P0100) and protein phosphatase inhibitors (Solarbio, P1260) were added. The lysis buffer was added to HT29 cells and tumor tissue samples in appropriate volumes, and then lysed on ice for 25 minutes. After centrifugation at 12,000 rpm for 10 minutes at 4 °C, the liquid part (supernatant) above the pellet was carefully collected to obtain protein extracts. Protein quantification was performed using a BCA protein quantification kit (Solarbio, PC0020). The protein samples were heated in a 95 °C water bath for 10 minutes, cooled, and then stored at -80 °C. Gel electrophoresis was carried out at gradually increasing voltages (80 V for 35 minutes, then 120 V for 60 minutes). The proteins were transferred to PVDF membranes, and subsequently, these membranes were treated with a 5% skim milk solution for 2 hours to prevent non-specific binding. Subsequently, the membranes were incubated with the primary antibody overnight at 4 °C. Thereafter, the membranes were subjected to a series of washes and then exposed to the secondary antibody. After another round of washing, images were captured using a gel imaging system. Subsequent data analysis was performed using Image J software. The antibodies used included HK2 (Affinity, DF6176), LDHA (Huabio, ET1608-57), β-actin (Huabio, ET1701-80), APC (Huabio, ET1610-80), E-cadherin (ABclonal, A20798), N-cadherin (ABclonal, A19083), MMP9 (Huabio, ET1704-69), MMP2 (Huabio, ET1606-4), p-GSK3β (Affinity, AF2016), GSK3β (Affinity, AF5016), β-catenin (Wnt / β-catenin, Cell Signaling, 8480S), goat anti-rabbit IgG (Affinity, S0001), and goat anti-mouse IgG (Affinity, S0002).

[0112] In vivo experiments

[0113] Male BALB / c mice aged 4-6 weeks and weighing 17-20 g were purchased and housed in the Animal Experiment Center of the Fourth Hospital of Hebei Medical University. After 7 days of adaptation, HT29 colorectal cancer cells were subcutaneously injected. On the 7th day after tumor inoculation, the treatment group was intraperitoneally injected with propofol cyclic solution (1 mL, 5 mg / kg) daily, and the control group was intraperitoneally injected with an equal volume of normal saline. After 14 days of treatment, the mice were sacrificed, and the subcutaneous tumor tissues were collected, weighed, photographed, and stored in liquid nitrogen. The tumor volume was calculated using the formula: V = (L × W 2 ) / 2.

[0114] Statistical analysis

[0115] Statistical analysis was performed using SPSS software. Measurement data were expressed as mean ± standard deviation (SD). One-way or two-way analysis of variance (ANOVA) was used to verify the differences between groups, and t-tests were used to analyze the differences between two groups. Experimental data were performed three or more times, and a threshold of P < 0.05 was used to evaluate statistical significance.

[0116] 2. Results

[0117] Propofol inhibits EMT and glycolysis in colorectal cancer cells

[0118] Propofol had a significant inhibitory effect on colorectal cancer cells, showing a concentration-dependent response. The IC50 of propofol was calculated to be 37.62 μmol / L using GraphPad Prism 9.0. In addition, propofol could effectively inhibit the invasion and migration of colorectal cancer cells, and an enhanced inhibitory effect was observed at higher concentrations. Subsequently, western blot analysis of EMT-related marker proteins MMP2, MMP9, N-cadherin, and E-cadherin showed that after propofol treatment, the protein expression levels of MMP2, MMP9, and N-cadherin decreased, while E-cadherin expression was upregulated. This further confirmed the potential effect of propofol on the EMT process in colorectal cancer cells ( Figure 1 ).

[0119] After determining the ability of propofol to inhibit the proliferation, invasion, and migration of colorectal cancer cells, the subsequent focus turned to exploring its potential ability to impede glycolysis. The results showed that propofol could effectively inhibit the ATP level, lactate production, and glucose production in colorectal cancer cells. The downregulation of HK2, LDHA mRNA, and protein expression levels further confirmed this inhibitory effect, indicating that propofol has the ability to inhibit glycolytic metabolism in colorectal cancer cells ( Figure 2 ).

