Application of aGM gene and its encoded protein, biological material in improving plant disease resistance and / or cultivating disease-resistant plants

By introducing the codon-optimized aGM gene and its encoded protein into rice and tobacco, and activating the immune signaling chain using the Xa23 promoter, the problem of insufficient resistance to bacterial blight in rice and Phytophthora blight in peppers was solved, resulting in a significant improvement in disease resistance.

CN118853694BActive Publication Date: 2025-11-28HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411230757.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-03
Publication Date
2025-11-28
Estimated Expiration
2044-09-03

AI Technical Summary

Technical Problem

In the existing technology, the resistance genes for rice bacterial blight and pepper blight are insufficient to cope with the complex distribution of pathogens in the field and the continuous emergence of new pathogens and races, and there is a lack of effective disease resistance gene resources.

Method used

The codon-optimized aGM gene and its encoded protein were introduced into plants via a recombinant vector. The Xa23 promoter was used to activate the immune signaling chain, thereby enhancing the plant's disease resistance.

Benefits of technology

The study enhanced resistance to Phytophthora blight in tobacco and to bacterial blight in rice by inducing hypersensitivity reactions and reactive oxygen species bursts, thereby activating the expression of disease-resistant genes and significantly improving plant disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118853694B_ABST
    Figure CN118853694B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of agricultural genetic engineering, and particularly relates to an aGM gene and a protein and a biological material coded by the aGM gene, and application of the aGM gene and the protein and the biological material in improving plant disease resistance and / or cultivating disease-resistant plants. The application provides an aGM gene which is codon-optimized, and a nucleotide sequence of the aGM gene is shown in SEQ ID NO. 1. The aGM gene is beneficial to improving the disease resistance of plants, and thus the application further provides a protein and a biological material coded by the aGM gene and application of the protein and the biological material in improving the disease resistance of plants and / or cultivating disease-resistant plants. Experiments prove that after the exogenous aGM gene is introduced into plants, the disease resistance of the plants to diseases caused by Phytophthora capsici Leonian and to diseases caused by Xanthomonas campestris pv. is improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of agricultural genetic engineering, and particularly relates to an aGM gene and a protein and a biological material coded by the aGM gene, and application of the aGM gene and the protein and the biological material in improving plant disease resistance and / or cultivating disease-resistant plants. BACKGROUND

[0002] Rice bacterial leaf blight is caused by Xanthomonas oryzae pv. oryzae (Xoo), which can cause leaf whitening and death. The disease is prone to spread under high temperature and humidity conditions, and seriously reduces rice yield and quality. At present, Xa23, Xa10, Xa7 and other rice bacterial leaf blight resistance genes have been cloned and applied in production practice. However, due to the complex distribution of pathogens in the field, new pathogenic races are constantly emerging, so it is urgent to explore new resistance genes.

[0003] GSDM proteins were first found in mammals. They regulate programmed cell death and participate in immune response and tissue homeostasis of the body. Under the stimulation of certain inflammatory factors, the N-terminal of GSDM proteins can be activated to cause cell membrane perforation, release cell contents, trigger inflammatory response, and defend against pathogens. Recent studies have shown that GSDM proteins are distributed in mammals, fungi, bacteria and archaea, such as Archaea GSDM (aGM) in archaea, but have not been found in plants. SUMMARY

[0004] The application aims to provide application of an aGM gene and a protein and a biological material coded by the aGM gene in improving plant disease resistance and / or cultivating disease-resistant plants, so as to improve the ability of plants to resist bacterial leaf blight and pepper pythium blight.

[0005] The application provides an aGM gene, and the nucleotide sequence of the aGM gene is shown as SEQ ID NO. 1.

[0006] The application also provides an aGM protein coded by the aGM gene in the above technical solution, and the amino acid sequence of the aGM protein is shown as SEQ ID NO. 2.

[0007] The application provides a biological material, and the biological material comprises a recombinant vector containing the aGM gene in the above technical solution or an engineering bacterium containing the recombinant vector.

[0008] Preferably, the recombinant vector further comprises a promoter.

[0009] The promoter is Xa23.

[0010] The nucleotide sequence of the Xa23 is shown as SEQ ID NO. 20.

[0011] The application also provides the use of the aGM gene, the aGM protein or the biological material in improving the disease resistance of plants and / or cultivating disease-resistant plants.

[0012] Preferably, the plants include tobacco and / or rice.

[0013] Preferably, the disease resistance includes resistance to Phytophthora capsici and / or resistance to Xanthomonas oryzae.

