Use of miR-125a-5p / let-7e-5p antagonist in treating non-alcoholic fatty liver disease

Abstract

The application discloses application of an miR-125a-5p / let-7e-5p antagonist in treatment of non-alcoholic fatty liver disease. Experiments prove that miR-125a-5p and let-7e-5p jointly target a PRKAA2 gene to promote non-alcoholic fatty liver disease progression through an AMPK pathway, and the miR-125a-5p / let-7e-5p antagonist can slow down the non-alcoholic fatty liver disease progression, and has a good application prospect in treatment of non-alcoholic fatty liver disease.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of medicine, and relates to a miRNA antagonist wrapped by a lipid nanoparticle, in particular to application of miRNA antagonists antago-miR-125a-5p and antago-let-7e-5p in preparation of a medicine for treating nonalcoholic fatty liver disease. BACKGROUND

[0002] Nonalcoholic fatty liver disease (NAFLD) is a metabolic disease related to obesity caused by metabolic disorders, and characterized by lipid accumulation in hepatocytes. Recently, most scholars suggest that NAFLD be referred to as "metabolic dysfunction associated fatty liver disease" (MAFLD). The pathological development of NAFLD has stages, that is, from fatty liver to nonalcoholic steatohepatitis (NASH), liver fibrosis, and liver cirrhosis, and even liver cancer. Due to the improvement of human economic level and the change of lifestyle, the prevalence rate of NAFLD in the population shows a trend of increasing year by year, and it has become the first type of liver disease, epidemiological surveys show that about 25% of the world's population is suffering from NAFLD, and NASH is considered to be the main cause of liver cancer. Although great progress has been made in the research of the development and pathogenesis of NAFLD, due to the complexity of the causes of NAFLD, the unclear characteristics of the disease, and the lack of effective treatment evaluation methods, at present, only the oral small molecule drug Rezdiffra has been approved by FDA for treating NASH, but the effective rate is less than 30%.

[0003] It is known that the key molecules in the progression of NAFLD and the dysregulation of related gene expression are related to epigenetic modifications. DNA methylation, histone acetylation and non-coding RNA-dependent regulation are the main ways of epigenetic modification. Among them, microRNAs (miRNA) are small RNAs with a length of about 20-24 nucleotides, which bind to specific target sequences in the 3'UTR, leading to the degradation or translation arrest of the gene, negatively regulating the expression of target genes, and playing an important role in metabolic-related NAFLD. The difference of target genes and the complex action between miRNA have a great influence on the actual role of miRNA (see: microRNA in liver fibrosis and hepatocellular carcinoma. Central China University of Science and Technology, 2013; miRNAs mitochondrial-cytoplasmic redistribution in the pathogenesis of non-alcoholic fatty liver. Shandong University, 2022; Chinese patents CN109477144A, CN107075515A).

[0004] Currently, the main treatment mode for NAFLD is weight loss, dietary adjustment, lifestyle change and drug intervention. Compared with traditional drugs, small molecule compounds and antibodies are the preferred choice for drug development and clinical trials. However, antibodies have the problem of non-druggable or difficult-to-drug due to the complexity of protein structure, so drugs targeting RNA or DNA small nucleic acids have great potential. Taking miRNA as an example, three strategies of miRNA mimic, miRNA inhibitor and miRNA antagomir can be used. Drug intervention mainly includes single drug treatment and combination therapy; compared with single drug treatment, combination therapy is less studied. In addition, the delivery of miRNA drugs is not limited to the initial use of injecting naked miRNA or injecting virus-coated miRNA, etc. (due to degradation when delivered to blood, ultimately reducing the efficiency of miRNA reaching the target site), for example, recent studies have found that lipid nanoparticles (LNP) have modifiability, non-immunogenicity and high targeting, and the drugs wrapped by them are not easily exposed and degraded in the blood, and can cross the blood-brain barrier to achieve intracranial delivery, so LNP has become the main way to deliver miRNA drugs.

[0005] At present, the miRNA molecules regulating the progression of NAFLD have not been completely revealed, and some potential signaling pathways need to be further studied (see: ApoM gene in the formation of non-alcoholic fatty liver disease. Wannan Medical College, 2018. etc.). Therefore, it is still a complex and arduous task to develop miRNA drugs that can effectively treat non-alcoholic fatty liver disease. SUMMARY

[0006] The application provides an application of an miR-125a-5p / let-7e-5p antagonist in treating non-alcoholic fatty liver disease.

