Application of Bta60SRPL18a gene in control of Bemisia tabaci, reagents for control of Bemisia tabaci and control methods thereof

Abstract

The invention discloses an application of a Bta60SRPL18a gene in the prevention and control of whiteflies, an agent for preventing and controlling whiteflies, and a prevention and control method, and belongs to the technical field of pest control. The nucleic acid sequence of the whitefly Bta60SRPL18a gene of the invention is shown in SEQ ID NO.1, and a highly efficient silencing dsBta60SRPL18a is prepared according to the Bta60SRPL18a gene, and dsBta60SRPL18a is introduced into the body of whiteflies by feeding, which can significantly reduce the positioning ability and feeding behavior of whiteflies on hosts, thereby achieving the purpose of prevention and control. The method is easy to operate, has strong effectiveness and specificity, has a significant effect on host selectivity, and has many advantages such as being environmentally friendly, and has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of pest control, and specifically relates to an application of a Bta60SRPL18a gene in the control of Bemisia tabaci, and an agent and a control method for the control of Bemisia tabaci. Background Art

[0002] Bemisia tabaci (Gennadius) belongs to the family Aleyrodidae, order Hemiptera, class Insecta. The insect was first reported in 1889 on tobacco in Greece. Over the past 40 years, the insect has become an important agricultural pest worldwide, causing serious economic losses to vegetables, cotton, etc.

[0003] At present, the method of controlling whiteflies mainly relies on chemical control, using chemically synthesized insecticides, such as organophosphates and carbamates, for spraying, which can quickly and effectively kill whiteflies. The operation is simple and the effect is obvious, but it may cause harm to non-target organisms, and long-term use may lead to insect pests' resistance to the pesticide, causing environmental pollution and potential safety hazards. Biological control methods are friendly to the ecological environment and will not cause chemical residues, which has become a research hotspot in recent years.

[0004] RNA interference (RNAi) is a mechanism of action that is triggered by short RNA fragments (siRNAs) and promotes the degradation of homologous mRNA or inhibits its translation. RNAi was first discovered in nematodes and can work in most organisms. The use of RNAi technology for gene function research, transgenic insect-resistant plants and new nucleic acid pesticides has gradually become an important green biological control method in the plant protection industry. RNAi technology can specifically inhibit gene expression and efficiently target and silence pest genes to achieve the purpose of pest control. It shows great potential in the development of new pest control strategies. Developing exogenous dsRNA products suitable for the control of whiteflies from the genetic level is easy to use and low cost. Moreover, due to the specificity of the gene, it can achieve precise control effects and is environmentally friendly. It has great application prospects in the control of whiteflies. Summary of the invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to provide an application of the Bta60SRPL18a gene in the control of Bemisia tabaci, an agent for controlling Bemisia tabaci and a control method.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] The application of the Bemisia tabaci Bta60SRPL18a gene in controlling Bemisia tabaci or preparing an agent for controlling Bemisia tabaci, wherein the nucleic acid sequence of the Bemisia tabaci Bta60SRPL18a gene is shown in SEQ ID NO.1.

[0008] On the basis of the above scheme, gene silencing is used to inhibit the expression of the Bta60SRPL18a gene in whiteflies and reduce the tropism of whiteflies to host plants.

[0009] Based on the above scheme, the gene silencing method is RNA interference.

[0010] Based on the above scheme, the host plant is tomato.

[0011] A dsRNA for biological control of Bemisia tabaci, comprising primers designed for the Bemisia tabaci Bta60SRPL18a gene, and synthesizing dsRNA for the Bemisia tabaci Bta60SRPL18a gene; the nucleic acid sequence of the Bemisia tabaci Bta60SRPL18a gene is shown in SEQ ID NO.1.

[0012] Based on the above scheme, the primers are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0013] On the basis of the above scheme, the nucleic acid sequence corresponding to the sense strand of the dsRNA is shown as SEQ ID NO.4; the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.4.

[0014] An agent for controlling Bemisia tabaci, comprising the above-mentioned dsRNA.