[0014] The application also provides a method for improving the disease resistance of plants and / or cultivating disease-resistant plants, comprising:

[0015] The aGM gene is introduced into the target plants to improve the disease resistance of the plants and / or cultivate disease-resistant plants.

[0016] Preferably, the introduction includes injecting a transformation solution containing an aGM gene expression vector into the target plants.

[0017] Preferably, the target plants include tobacco and / or rice.

[0018] Advantages:

[0019] The application provides an aGM gene, and the nucleotide sequence of the aGM gene is shown as SEQ ID NO. 1. The existing sequence is codon-optimized according to the expression characteristics of plants, and then the nucleotide sequence shown as SEQ ID NO. 1 is obtained. The nucleotide sequence can be expressed in plants, and is beneficial to improving the disease resistance of the plants.

[0020] Based on the above technical advantages, the application further provides a protein encoded by the aGM gene, a biological material containing the aGM gene and the use of the aGM gene in improving the disease resistance of plants and / or cultivating disease-resistant plants. Experiments prove that the disease resistance of tobacco to Phytophthora capsici is improved by introducing an exogenous aGM gene into tobacco, and the disease resistance of rice to Xanthomonas oryzae is improved by introducing an exogenous aGM gene into rice. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0022] Figure 1 HR response of tobacco leaves induced by different treatments in Example 2 is shown in Table 1.

[0023] Figure 2 The effect of different treatments on the resistance level of tobacco in Example 2 is shown in Table 2.

[0024] Figure 3 Effect of different treatments on resistance of tobacco to P. capsici for Example 2;

[0025] Figure 4 Growth of transgenic rice lines in different treatments for Example 3;

[0026] Figure 5 Relative expression of aGM gene in different rice lines into which aGM gene was introduced for Example 3;

[0027] Figure 6 Phenotype of rice in different treatments for Example 3;

[0028] Figure 7 Expression of genes in rice in different treatments for Example 3. DETAILED DESCRIPTION

[0029] The application provides an aGM gene, a nucleotide sequence of the aGM gene is shown as SEQ ID NO. 1; the sequence of the SEQ ID NO. 1 is obtained by codon optimization, so that the aGM gene can be expressed in plants; the nucleotide sequence of the SEQ ID NO. 1 is: 5'-ATGTTCAGGTTCTTGAGCGGCGACCCTCTCATCTCGCTGCTGAAGAGCTACGGCTACAACGTCGTCCGCCTTCCAAAGGCGACTATCAAACCACTCCAACTCATGGCCAGCAAGAACAACGAGCTTTCCAGAGTCGGCGAGCTGTCAGTGGTGTTTAAGAGCAAGGGCAATATACCTCAGCCTACGCTCATGGAGAACTCGCCTGTGGCGAACATCAGCGGCAAGAAATCCGGCGAATTTAGCCTCGGCTTCGGTTTGTCCATACTGGGCAACATCATCAGCGGCCTTGGCGGTAGCACCGCGGGCTTGGAAAGTAAGTTCTCCAACGCCGATTCCATCGCTTTCCAGTATGAGGGAGTGCTGGAAGACTCCGTGGACGTGGCTGAACTCGATCAGTTTCTGTGCGATGCGGATATCAGTCCGTTCAGCCGTTTCGTTGGCCAGCTGCTCGACTCCGATAAGGTGTACGTGGTTACTGCCACCATCAAGTCCAAGAAGTTCACCATCTTTCCGCAGTCTTCGAAAGGCGGTGATCTGGGCATCCAAGTGCCGGTGATCCAGAACGTGGTGTCACCAACGGTCAAGGTCACCGGACAGGGCGGTAACTCTAGCGCTATCACCTTCGAGGGAGCTACGCCACTCGTGTTCGGCTTCCAGGCGGTCCAGCTCTTCTACGACAGAGGCCGCTACACGCGCATCGAGCCAGCTCAGCAAGATTTGCCTATGAGA-3'; by transferring the above sequence into plants, the disease resistance of the plants can be improved. The optimization method of the application is optimized according to the codon bias of rice. In the specific embodiments of the application, the online tool for codon optimization is https: / / www.novopro.cn / tools / codon-optimization.html.

[0030] The application provides an aGM protein encoded by the aGM gene in the technical scheme, and the amino acid sequence of the aGM protein is shown in SEQ ID NO. 2, and is MFRFLSGDPLISLLKSYGYNVVR LPKATIKPLQLMASKNNELSRVGELSVVFKSKGNIPQPTLMENSPVANISGKKSGEFSLGFGLSILGNIISGLGGSTAGLESKFSNADSIAFQYEGVLEDSVDVAELDQFLCDADISPFSRFVGQLLDSDKVYVVTATIKSKKFTIFPQSSKGGDLGIQVPVIQNVVSPTVKVTGQGGNSSAITFEGATPLVFGFQAVQLFYDRGRYTRIEPAQQDLPMR, and the protein can also improve the disease resistance of plants.