[0120] Propofol inhibits the EMT process and glycolysis in colorectal cancer cells by activating the APC protein

[0121] Western blot analysis confirmed that with the increase in the concentration of propofol cyclis, the expression of APC protein gradually increased, indicating that propofol cyclis has the ability to enhance APC expression. To clarify whether propofol cyclis inhibits glycolysis and EMT processes in colorectal cancer cells by activating APC, HCT116 cells were mainly studied, which had the highest APC expression level among the four colorectal cancer cell lines. The experimental group was divided into four groups (Control, Ciprofol, NC, and Ciprofol + Si-APC), and the latter involved the construction of an HCT116 cell line with APC deficiency in vivo. QPCR results showed that all three Si-APC sequences significantly downregulated APC mRNA expression, and the Si-APC 1 sequence showed the most obvious decrease. Therefore, Si-APC 1 was selected as the subsequent interference sequence. The study showed that APC downregulation counteracted the inhibitory effect of propofol cyclis on the invasion and migration of HCT116 cells, while propofol cyclis retained its ability to inhibit glycolysis-related indicators in HCT116 cells. Notably, APC downregulation restored the ATP level, lactate accumulation, and glucose production in HCT116 cells. Propofol cyclis may inhibit the EMT process and glycolysis in HCT116 cells by activating APC protein expression ( Figure 3 , Figure 4 ).

[0122] Propofol cyclis inhibits EMT and glycolysis in HT29 cells by inhibiting the Wnt / β-Catenin signaling pathway

[0123] Western blot analysis showed that compared with the control group, propofol cyclis treatment decreased β-catenin protein expression and increased p-GSK-3β protein expression. The expression of GSK-3β protein remained unchanged. Adding a Wnt / β-catenin signaling pathway activator (Derivative83) could counteract the effect of propofol cyclis. Transwell experiments and the evaluation of glycolysis-related indicators confirmed that the introduction of the Wnt / β-catenin signaling pathway activator alleviated the inhibitory effect of propofol cyclis on the invasion and glycolysis of HT29 cells. These results emphasized that the pharmacological effect of propofol cyclis on HT29 cells may be achieved by inhibiting the Wnt / β-catenin signaling pathway ( Figure 5 ).

[0124] Propofol cyclis inhibits the growth of tumor tissues in tumor-bearing mice

[0125] To investigate the effect of propofol cyclis on HT29 cells in vivo, HT29 cells were subcutaneously injected into mice to establish a xenograft model. Compared with the control group, the tumor volume and weight in the propofol cyclis treatment group were significantly reduced, effectively inhibiting the growth of tumor tissues. Subsequently, Western blot analysis of invasion- and glycolysis-related proteins was consistent with the in vitro research results, providing evidence for the ability of propofol cyclis to inhibit the invasion and glycolytic metabolism of HT29 cells in vivo( Figure 6 ).

[0126] The description of the above embodiments is only for understanding the method of the present invention and its core idea. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. Use of cycloprofene or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating colorectal cancer.

2. The application according to claim 1, wherein The treatment of colorectal cancer includes at least one of the following: (1) Activating APC protein; (2) Inhibiting the Wnt / β-catenin signaling pathway; (3) Inhibiting the EMT process; (4) Inhibiting the glycolysis process; (5) Inhibiting the proliferation, migration and / or invasion of colorectal cancer cells.

3. The application according to claim 2, wherein The marker of the Wnt / β-catenin signaling pathway described in (2) includes β-catenin.

4. The application according to claim 2, characterized in that, The inhibition of the EMT process described in (3) includes upregulating epithelial markers and / or inhibiting mesenchymal markers; The epithelial marker includes E-cadherin; The mesenchymal markers include one or more of MMP2, MMP9, and N-cadherin.

5. The application according to claim 2, characterized in that, The markers of the glycolysis process described in (4) include one or more of lactate, glucose, ATP, HK2, and LDHA.

6. The application according to claim 1, wherein The drug further includes a pharmaceutically acceptable carrier.

7. The application according to claim 6, characterized in that The pharmaceutically acceptable carrier includes one or more of a diluent, a binder, a surfactant, a humectant, an adsorption carrier, a lubricant, and a disintegrant.

Images