[0015] Based on the above scheme, the concentration of dsRNA in the agent for controlling whitefly is ≥700 ng / μL.

[0016] A method for controlling whitefly, which inhibits the expression of Bta60SRPL18a gene in whitefly by gene silencing, thereby reducing the tropism of whitefly to host plants. The nucleic acid sequence of the whitefly Bta60SRPL18a gene is shown in SEQ ID NO.1.

[0017] Based on the above scheme, the gene silencing method is RNA interference.

[0018] Based on the above scheme, the RNA interference is achieved by feeding whiteflies so that they ingest dsRNA of the Bta60SRPL18a gene.

[0019] Based on the above scheme, the dsRNA of the Bta60SRPL18a gene is prepared by the following method:

[0020] The cDNA reverse transcribed from total RNA of Bemisia tabaci was used as a template, and PCR amplification was performed using primers for synthesizing dsRNA. The PCR amplification product was recovered and purified and used as a template for in vitro transcription of dsRNA, and dsRNA was synthesized by in vitro transcription.

[0021] Based on the above scheme, the primers for synthesizing dsRNA are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0022] On the basis of the above scheme, the nucleic acid sequence corresponding to the sense strand of the dsRNA is shown as SEQ ID NO.4; the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.4.

[0023] On the basis of the above scheme, the whitefly is a MED cryptic species (Mediterranean, i.e. Q-type whitefly).

[0024] The present invention has the following beneficial effects:

[0025] The present invention provides the Bta60SRPL18a gene of Bemisia tabaci and its application in the prevention and control of Bemisia tabaci, and develops its highly efficient silencing dsRNA, and develops a technology capable of efficiently preventing and controlling Bemisia tabaci, that is, introducing dsBta60SRPL18a into the body of Bemisia tabaci by feeding, significantly reducing the host location ability and feeding behavior of Bemisia tabaci, thereby achieving the purpose of prevention and control. The method is easy to operate, has strong effectiveness and specificity, has a significant effect on host selectivity, and has many advantages such as being environmentally friendly, and has a good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Agarose gel electrophoresis results of amplified dsBta60SRPL18a;

[0027] Figure 2 Changes in the expression of Bta60SRPL18a gene in Bemisia tabaci in Lingshui area after feeding on dsEGFP and dsBta60SRPL18a (** indicates that there is a significant difference between the control curve and the treatment curve, 0.001<P≤0.01);

[0028] Figure 3 Changes in the expression of Bta60SRPL18a gene in Bemisia tabaci in Shouguang after feeding on dsEGFP and dsBta60SRPL18a (* indicates that there is a significant difference between the control curve and the treatment curve, 0.01<P≤0.05);

[0029] Figure 4 The positions of tomato leaves and whiteflies in the Y-shaped tube (A: the position where whiteflies are released; B: connected to the temperament bottle containing tomato plants);

[0030] Figure 5 Differences in host selection behavior of Bemisia tabaci in Lingshui area before and after interference with Bta60SRPL18a (** indicates significant difference between the control curve and the treatment curve, 0.001<P≤0.01);

[0031] Figure 6 Differences in host selection behavior of Bemisia tabaci in Shouguang area before and after interference with Bta60SRPL18a (*** indicates significant differences between the control curve and the treatment curve, P≤0.001). DETAILED DESCRIPTION

[0032] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention will be further described in detail below in conjunction with specific examples and with reference to data. The following examples are intended to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0034] The whitefly used in the following examples is the MED cryptic species (Mediterranean, i.e., Q-type whitefly), which was collected from Shouguang, Shandong and Lingshui, Hainan in 2017, and then raised with tobacco plants in an insect breeding room (temperature 27±1°C, relative humidity 60±5%, photoperiod 16L:8D).

[0035] RNA was extracted using the TRIzol extraction method (Thermo Fisher Scientific, USA). The reverse transcription reagent (EvoM-MLV RT Mix Kit with gDNA Clean for qPCR) was purchased from AG Aikerui Biotechnology Co., Ltd., the dsRNA synthesis kit (T7 RNAi Transcription Kit) was purchased from Novezan Biotechnology Co., Ltd., the kit used in the PCR reaction system (Premix TaqTM) was purchased from TAKARA Biotechnology Co., Ltd., and SteadyPure micro-PCR & gel recovery reagent was purchased from AG Aikerui Biotechnology Co., Ltd.