[0031] The application provides a biological material, which comprises a recombinant vector containing the gene combination in the technical scheme or an engineering bacterium containing the recombinant vector; a basic vector for constructing the recombinant vector is preferably pCAMBIA1300 or PRHE (disclosed in the following document: He F, Zhang F, Sun W, Ning Y, Wang GL. A Versatile Vector Toolkit for Functional Analysis of Rice Genes. Rice (N Y). 2018 Apr 20; 11 (1): 27. doi: 10.1186 / s12284-018-0220-7. Erratum in: Rice (N Y). 2018 Sep 7; 11 (1): 49. doi: 10.1186 / s12284-018-0238-x. PMID: 29679176; PMCID: PMC5910328.); and the recombinant vector further preferably comprises a promoter; the promoter is preferably Xa23, the Xa23-pro is contained in the sequence with the accession number KP123634.1 on NCBI; the nucleotide sequence of the Xa23 is as shown in SEQ ID NO.20, as 5'-CTGAGGTAGCTGCCACGTCAGCTAGGGGATCGGCCCGGCCGCCACGGTGGCACAATGTCAGCGCCAGTCCCGTTGGCGCTGACACGGCCAACGTCAGCGCCAATGTGTTTGGCGCTGAGGCGACGGCCTATTTTTGGTTGAAGTTTTTGGCAGGGGTTAGTTTCGAAATAAGTTTTCCAAAAGGGTCAATTTGTCAAAAAAACGGCTCGTCCCTGAGTCAAAGTCTTCCCTATTAAATTATGCGGCATCACTAACATCAGCTACTATAAAAGTCCCTTCCGCGTCACTAACATCAGCTACTATAAAAGTCCCTTCCGAAACATCTTCCTCCCGCATCACTAACATCAGCTTCTATAAAAGCCCTTCCTTGTTGCATCATCTCAAGGAGCTGCAAGCACTTCCTCTCTGGCAGCACTTCCTCATCTCAAGGAGTTGCAA-3'; in the sequence, the bolded part represents an EBE region, which can trap a TALE (Transcription Activator-Like Effect ors, TALEs) and activate the expression of downstream genes to trigger an immune signal chain containing multiple defense reactions, thereby benefiting the growth of plants.

[0032] The application provides application of the aGM gene, the aGM protein or the biological material in improving disease resistance of plants and / or cultivating disease-resistant plants; the disease resistance preferably includes resistance to diseases caused by Phytophthora capsici Leonian and / or Xanthomonas oryzae pv. oryzae; more preferably, the disease resistance includes resistance to diseases caused by Phytophthora capsici Leonian and Xanthomonas oryzae pv. oryzae; the plants preferably include tobacco and / or rice, and more preferably, the plants include tobacco and rice. The application does not have special limitations on the varieties of the tobacco and rice, and conventional tobacco or rice varieties in the art can be used; for example, in the specific embodiments of the application, the tobacco is Nicotiana benthamiana, and the rice is Kitaake.

[0033] The application provides a method for improving the disease resistance of plants and / or cultivating disease-resistant plants, comprising: introducing the aGM gene into a target plant to improve the disease resistance of the plant and / or cultivate a disease-resistant plant. In the application, the introduction preferably comprises injecting a transformation solution containing an aGM gene expression vector into the target plant; the target plant preferably comprises tobacco and / or rice, more preferably tobacco or rice. The components and preparation method of the transformation solution are not particularly limited and can be prepared by using methods known in the art.

[0034] Experiments show that, by introducing the exogenous aGM gene into tobacco according to the technical solution of the application, the hypersensitive (HR) response and reactive oxygen species (ROS) burst of tobacco are induced, and the tobacco is endowed with the resistance to pepper Phytophthora blight; by introducing the exogenous aGM gene into rice, the resistance of rice to bacterial leaf blight is improved.

[0035] In order to further illustrate the application, the aGM gene and the protein and biological material encoded thereby provided by the application in the improvement of the disease resistance of plants and / or the cultivation of disease-resistant plants are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the application.