[0007] To achieve the above-mentioned purpose, the application adopts the following technical scheme:

[0008] In the application, the following experiments are mainly performed: miR-125a-5p mimic and let-7e-5p mimic are transfected in an AML-12 hepatocyte line in vitro, and the changes of related molecules in a lipid metabolism pathway are detected; target molecules common to the two miRNAs (namely miR-125a-5p and let-7e-5p) are screened and found through a database, a reporter gene vector for a dual-luciferase reporter gene experiment is constructed, and the target gene is verified in vitro; miR-125a-5p antagonists and let-7e-5p antagonists wrapped by LNP (namely LNP-miR-125a-5p / let-7e-5p antagonists) are prepared, the LNP-miR-125a-5p / let-7e-5p antagonists are injected into NAFLD mice through a tail vein, and the treatment effect of the LNP-miR-125a-5p / let-7e-5p antagonists on the NAFLD mice is evaluated through serological indexes, pathological sections and flow cytometry detection and the like.

[0009] It is found through the above experiments that miR-125a-5p and let-7e-5p target the PRKAA2 gene together, regulate the expression of key enzymes in the synthesis and decomposition process of hepatocyte lipid metabolism, and affect hepatocyte lipid metabolism. The NAFLD mice treated by the delivered miR-125a-5p antagonists and let-7e-5p antagonists have weakened hepatocyte ballooning and liver inflammation, reduced lipid accumulation, and increased expression levels of p-AMPK alpha / AMPK alpha (namely the percentage of phosphorylated AMPK alpha protein in total AMPK alpha protein is increased).

[0010] The results of the above experiments show that the miR-125a-5p antagonists and let-7e-5p antagonists can be used as effective components of a drug for treating NAFLD, and can achieve the effect of slowing down the progression of NAFLD by activating the AMPK pathway.

[0011] The results of the above experiments also show that LNP can be used as a delivery carrier in the treatment of NAFLD by using the miR-125a-5p antagonists and let-7e-5p antagonists. In the LNP-miR-125a-5p / let-7e-5p antagonists, the ratio of the miR-125a-5p antagonists to the let-7e-5p antagonists is (1-10):(1-10), and the drug loading amount is 5%-6%.

[0012] The beneficial effects of the present application are embodied in:

[0013] On the basis of the discovery that miR-125a-5p and let-7e-5p can regulate the lipid metabolism of hepatocytes, and the in vitro verification that miR-125a-5p and let-7e-5p can simultaneously target the PRKAA2 gene, the present application discloses, for the first time, the mechanism of miR-125a-5p and let-7e-5p co-targeting the PRKAA2 gene to promote the progression of non-alcoholic fatty liver disease through the AMPK pathway, and confirms that miR-125a-5p and let-7e-5p antagonists can be used to treat NAFLD by targeting the corresponding two miRNAs, and effectively intervene in NAFLD by co-regulating the related molecules in the metabolic pathway, thereby providing a basis for the clinical treatment of NAFLD.

[0014] Further, the miRNAs antagonists (specifically, LNP-miR-125a-5p / let-7e-5p antagonists) obtained by the present application can effectively slow down the progression of NASH / NAFLD. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 The effects of miR-125a-5p and let-7e-5p on the lipid metabolism of hepatocyte line AML-12; wherein: *P<0.05; **P<0.01; ***P<0.001; ACC1 (Acetyl CoA carboxylase, acetyl coenzyme A carboxylase), FAS (Fatty acid synthase, fatty acid synthase), SREBP1c (Sterol regulatory element-binding protein 1, sterol regulatory element-binding protein 1) are related to fatty acid synthesis (FA synthesis); CD36 is related to lipid update (Lipid update); HSL (Hormone-sensitive triglyceride lipase, hormone-sensitive triglyceride lipase), CPT1α (Carnitine Palmitoyltransferase 1A, carnitine palmitoyltransferase 1A), PPRRα (Peroxisome Proliferator-Activated Receptor-Alpha, Peroxisome Proliferator-Activated Receptor-Alpha) are related to fatty acid oxidation (FA oxidation) decomposition.

[0016] Figure 2 In vitro verification of miR-125a-5p and let-7e-5p targeting PRKAA2 gene; wherein: (A) report plasmid construction strategy of target molecule PRKAA2, (B) dual luciferase reporter gene experiment results of miR-125a-5p and let-7e-5p and target molecule PRKAA2; **P<0.01; ***P<0.001.