[0036] The data processing method of the following examples: For the analysis of the results of the bioassay of dsRNA against whiteflies, Excel 2021 was used to perform statistics on the search speed of whiteflies, and SPSS 26.0 software was used to perform independent sample T test to analyze the differences between different groups. For the analysis of the changes in the expression of target genes after RNA interference, RT-qPCR data were analyzed using 2 -△△Ct SPSS 26.0 software was used to analyze the data using independent sample T test.

[0037] Example 1

[0038] A dsRNA for biological control of Bemisia tabaci, prepared by the following method:

[0039] (1) According to the open reading frame of the Bta60SRPL18a gene of Bemisia tabaci (shown in SEQ ID NO.1), primers were designed for synthesizing dsRNA. The primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0040] SEQ ID NO.1(5'→3'):

[0041] ATGAAAATCAGGAAGAAGGTCAGAGAATTCCGAGTTATTGGCCGTAAAATGCCAAAGAACTTGAAGGAACAAACACCCTTATACAGAATGAGGATATTTTGCCCCCAACAGAATCATAGCCAAATCCAGGTTTTG GTATTTCCTCCGTCAGTTGCGCAAATTCAAGAAATCGACAGGAGAAATCGTTCAAGTTAAAGAAATCTTTGAAAAGGACCCTACGACAGTCAAGAACATCGGTATTTGGCTGCGATATGACCACAGGAATGGTA CCTCAAACATGTACAGGGAGTACAGAGCACTCAGTACATGCAGTGCTGTTGGAAAAATGTACAGAGAAATGGCCTCCAAACACAAAGCTCGCGTTCACAGTATCCAGATCATCCGGATTGCCACCATCAAAGAA GACGATGTACGCAGACCCTACATCAAACAATGGCTGCAACCCAACATCAAGTTCCCACTTGTACACCGTATCGTACAGAAGAGGAAGCTTGGATTATTCACGCTTCGAAAGAACATCAACACTGTTTACAGATAA

[0042] dsBta60SRPL18a-F: 5'-ttaatacgactcactataggggCCGAGTTATTGGCCGTAAAA-3' (SEQ ID NO. 2);

[0043] dsBta60SRPL18a-R: 5'-ttaatacgactcactatagggTGATGTTCTTTCGAAGCGTG-3' (SEQ ID NO. 3);

[0044] (2) Forty newly emerged adults of Bemisia tabaci were placed in a 1.5 mL centrifuge tube and total RNA was extracted using the TRIzol method. The concentration and quality of RNA were measured using an ultra-micro UV spectrophotometer (N60). The reverse transcription kit (EvoM-MLV RT Mix Kit with gDNA Clean for qPCR, AG) was used to perform reverse transcription according to the instructions to synthesize the first-chain cDNA.

[0045] (3) using the Bemisia tabaci cDNA synthesized in step (2) as a template, and performing PCR amplification using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3;

[0046] The reaction system for PCR amplification was: Premix Taq (TaKaRa TaqTM Version 2.0plus dye) 25 μL, upstream primer (10 μmoL / L) 2 μL, downstream primer (10 μmoL / L) 2 μL, template 2 μL, and dd H2O was added to make up to 50 μL.

[0047] The reaction procedure of PCR amplification was as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 40 s, for a total of 40 cycles; 72°C extension for 10 min. The amplified product was stored at 4°C.

[0048] (4) After the PCR reaction in step (3) is completed, the amplification result is detected by agarose gel electrophoresis, and the PCR product obtained above is recovered and purified using SteadyPure Micro PCR & Gel Recovery Reagent (AG Aikerui Biotechnology Co., Ltd.) and used as a template for in vitro transcription of dsRNA.