[0036] Example 1 Sequence optimization of archaeal aGM

[0037] The existing archaeal aGM gene sequence (Gene accession in the IMG database: 8000477852) was subjected to codon optimization using an online codon optimization tool (https: / / www.novopro.cn / tools / codon-optimization.html). The optimization results are as follows:

[0038] The nucleotide sequence of the optimized archaeal aGM (i.e., the N terminus of archaeal GSDM is subjected to codon optimization) is shown as SEQ ID NO. 1, and the aGM protein sequence encoded by the optimized archaeal aGM gene is shown as SEQ ID NO. 2;

[0039] The nucleotide sequence of the optimized archaeal aGMF (i.e., the full length of archaeal GSDM is subjected to codon optimization) is shown as SEQ ID NO. 3, and the aGMF protein sequence encoded by the optimized archaeal aGMF gene is shown as SEQ ID NO. 4;

[0040] SEQ ID NO. 3: 5'-ATGTTCAGGTTCTTGAGCGGCGACCCTCTCATCTCG CTGCTGAAGAGCTACGGCTACAACGTCGTCCGCCTTCCAAAGGCGACTATCAAACCACTCCAACTCATGGCCAGCAAGAACAACGAGCTTTCCAGAGTCGGCGAGCTGTCAGTGGTGTTTAAGAGCAAGGGCAATATACCTCAGCCTACGCTCATGGAGAACTCGCCTGTGGCGAACATCAGCGGCAAGAAATCCGGCGAATTTAGCCTCGGCTTCGGTTTGTCCATACTGGGCAACATCATCAGCGGCCTTGGCGGTAGCACCGCGGGCTTGGAAAGTAAGTTCTCCAACGCCGATTCCATCGCTTTCCAGTATGAGGGAGTGCTGGAAGACTCCGTGGACGTGGCTGAACTCGATCAGTTTCTGTGCGATGCGGATATCAGTCCGTTCAGCCGTTTCGTTGGCCAGCTGCTCGACTCCGATAAGGTGTACGTGGTTACTGCCACCATCAAGTCCAAGAAGTTCACCATCTTTCCGCAGTCTTCGAAAGGCGGTGATCTGGGCATCCAAGTGCCGGTGATCCAGAACGTGGTGTCACCAACGGTCAAGGTCACCGGACAGGGCGGTAACTCTAGCGCTATCACCTTCGAGGGAGCTACGCCACTCGTGTTCGGCTTCCAGGCGGTCCAGCTCTTCTACGACAGAGGCCGCTACACGCGCATCGAGCCAGCTCAGCAAGATTTGCCTATGAGAGGTCCGAGCAACGTGGGTGGTAGCAAGCTCATCTCTCCAGCTCCATTTGTCAGCCTTGGCGAATGA-3';

[0041] SEQ ID NO. 4: MFRFLSGDPLISLLKSYGYNVVRLPKATIKPLQLMASKNNELSRVGELSVVFKSKGNIPQPTLMENSPVANISGKKSGEFSLGFGLSILGNIISGLGGSTAGLESKFSNADSIAFQYEGVLEDSVDVAELDQFLCDADISPFSRFVGQLLDSDKVYVVTATIKSKKFTIFPQSSKGGDLGIQVPVIQNVVSPTVKVTGQGGNSSAITFEGATPLVFGFQAVQLFYDRGRYTRIEPAQQDLPMRGPSNVGGSKLISPAPFVSLGE.

[0042] That is, the relationship between the optimized archaeal aGM (SEQ ID NO. 1) and the optimized archaeal aGMF (SEQ ID NO. 3) is that aGM and aGMF are derived from the same gene, aGM is the N-terminal domain part of aGMF, and aGMF has an additional C-terminal domain compared with aGM.

[0043] Example 2C Tobacco transient transformation aGM experiment

[0044] S1, vector construction:

[0045] The aGM (SEQ ID NO. 1) and aGMF (archaeal GSDM full-length, SEQ ID NO. 3) fragments were amplified respectively, and were constructed into pCAMBIA1300 vectors by homologous recombination. The primer sequences were designed as follows: the primers for amplifying aGM were P1300-aGMN-F: 5'-CCAAATCGACTCTAGAAAG CTTATGTTCAGGTTCTTGAGCG-3' (SEQ ID NO. 5) and P1300-aGMN-R: 5'-TTGCTCACCATGGTCTCTCATCTCATAGGCAAATCTTGCT-3' (SEQ ID NO. 6), and a stop codon TGA was added at the end of aGM by artificially adding a stop codon on the R primer; the primers for amplifying aGMF were P1300-GMN-F (SEQ ID NO. 5) and P1300-aGMF-R: 5'-TTGCTCACCATGGTCTCTCATTCGCCAAGGCTGAC-3' (SEQ ID NO. 7);