[0017] Figure 3 Electron microscopy and particle size chart of LNP-miR-125a-5p / let-7e-5p antagonist; wherein: (A) electron microscopy chart, (B) particle size chart.

[0018] Figure 4 Effect and mechanism of LNP-miR-125a-5p / let-7e-5p antagonist on NAFLD mice; wherein: (A) comparison of mouse body weight (Body Weight), liver weight (Liver Weight), and blood glucose (Blood Glucose), (B) detection of serum (Serum) liver function indicators of mice, (C) HE and oil red O staining of mouse liver, (D) change of macrophages in mouse liver, (E) RNA level expression of target molecule PRKAA2 in mouse liver, (F) protein level expression of target molecule PRKAA2 in mouse liver; *P<0.05; **P<0.01; ***P<0.001; GAPDH is an internal reference, the molecular weight of GAPDH is about 36KDa, the molecular weight of AMPKα is about 62KDa, and the molecular weight of p-AMPKα is about 62KDa. DETAILED DESCRIPTION

[0019] The application will be further described in detail below in combination with the drawings and examples. The examples are only used to explain the application, and are not a limitation on the protection scope of the application.

[0020] (I) Non-alcoholic fatty liver disease research based on multi-molecular action

[0021] In the previous study, we found that miR-125a-5p and let-7e-5p were highly expressed in adipose tissue macrophages of obese mice, while they were lowly expressed in adipose tissue macrophages of normal control mice. At the same time, based on the study of miR-125a-5p, we found that miR-125a-5p and let-7e-5p were in the same miRNA cluster. According to these findings, we speculated that miR-125a-5p and let-7e-5p might be transported to the liver through exosomes; however, considering that they are in the same miRNA cluster, previous studies could not determine whether these two miRNAs affect the progression of nonalcoholic fatty liver disease (NAFLD) through synergistic action.

[0022] (II) Effect and mechanism of LNP-miR-125a-5p / let-7e-5p antagonists in the treatment of nonalcoholic fatty liver disease

[0023] (1) Transfection of miRNA mimic into AML-12 hepatocyte line and detection of lipid metabolism-related molecules at RNA level

[0024] First, the culture of AML-12 hepatocyte line (origin: Air Force Military Medical University, School of Basic Medical Sciences, Department of Medical and Genetic Developmental Biology; or the same commercial cell line can be purchased) was performed.

[0025] After the cells grew stably, 5 x 10 5 cells were counted and inoculated in a 6-well plate for culture. After they adhered, each group of miRNA was introduced. The specific introduction process was as follows: the working concentration of miRNA mimic (purchased from Ribobio) was 100 nM, and Lipo2000 (purchased from Thermo) was used for miRNA mimic transfection, with a transfection reagent volume:miRNA mimic volume of 3:5. The culture medium used during transfection was serum-free DMEM (purchased from Gibico). After 4-6 hours of transfection, the culture medium was replaced with complete culture medium containing 10% serum, and after 24 hours of culture, the sample was collected by centrifugation.

[0026] Finally, the detection of lipid metabolism-related molecules in cells was performed at the RNA level.

[0027] The experimental results showed that Figure 1), compared with mimic NC, transfection of miR-125a-5p mimic or transfection of let-7e-5p mimic affected the expression of lipid metabolism related molecules, but most of them had no significant difference; co-transfection of miR-125a-5p mimic and let-7e-5p mimic (i.e. "mimic miR-125a-5p+mimic let-7e-5p" group) affected the expression of lipid metabolism related molecules, and had significant statistical difference.

[0028] (2) Target gene screening, vector construction and dual luciferase reporter gene experiment

[0029] The downstream target genes of miR-125a-5p and let-7e-5p were predicted by using four databases of miRtarbase, miRwalk, starbase and targetscan. In addition, the predicted target genes were analyzed for function by KEGG, and the common target genes of miR-125a-5p and let-7e-5p were found. After bioinformatics analysis of all target genes, it was found that TNFRSF1B, MLEC, SLC38A9, AGO4, LIN28A and PRKAA2 were enriched in the NAFLD related pathway. In addition, when adipose tissue macrophage-derived exosomes were co-incubated with hepatocytes to verify the expression of target genes, it was found that only PRKAA2 had a significantly reduced expression level after co-incubation. Therefore, PRKAA2 was identified as the common downstream target gene of miR-125a-5p and let-7e-5p.