[0049] The PCR amplification product with a size of 531 bp was obtained by PCR amplification ( Figure 1), after sequencing and deleting the T7 promoter sequence, a nucleotide sequence of 491 bp was obtained, which is the target sequence of gene Bta60SRPL18a for synthesizing dsRNA, as shown in SEQ ID NO.4; the dsRNA of gene Bta60SRPL18a is a double-stranded RNA, consisting of a sense strand and an antisense strand, the nucleotide sequence corresponding to the sense strand is shown in SEQ ID NO.4, and the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.4.

[0050] SEQ ID NO.4 (5'→3'):

[0051] CCGAGTTATTGGCCGTAAAATGCCAAAGAACTTGAAGGAACAAACACCCTTATACAGAATGAGGATATTTTGCCCCCAACAGAATCATAGCCAAATCCAGGTTTTGGTATTTCCTCCGTCAGTTGCGCAAATTCAAGAAATCGACAGGAGAAATCGTTCAAGTTAAAGAAATCTTTGAAAAGGACCCTACGACAGTCAAGAACATCGGTATTTGGCTGCGATATGACCACAGGAATGGTACCTCAA ACATGTACAGGGAGTACAGAGCACTCAGTACATGCAGTGCTGTTGGAAAAATGTACAGAGAAATGGCCTCCAAACACAAAGCTCGCGTTCACAGATCCAGATCATCCGGATTGCCACCATCAAAGAAGACGATGTACGCAGACCCTACATCAAACAATGGCTGCAACCCAACATCAAGTTCCCACTTGTACACCGTATCGTACAGAAGAGGAAGCTTGGATTATTCACGCTTCGAAAGAACATCA

[0052] (5) using the PCR product purified in step (4) as a template for in vitro transcription of dsRNA to prepare dsRNA;

[0053] The in vitro transcription system of dsRNA is: NTPMix 8μL, 10×Transcription Buffer 2μL, T7Enzyme Mix 2μL, template 8μL, ddH2O to 20μL. Incubate at 37℃ for more than 2h.

[0054] After the reaction, a double enzyme digestion system was added to remove the residual template DNA and single-stranded RNA. The double enzyme digestion system was: 17 μL RNase-free H2O, 1 μL DNaseⅠ, and 2 μL RNase T1 (10 U / μL). Incubate at 37°C for 30 min.

[0055] The product was stored in a -20°C refrigerator to obtain dsRNA for biological control of whitefly, which was recorded as dsBta60SRPL18a.

[0056] Example 2 Inhibition of Bta60SRPL18a Gene Expression in Bemisia tabaci by dsBta60SRPL18a

[0057] The following tests were conducted in Lingshui (LS) and Shouguang (SG):

[0058] 30 newly emerged adults of Bemisia tabaci were placed in cylindrical test tubes. The tube caps were sealed with filter paper, and the dsBta60SRPL18a prepared in Example 1 was diluted to 700 ng / μL with 20% sucrose solution, added to the filter paper from the top of the tube cap, and the test tubes were gently rotated to make the filter paper all covered with dsBta60SRPL18a solution, and then placed in the insect breeding room for feeding. The newly emerged adults of Bemisia tabaci fed with dsEGFP were used as the control group, specifically, they were fed with sucrose solution of equal concentration of dsEGFP. Three replicates were set for each group.

[0059] Here, dsEGFP refers to the dsRNA of the enhanced green fluorescent protein gene (EGFP). In the preparation method thereof, the primers used for synthesizing dsRNA are shown in SEQ ID NO.5 and SEQ ID NO.6, the template used for PCR amplification is a plasmid containing the EGFP gene stored in the laboratory, the product size obtained by PCR amplification is 520 bp, the specific sequence is shown in SEQ ID NO.7, and the other reagents and methods used are the same as the method for preparing dsBta60SRPL18a in Example 1. Among them, the dsRNA of the gene EGFP is a double-stranded RNA, consisting of a sense strand and an antisense strand, the nucleotide sequence corresponding to the sense strand is shown in SEQ ID NO.7, and the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.7.