[0046] The primer pairing mode for amplifying aGM and aGMF fragments is: P1300-aGMN-F (SEQ ID NO. 5) and P1300-aGMN-R (SEQ ID NO. 6) for amplifying aGM fragment; P1300-aGMN-F (SEQ ID NO. 5) and P1300-aGMF-R (SEQ ID NO. 7) for amplifying aGMF fragment; the reaction conditions are: 95°C pre-denaturation for 5 min; 95°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, 34 cycles; 72°C extension for 5 min; by the above method, aGM product and aGMF product are prepared respectively;

[0047] Homologous recombination connection: the pCAMBIA1300 vector is digested with Hind III, and the digestion products are sequentially connected with the aGM product and the aGMF product respectively to construct a tobacco transient expression vector, and then transformed into E. coli DH5α to obtain a vector containing aGM sequence and a vector containing aGMF sequence. After extracting the plasmid, the plasmid is transformed into Agrobacterium GV3101 for standby use.

[0048] S2, immune characteristic analysis:

[0049] (1) Nicotiana benthamiana transient expression aGM induced plant hypersensitive (HR) reaction

[0050] This experiment is divided into four groups, namely aGM (1-243 aa), aGMF (1-264 aa), pCAMBIAsuper1300 empty vector (EV) and positive control Xa23 for inducing HR reaction; each experimental group is one treatment, and four treatments injected at different positions on the same tobacco leaf are one repetition, and at least three parallel repetitions are carried out;

[0051] The specific process is: aGM (SEQ ID NO. 1), aGMF (SEQ ID NO. 3) and Xa23 (here Xa23 refers to the Xa23 gene nucleotide sequence shown in KP123634.1) are respectively constructed into pCAMBIAsuper1300 vector and transformed into Agrobacterium GV3101; after shaking for 16 h, the bacterial bodies are resuspended using the infection liquid (consisting of 10 mM MgCl2, 10 mM 2-morpholinoethanesulfonic acid (MES) and 100 μM water solution of acetyl-syringone), adjusting the OD600 of each component to 1.0, and standing for more than 3 h, to obtain Agrobacterium containing aGM expression plasmid, Agrobacterium containing aGMF expression plasmid and Agrobacterium containing Xa23 expression plasmid;

[0052] Bacteria containing aGM expression plasmid 100 μL, bacteria containing aGMF expression plasmid 100 μL, bacteria containing Xa23 expression plasmid 100 μL and empty vector 100 μL were injected into different parts of the same tobacco leaf (i.e. four-week-old N. benthamiana leaves) respectively. 24 h after injection, the tobacco leaves were observed and photographed under white light and ultraviolet (UV) light, and the results are shown in Figure 1 (1) (in Figure 1 , the left graph represents the results of white light photography; the middle graph represents the results of ultraviolet light photography; in Figure 1 each graph, the white line in the lower right corner represents a scale of 1 cm; aGM represents the results of aGM expression; aGMF represents the results of aGMF expression; EV represents the results of the negative control; Xa23 represents the results of the positive control), 18 h after injection, tobacco leaf samples were taken to extract RNA and reverse transcribe to obtain cDNA, using tobacco reference gene EF1α as the reference (primer sequences are shown in SEQ ID NO. 16 and SEQ ID NO. 17), and aGM as the target gene (primer sequences are shown in SEQ ID NO. 23 and SEQ ID NO. 24) to perform fluorescent quantitative PCR to detect the relative expression level of each gene (aGM / aGMF) at the injection site, and the results are shown in Figure 1 the right graph in the middle.

[0053] From Figure 1 the left graph and the middle graph in the middle, it can be seen that after injecting bacteria containing aGM expression plasmid, it can cause HR response in tobacco cells like the positive control Xa23; and after injecting bacteria containing aGMF expression plasmid, it is consistent with the empty vector (EV) and does not trigger HR response in tobacco cells, and from Figure 1 the right graph in the middle, it can be seen that each gene is expressed at the injection site.

[0054] (2) aGM induces reactive oxygen species (ROS) burst in N. benthamiana and can be stained by DAB

[0055] As described in (1), bacteria containing aGM expression plasmid 100 μL, bacteria containing aGMF expression plasmid 100 μL, bacteria containing Xa23 expression plasmid 100 μL and empty vector 100 μL were injected into different parts of the same tobacco leaf (i.e. four-week-old N. benthamiana leaves) respectively.