[0030] The target sequences of miRNA and target genes were found by using targetscan, and the reporter gene vector containing the target sequence was constructed. For details, see Figure 2 A, first, the binding site sequence of miR-125a-5p (i.e. AGUGUCCAAUUUCCCAGAGU CCCU) and let-7e-5p (i.e. UUGGUGUGUUGGAGGAUGGAGU) with the target gene PRKAA2 (wild sequence, after transcription, it is Figure 2 A "WT-PRKAA2 3UTR") and the mutated binding site sequence (after transcription, it is Figure 2 A "Mut-PRKAA2 3UTR") were designed, and then they were submitted to Genscript Biotechnology Co., Ltd. for target gene plasmid construction and mutant gene plasmid construction, and the reporter gene vector containing the corresponding wild sequence and mutant sequence of the 3`UTR region of PRKAA2 mRNA, i.e. "PRKAA2 3`UTR-WT" and "PRKAA2 3`UTR-MUT", were obtained.

[0031] HEK293T cells were seeded at 5 x 10 3 The cells were seeded in 96-well plates, and after they were 70%-80% full, the miRNA mimic and the reporter vector were co-transfected. In one group of experiments, miR-125a-5p mimic and mimic NC (control group) were respectively co-transfected with "PRKAA2 3'UTR-WT" (or a plasmid with a mutated targeting sequence, i.e., "PRKAA2 3'UTR-MUT") containing a targeting sequence that can be recognized by miR-125a-5p. In another group of experiments, let-7e-5p mimic and mimic NC (control group) were respectively co-transfected with "PRKAA2 3'UTR-WT" (or a plasmid with a mutated targeting sequence, i.e., "PRKAA2 3'UTR-MUT") containing a targeting sequence that can be recognized by let-7e-5p. Each group of experiments was performed according to the following procedure: 200 ng / well of plasmid transfection, 50 nM / well of miRNA mimic, and transfection reagent. After 4-6 hours of transfection, the medium was replaced with complete medium containing 10% serum. After 24-36 hours of culture, the cells were centrifuged and the supernatant was discarded. The cell pellet was washed with PBS, 20 μL of 1x Passive lysis buffer was added, and the cells were lysed on ice for 10 minutes. The lysate was centrifuged at 12000 rpm and 4°C for 10 minutes, and the supernatant was collected and used as the lysate. 5 μL of the lysate was mixed with 8 μL of Luciferase Assay Buffer II, and the mixture was quickly blown for 5 times. The mixture was placed in a fluorescence instrument for the first reading, with a delay of 2 s and a reading time of 10 s. Then, 8 μL of Stop & Glo Reagent was immediately added to the mixture, which was quickly blown for 5 times. The second reading was performed, and the R1 and R2 readings and the R1 / R2 ratio were recorded.

[0032] The experimental results showed that Figure 3 B) For experiments in which HEK293T cells were transfected with let-7e-5p mimic, the recombinant luciferase activity of the PRKAA2 3'UTR vector was significantly inhibited compared with the control group, while the recombinant luciferase activity of the PRKAA2 3'UTR mutant had no significant effect. For experiments in which HEK293T cells were transfected with miR-125a-5p mimic, the recombinant luciferase activity of the PRKAA2 3'UTR vector was significantly inhibited compared with the control group, while the recombinant luciferase activity of the PRKAA2 3'UTR mutant had no significant effect.

[0033] (3) LNP-miR-125a-5p / let-7e-5p antagonist treatment of NAFLD mice

[0034] Experiment and grouping: (1) C57BL / 6J mice were fed with normal diet (denoted as NCD, n = 5); (2) C57BL / 6J mice were fed with high-fat and high-sugar diet for 16 weeks to obtain NAFLD mice, and during the treatment, the tail vein was injected with blank liposomes as a control (denoted as HG-HFD, n = 5); (3) C57BL / 6J mice were fed with high-fat and high-sugar diet for 16 weeks to obtain NAFLD mice, and during the treatment, the tail vein was injected with LNP-miR-125a-5p / let-7e-5p antagonists (denoted as H+antagomir, n = 5), and the treatment lasted for two weeks, and the total injection of miRNA antagonists (miR-125a-5p antagonist and let-7e-5p antagonist) was 1.05 mg per mouse.