[0060] dsEGFP-F: 5'-taatacgactcactatagggg CCTGAAGTTCATCTGCACCA-3' (SEQ IDNO.5);

[0061] dsEGFP-R: 5'-taatacgactcactataggg GTGCTCAGGTAGTGGTTGTCG-3' (SEQ IDNO.6);

[0062] SEQ ID NO.7(5'→3'):

[0063] CCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCAT CGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCAC

[0064] On the second day after the whiteflies began to feed on dsRNA, newly emerged adults of whiteflies treated with 700ng / μL dsBta60SRPL18a and dsEGFP were collected, and three biological replicates were collected for each treatment. RNA from each group of whiteflies was extracted and purified, and then reverse transcribed into cDNA, which was diluted 20 times as a template for fluorescent quantitative PCR. RT-qPCR analysis was performed using the following primers.

[0065] The quantitative primers for the Bta60SRPL18a gene are as follows:

[0066] F: 5'-CGCGTTCACAGTACCAGATCA-3' (SEQ ID NO. 8);

[0067] R:5'-TGGGTTGCAGCCATTGTTTG-3' (SEQ ID NO.9);

[0068] The quantitative primers for the EGFP gene are as follows:

[0069] F: 5'-TAGCCTTGGCCAATTTCCG-3' (SEQ ID NO. 10);

[0070] R: 5'-TCCTTCAGCATTACCGTCC-3' (SEQ ID NO. 11);

[0071] The primers for the internal reference gene Actin are as follows:

[0072] F: 5'-TCTTCCAGCCATCCTTCTTG-3' (SEQ ID NO. 12);

[0073] R: 5'-CGGGTGATTTCCTTCTGCATT-3' (SEQ ID NO. 13);

[0074] The RT-qPCR system was (10 μL): 1.5 μL of ddH2O, 5 μL of 2×SYBR Green (Vazyme), 0.25 μL of upstream primer and downstream primer (10 μM) and 3.0 μL of cDNA first-strand template.

[0075] RT-qPCR reaction instrument Bio-Rad CFX Connect Real-Time system (BIO-RAD, USA).

[0076] The reaction conditions were 95°C for 2 min; 95°C for 15 s, 60°C for 30 s, 39 cycles, and 3 technical replicates for each sample.

[0077] The results are as follows Figure 2 and 3 Taking dsEGFP as the control, the relative expression of Bta60SRPL18a gene in whiteflies fed with dsBta60SRPL18a was statistically analyzed on the second day after feeding. The results showed that the expression of Bta60SRPL18a gene in whiteflies fed with dsBta60SRPL18a showed a significant downward trend compared with the expression of Bta60SRPL18a gene in whiteflies fed with dsEGFP. On the second day after feeding dsBta60SRPL18a, the expression level of Bta60SRPL18a gene in Lingshui strain of whitefly decreased by about 51.9% compared with the control group, and the expression level of Bta60SRPL18a gene in Shouguang strain of whitefly decreased by about 38.9% compared with the control group, further indicating that feeding dsBta60SRPL18a can cause a strong RNAi effect in whiteflies, resulting in a significant decrease in the expression level of Bta60SRPL18a gene in the body, thereby inhibiting the host selection behavior of whiteflies.

[0078] Example 3 Application of dsBta60SRPL18a in inhibiting host selectivity of Bemisia tabaci

[0079] The effects of feeding dsBta60SRPL18a on host selection of Bemisia tabaci were tested in Lingshui (LS) and Shouguang (SG).

[0080] Among them, the tests in Lingshui area are:

[0081] 30 newly emerged adults of Bemisia tabaci were placed in cylindrical test tubes. The tube caps were sealed with filter paper, and the prepared dsBta60SRPL18a was diluted to 700 ng / μL with 20% sucrose solution, added to the filter paper from the top of the tube cap, and the test tubes were gently rotated to make the filter paper covered with dsBta60SRPL18a solution, and then placed in the insect breeding room for feeding for 48 hours. The newly emerged adults of Bemisia tabaci fed with dsEGFP were used as the control group, specifically, they were fed with sucrose solution of equal concentration of dsEGFP. Three replicates were set for each group.