[0056] 15 h after injection, the injected tobacco leaves were immersed in 20 mL DAB staining solution, and after 8 h of horizontal shaking in the dark, they were placed in anhydrous ethanol for decolorization, and horizontal shaking was performed for 48 h, and photography was performed under white light, and the results are shown in Figure 2 (in Figure 2 , the left graph represents the DAB staining results; the white line in the lower right corner represents a scale of 1 cm)

[0057] Depend on Figure 2 As can be seen from the left figure, both aGM and the positive control Xa23 can stain for ROS bursts, while the control group aGMF and the empty vector (EV) do not show this phenomenon. This shows that aGM expression in tobacco cells can induce ROS bursts in the same way as the positive control Xa23.

[0058] (3) Detection of disease resistance-related genes

[0059] Experimental method: Two groups of experiments were set up. The experimental group was Agrobacterium tumefaciens containing the expression plasmid aGM was injected into Nicotiana benthamiana, and the EV control was Agrobacterium tumefaciens containing the empty vector expression plasmid was injected into Nicotiana benthamiana. The experimental group and the control were injected on the same leaf. Each sample was replicated at least three times, that is, replicated on at least three leaves.

[0060] RNA extraction and reverse transcription quantitative PCR analysis: Tobacco leaves were collected 15 h after agroinjection (aGM and control EV) and immediately frozen in liquid nitrogen; after grinding in liquid nitrogen, the samples were used for RNA extraction; total RNA was extracted from the samples using an RNAprep Pure Plant Kit (TianGen Biotech; China); RNA was purified from the total RNA using DNase I (Thermo Scientific); complementary DNA (cDNA) was synthesized using a HiScript II first-strand cDNA synthesis kit (Vazyme); qRT-PCR was performed using SYBR Green mix (Vazyme) on a Bio-Rad CFX96 real-time system with a C1000 thermal cycler (Bio-Rad); the primers used are as follows: primers for amplifying the ERF1 gene qRT-ERF1 / F: 5'-gctcttaacgtcggatggtc-3' (SEQ ID NO. 8) and qRT-ERF1 / R: 5'-agccaaaccctagctccatt-3' (SEQ ID NO. 9); primers for amplifying the NPR1 gene qRT-NPR1 / F: 5'-acatcagcggaagcag tag-3' (SEQ ID NO. 10) and qRT-NPR1 / R: 5'-gtcggcgaagtagtcaaac-3' (SEQ ID NO. 11); primers for amplifying the PAL1 gene qRT-PAL1 / F: 5'-gttatgctcttagaacgtcgccc-3' (SEQ ID NO. 12) and qRT-PAL1 / R: 5'-ccgtgtaatgccttgtttcttga-3' (SEQ ID NO. 13); primers for amplifying the PR1b gene qRT-PR1b / F: 5'-gtggacactatactcaggtg-3' (SEQ ID NO. 14) and qRT-PR1b / R: 5'-tccaacttggaatcaaaggg-3' (SEQ ID NO. 15); primers for amplifying the NBEF1a reference gene qRT-NBEF1a-F: 5'-AGAGGCCCTCAGACAAAC-3' (SEQ ID NO. 16) and qRT-NBEF1a-R: 5'-TAGGTCCAAAGGTCACAA-3' (SEQ ID NO. 17); 2 -ΔΔCT The expression levels of each gene were calculated, and the results are shown in Table 1 and the right graph in FIG. Figure 2 Figure 2 ​In the right figure, aGM represents the expression of aGM; EV represents the negative control; ERF1 represents the expression level of ERF1; NPR1 represents the expression level of NPR1; PAL represents the expression level of PAL; PR1b represents the expression level of PR1b (significant difference P<0.05).

[0061] Table 1. Expression levels of different genes under different treatments

[0062]

[0063] From Table 1, Figure 2 As shown in the right figure, in the tobacco samples injected with aGM, the expression levels of disease resistance genes such as PR1b, NPR1, PAL1, and ERF1 were significantly higher than those in the control group. This indicates that the expression of aGM activates the expression of plant disease resistance genes, proving that the aGM gene has the immune characteristics of plant R genes.

[0064] (4) After transient expression of aGM protein, inoculation with Phytophthora capsici was performed.

[0065] As described in (1), Agrobacterium tumefaciens injected with an expression plasmid containing aGM into Nicotiana benthamiana was used as the experimental group, and Agrobacterium tumefaciens injected with an empty vector expression plasmid into Nicotiana benthamiana was used as the EV control. At least eight biological replicates were performed for each sample.