[0035] Among them, the NCD group of mice was always fed with normal diet, and the HG-HFD group of mice and the H+antagomir group of mice were changed to normal diet during the treatment. The injection of foreign agents during the treatment of mice may cause acute inflammation to occur. In order to ensure the stability of the mice, after the treatment, the mice were fed for two weeks before being taken and analyzed (i.e. the treatment was carried out at 16 weeks, the treatment was stopped at 18 weeks, the taking and analysis were carried out at 20 weeks, and all the experimental data after the treatment were obtained at 20 weeks); the LNP-miR-125a-5p / let-7e-5p antagonists (see Figure 4 ) were obtained by wrapping miR-125a-5p antagonists and let-7e-5p antagonists with liposomes (purchased from Ruihe Biological Technology Co., Ltd.). The miR-125a-5p antagonists and let-7e-5p antagonists, i.e. miR-125a-5p antagomir and let-7e-5p antagomir (purchased from Ruihe Biological Technology Co., Ltd.), were reverse complementary sequences of mature miRNA chains, and the whole chain was methylated. There were 2 and 4 base thio-modifications at the 5' end and the 3' end respectively, and there was a high-affinity cholesterol modification at the 3' end. During the treatment, the miR-125a-5p antagonists:let-7e-5p antagonists wrapped by the lipid nanoparticles were 1:1, and the drug loading was 6wt% (drug loading = total miRNA antagonists / liposomes x 100%).

[0036] During the 17th to 20th weeks of the experiment, it was found that Figure 4 A): Compared with the untreated NAFLD mice, the body weight of the mice treated with miR-125a-5p antagonists and let-7e-5p antagonists gradually decreased obviously, and the liver weight and blood glucose significantly decreased at 20 weeks. After the eyeball blood of the mice was taken, it was left at room temperature for 30 minutes, and then centrifuged at 12000 rpm and 4°C for 15 minutes. The serum was taken, and the serum of the mice was used to detect the liver function indexes such as ALT, AST, ALP, TC, HDL, etc. by using a full-automatic biochemical analyzer, and it was found that Figure 4B) : Compared with the untreated NAFLD mice, the expression of ALT, AST, ALP, TC, HDL was significantly reduced after the treatment of miR-125a-5p and let-7e-5p antagonists.

[0037] In addition, the mouse liver was taken, embedded with paraformaldehyde, and sent to the Seville Company for dehydration, embedding, sectioning, and HE and oil red O staining. The experimental results showed that Figure 4 C) : Compared with the untreated NAFLD mice, the ballooning degeneration of liver cells and lipid accumulation of mice were significantly reduced after the treatment of miR-125a-5p and let-7e-5p antagonists.

[0038] In addition, the mouse liver was taken, embedded with paraformaldehyde, and sent to the Seville Company for dehydration, embedding, sectioning, and HE and oil red O staining. The experimental results showed that Figure 4 D) : Compared with the untreated NAFLD mice, the CD11b + F4|80 low inflammatory macrophages (IM) of the mice were significantly reduced after the treatment of miR-125a-5p and let-7e-5p antagonists, and the CD11b + F4|80 hi tissue-resident macrophages, i.e., Kupffer cells (KC), had no obvious statistical change. This result suggests that the inflammation of the mice is alleviated after the treatment of LNP-miR-125a-5p / let-7e-5p antagonists.

[0039] The expression of target molecules is detected at the RNA level and the protein level for tissue samples taken from the liver of mice.

[0040] The procedure for detecting the expression at the RNA level is as follows: grind the liver tissue in trizol and add 1 / 5 volume of chloroform, invert up and down, and after standing for 5 minutes, centrifuge at 4°C and 12000 rpm for 20 minutes; transfer the supernatant to a new RNase-free EP tube, add an equal volume of isopropanol, mix well, and after standing, centrifuge at 4°C and 12000 rpm for 10 minutes; after discarding the supernatant, add 1 mL of pre-cooled anhydrous ethanol, and centrifuge at 4°C and 12000 rpm for 10 minutes; discard the supernatant, dry, and then add DEPC water to dissolve the RNA; use a micro nucleic acid protein detection instrument to detect the RNA concentration, and after reverse transcription, perform q-PCR to detect the expression of the target gene. The experimental results show that Figure 4 E): Compared with untreated NAFLD mice, the expression of PRKAA2 gene in the liver of mice treated with miR-125a-5p and let-7e-5p antagonists increased significantly.