[0082] The Y-type olfactometer was used to detect the host selection behavior of whiteflies after feeding dsRNA: the overall connection mode of the Y-type tube olfactometer is: air pump → activated carbon → molecular sieve → color-changing silica gel → gas washing bottle → flow meter → Y-type tube, the gas connection part is composed of soft sterile silicone tube, and a 15W-6500K energy-saving lamp is installed above the whole. When using, the whole Y-type tube olfactometer is wiped with anhydrous alcohol to remove dust and other messy organic compounds and grease, and ventilated for 30 minutes after drying to balance the system.

[0083] The specific method of using the Y-type olfactometer to detect the host selection behavior of whiteflies fed with dsRNA is as follows: a whole tomato plant with good growth is placed in a gas atmosphere bottle, the gas flow rate is set to 200 mL / min, and the Y-type tube is ventilated for 1 hour to make the Y-type tube full of odor. The olfactory selection behavior of whiteflies fed with different dsRNA in the Y-type tube is tested. After a group of 30 whiteflies are starved for 4 hours, they are all placed about 5 cm inside the entrance of the Y-type tube (such as Figure 4 ), and then observe the behavioral response of whiteflies within 1 hour, and count the results every 10 minutes. Individuals that died during the experiment were not counted, and the ratio was calculated for each group of experiments.

[0084] The experimental process in Shouguang area is the same as above, only the area is different.

[0085] The results are as follows Figure 5 , 6 As shown in the figure, after continuous feeding of newly emerged whiteflies dsBta60SRPL18a for 48 hours, the proportion of newly emerged whiteflies that found tomatoes showed a downward trend over time. Figure 5 , 6The results showed that there were significant differences between the dsBta60SRPL18a treatment group and the control group in different regions, indicating that feeding dsBta60SRPL18a can induce a strong RNAi effect in the body of whiteflies and affect the host selection behavior of whiteflies.

[0086] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. Bemisia tabaci Bta60SRPL18a The use of dsRNA of a gene in controlling Bemisia tabaci or preparing an agent for controlling Bemisia tabaci is characterized in that: Bemisia tabaci Bta60SRPL18a The nucleic acid sequence of the gene is shown as SEQ ID NO.1; the nucleotide sequence of the sense strand of the dsRNA is shown as SEQ ID NO.4, and the nucleotide sequence of the antisense strand of the dsRNA is the reverse complementary sequence of SEQ ID NO.

4.

2. The use according to claim 1, characterized in that: By using gene silencing, the Bta60SRPL18a The expression of the gene reduces the preference of whiteflies for host plants.

3. The use according to claim 2, characterized in that: The gene silencing method is RNA interference.

4. A dsRNA for biological control of Bemisia tabaci, characterized in that: Bemisia tabaci Bta60SRPL18a Gene design primers, synthesis of primers targeting Bemisia tabaci Bta60SRPL18a dsRNA of a gene; the whitefly Bta60SRPL18a The nucleic acid sequence of the gene is shown as SEQ ID NO.1; the nucleotide sequence of the sense strand of the dsRNA is shown as SEQ ID NO.4, and the nucleotide sequence of the antisense strand of the dsRNA is the reverse complementary sequence of SEQ ID NO.

4.

5. An agent for controlling Bemisia tabaci, characterized in that: Containing the dsRNA according to claim 4.

6. A method for controlling Bemisia tabaci, characterized in that: By using gene silencing, the Bta60SRPL18a The expression of the gene reduces the preference of whitefly to the host plant. Bta60SRPL18a The nucleic acid sequence of the gene is shown in SEQ ID NO.1; the gene silencing method is RNA interference; the RNA interference is through feeding, so that the whitefly ingests Bta60SRPL18a dsRNA of a gene; the nucleotide sequence of the sense strand of the dsRNA is as shown in SEQ ID NO.4, and the nucleotide sequence of the antisense strand of the dsRNA is the reverse complementary sequence of SEQ ID NO.4.

Images