[0066] Fifteen hours after injection, leaves from different treatments were cut off and placed in an inoculation tray lined with moistened absorbent paper towels. A 3mm diameter mycelium of *Phytophthora capsici* strain LT263 was inoculated at the injection site. 10μL of sterile ddH2O was added to the inoculation site, and the tray was sealed with plastic wrap to maintain moisture and avoid light for 36–48 hours. The tobacco leaves were then observed and photographed under ultraviolet (UV) light. Results (…) Figure 3 The results showed that the lesion area in the aGM-injected group was significantly smaller than that in the EV-injected group, and the relative biomass of pathogens in the aGM-injected group was significantly lower than that in the control group.

[0067] The area of the infection spot formed by the treatment group injected with aGM was significantly smaller than that of the control group. The leaf samples were taken according to the size of 3 cm diameter centering on the inoculation cake, and the DNA was extracted by CTAB method. The concentration of the DNA was adjusted, and the tobacco reference EFla and the pepper Phytophthora internal reference gene were used respectively; the primer information was as follows: qRT-NBEFla-F (SEQ ID NO. 16) and qRT-NBEFla-R (SEQ ID NO. 17); Pc-tubulin-F: 5'-CAGAGGGTGCTGAGCTTATTGAC-3' (SEQ ID NO. 18) and Pc-tubulin-R: 5'-GAGAGTGGGTGATCTGGAAACCC-3' (SEQ ID NO. 19); the SYBRGreen mixture (Vazyme) was used to perform qRT-PCR on the Bio-Rad CFX96 real-time system and C1000 thermal cycler (Bio-Rad); 2 -ΔΔCT The relative biomass of pepper Phytophthora in tobacco leaf tissue was calculated by the method, and the results are shown in Table 2.

[0068] Table 2 Relative biomass of pepper Phytophthora in untreated samples

[0069]

[0070]

[0071] As can be seen from Table 2, after the same time of inoculation of pepper Phytophthora and detection, it was found that in the same weight of tobacco leaf, the relative pathogen biomass of the sample injected with aGM was significantly lower than that of the tobacco leaf sample injected with EV (after t-test, p = 0.0086 < 0.05), therefore, the archaeon aGM protein can function in plants and enhance the immune level and the ability to resist pepper Phytophthora of plants.

[0072] Example 3 Resistance analysis of archaeon aGM transgenic rice to Xoo strains PX099 and AH28 of rice bacterial leaf blight

[0073] S1, pathogen-induced promoter screening and use strategy

[0074] Xanthomonas oryzae pv. oryzae (Xoo) is a bacterial pathogen that causes severe damage to rice crops. The pathogen injects Transcription Activator-Like Effectors (TALEs) into rice cells using its Type III Secretion System (T3SS). TALE effectors recognize and bind to Effector Binding Elements (EBEs) in the rice genome through their specific DNA binding domains, thereby activating or repressing the expression of host genes. Rice disease resistance gene Xa23 was discovered by genetic analysis of rice varieties, and it can effectively resist bacterial blight. The EBE region in the Xa23 promoter sequence (SEQ ID NO. 20) can trap TALE and trigger an immune signal chain containing multiple layers of defense responses. Therefore, the Xa23 promoter was selected to be recombined with aGM and aGMF in rice, and homologous recombination was performed into the vector pRHE. The correct vector was sequenced and sent to AIDELAB Biotech Co., Ltd. for transformation into rice variety Kitaake.

[0075] S2, Detection of aGM expression and disease resistance identification of T0 generation of transgenic lines

[0076] Detection of aGM expression: A total of 25 independent T0 generation rice lines were finally obtained from the company. The obtained transgenic rice T0 lines (genetic background: Kitaaake) were numbered 1-25, and wild type rice lines were used as controls. The CTAB method was used to extract DNA samples from the above 25 lines, and the extracted DNA was used as a template for detection with the target gene primers (specific primer information: Bath-F: 5'-ATGTTCAGGTTCTTGAGCG-3' (SEQ ID NO. 21) and Bath-R: 5'-TCATCTCAT AGGCAAATCTTGCT-3' (SEQ ID NO. 22).

[0077] After the above PCR detection process, 13 positive lines were finally detected (numbered 1, 3, 5, 7, 9, 11, 12, 14, 16, 20, 21, 22 and 25, Figure 4The figure shows the comparison of the growth phenotype of part of the transgenic rice T0 with wild type Kitaake, from left to right in the figure are wild type Kitaake and T0 lines 1, 3, 25, 21), part of the lines (1, 14, 20, 21, 25, 3, 7 and 9) that were tested positive were randomly selected to extract RNA for the fluorescence quantitative experiment to detect the expression level of aGM, the primer information used in the process is as follows: qRT-agm-F: 5'-CTTCCAAAGGCGACTATCAAACCA-3' (SEQ ID NO. 23) and qRT-agm-R: 5'-CTCCATGAGCGTAGGCTGAGGTAT-3' (SEQ ID NO. 24); the primer for the reference gene is qRT-OSActin-F: 5'-CAGGCCGTCCTCTCTCTGTA-3' (SEQ ID NO. 25) and qRT-OSActin-R: 5'-AAGGATAGCATGGGGGAGAG-3' (SEQ ID NO. 26), the results are shown in Table 3 and Figure 5 .