[0041] The procedure for detecting the expression at the protein level is as follows: homogenize the liver tissue with protein lysis buffer RIPA, P-MSF and phosphatase inhibitor for 2 minutes, centrifuge at 4°C and 12000 rpm for 10 minutes; take the supernatant and use a BCA kit (purchased from Thermo) to perform protein BCA quantification, and after adding 5x loading buffer to the protein, place it in a 95°C metal bath for 10 minutes; according to the quantification results, perform protein sample loading, electrophoresis, membrane transfer and luminescence. The experimental results show that ​ F): Compared with untreated NAFLD mice, the expression of p-AMPKα / AMPKα in the liver of mice treated with miR-125a-5p and let-7e-5p antagonists increased (the ratio increased).

[0042] The above results reveal the role of miR-125a-5p and let-7e-5p in the progression of NASH / NAFLD, i.e., miR-125a-5p and let-7e-5p can target PRKAA2 to regulate (promote) the progression of NASH / NAFLD through AMPK.

[0043] In summary, the present application is based on the following experiments: (1) detection of lipid metabolism related molecules in hepatocyte line AML-12 transfected with miR-125a-5p mimic and let-7e-5p mimic; (2) screening of miR-125a-5p and let-7e-5p target genes by database, and vector construction and fluorescence reporter gene experiment; (3) treatment of NAFLD mice with LNP-miR-125a-5p / let-7e-5p antagonist, and detection of serology, pathology and flow cytometry; and detection of RNA level and protein level target molecule expression. The results show that, compared with transfection of miR-125a-5p or let-7e-5p, the hepatocyte lipid metabolism process is obviously affected after co-transfection of miR-125a-5p and let-7e-5p (combined with database analysis, miR-125a-5p and let-7e-5p may cause hepatocyte lipid metabolism disorder by co-targeting PRKAA2); compared with the control group, after treatment of NAFLD mice with LNP-miR-125a-5p / let-7e-5p antagonist, the mouse weight, blood glucose, lipid accumulation and inflammatory macrophage recruitment are reduced to some extent, and the liver PRKAA2 expression and AMPKα phosphorylation level are increased. Therefore, miR-125a-5p and let-7e-5p have important roles in the development of NAFLD, and the study of the molecular mechanism of LNP-miR-125a-5p / let-7e-5p antagonist in the treatment of NAFLD can provide certain theoretical basis for the clinical treatment of NAFLD.

Claims

1. A miRNA antagonist composition that increases the expression level of the liver PRKAA2 gene, characterized in that: The composition consists of a miR-125a-5p antagonist and a let-7e-5p antagonist; the miR-125a-5p antagonist is miR-125a-5pantagomir, and the let-7e-5p antagonist is let-7e-5p antagomir.

2. The miRNA antagonist composition for increasing the expression level of the liver PRKAA2 gene according to claim 1, characterized in that: The mass ratio of miR-125a-5p antagonist to let-7e-5p antagonist is (1-10):(1-10).

3. A drug for treating non-alcoholic fatty liver disease, characterized in that: The drug comprises the miRNA antagonist composition as described in any one of claims 1-2.

4. The drug for treating non-alcoholic fatty liver disease according to claim 3, characterized in that: The drug also includes pharmaceutical excipients.

5. The medicament for treating non-alcoholic fatty liver disease according to claim 4, characterized in that: The formulation excipients are lipid nanoparticles used to encapsulate miR-125a-5p antagonists and let-7e-5p antagonists.

6. The use of miRNA antagonists in the preparation of medicaments for treating non-alcoholic fatty liver disease, characterized in that: The miRNA antagonists are miR-125a-5p antagonists and let-7e-5p antagonists, wherein the miR-125a-5p antagonist is miR-125a-5p antagomir and the let-7e-5p antagomir is let-7e-5p antagomir, and the miRNA antagonists slow the progression of non-alcoholic fatty liver disease; The non-alcoholic fatty liver disease mentioned is non-alcoholic steatohepatitis.

7. The application according to claim 6, characterized in that: The miR-125a-5p antagonists and let-7e-5p antagonists reduce hepatocyte ballooning degeneration and hepatic lipid accumulation, and alleviate liver inflammation.

8. The application according to claim 6, characterized in that: The miR-125a-5p antagonists and let-7e-5p antagonists increased hepatic PRKAA2 expression and AMPKα phosphorylation levels.

Images