[0078] Table 3 Relative expression level of target gene of rice transformation lines

[0079] - K1 K14 K20 K21 K25 K3 K7 K9 Repeat 1 0.02351 1.00000 0.65238 0.14944 2.06056 0.13305 0.21743 0.57690 Repeat 2 0.06508 0.60788 0.72982 0.08256 1.16049 0.13988 0.22520 0.47249 Repeat 3 0.10110 0.88462 0.56931 0.11577 0.80727 0.11552 0.19625 0.55010

[0080] It can be seen from Table 3 and Figure 5 that the relative expression level of the introduced gene aGM in different independent T0 generation rice transformation lines is not the same, which can provide a certain degree of theoretical basis for subsequent disease resistance identification.

[0081] (2) Disease resistance identification: According to the previous collection of T0 generation of rice transformation lines of rice bacterial leaf blight resistance detection results, select transgenic lines 21, 22 seed germination to obtain T1 generation of transgenic lines and extract DNA for genotype identification, in the booting stage T1 generation of transgenic rice inoculated with rice bacterial leaf blight strain PXO99 (AvrXa23 effector can be secreted combined with Xa23 promoter to induce aGM expression, published in Xu Z, Xu X, Wang Y, Liu L, Li Y, Yang Y, Liu L, Zou L, Chen G. A varied AvrXa23-like TALE enables the bacterial blight pathogen to avoid being trapped by Xa23 resistance gene in rice. J Adv Res. 2022 Dec;42:263-272. doi: 10.1016 / j.jare.2022.01.007. Epub 2022 Jan 29. PMID: 36513417; PMCID: PMC9788936.), or inoculated with rice bacterial leaf blight strain AH28 (AvrXa23 effector cannot be secreted combined with Xa23 promoter to induce aGM expression) in transgenic rice, get inoculated with PXO99 rice and inoculated with AH28 rice;

[0082] The specific process is: using NB medium (NB medium uses water as solvent, containing 10 g / L of proteose peptone, 3 g / L of beef extract and 5 g / L of sodium chloride NaCl) to culture PXO99 and AH28 overnight, then centrifuge at 4000 rpm for 5 min to collect bacteria PXO99 and bacteria AH28, resuspend the bacteria with sterilized ddH2O, and repeat the washing of the bacteria twice to adjust OD 600 0.5, get PXO99 bacterial solution and AH28 bacterial solution; select rice flag leaf for inoculation, dip the bacterial solution with scissors to form a flat and uniform wound about 2 cm from the tip of the flag leaf to facilitate bacterial invasion, observe the disease condition 14 days after inoculation, and count the lesion length, the results are shown in Table 4 and Figure 6 (In Figure 6 , PXO99 represents the disease condition of rice after inoculation with PXO99; AH28 represents the disease condition of rice after inoculation with AH28; WT represents wild type control, aGM and aGMF represent positive T1 generation lines of aGM and aGMF, respectively)

[0083] Table 4 Disease condition of rice in different treatments (unit: centimeter)

[0084]

[0085] From Table 4 and Figure 6 It can be seen that the T1 generation of seed germination of T0 generation No. 21, 22 strain all showed significant resistance to PXO99, but no significant resistance to AH28, and the wild type and aGMF transformation strain had no obvious resistance to the two strains, indicating that PXO99 can induce the expression of aGM in transgenic strain and achieve disease resistance.

[0086] (3) Expression of aGM induced by X. oryzae and detection of expression amount of disease resistance gene:

[0087] According to the above Table 4, the transgenic strain 21 and 22 were selected for seed germination to obtain T1 generation transgenic strain and extract DNA for genotyping to identify positive plants of the introduced target gene. According to the method in (2), PXO99 and AH28 bacterial liquid were obtained, and a needleless syringe was used to inject different treated bacterial liquid on the back of the first fully expanded leaf of T0 generation transgenic strain 21 and 22 T1 generation seedlings, 1 kind of bacterial liquid was injected per leaf, 3 points of each bacterial liquid injection were used as one sample (i.e. 3 parallel repeats), for kitaake, the treatment of injecting PXO99 bacterial liquid was recorded as K99, the treatment of injecting AH28 bacterial liquid was recorded as K28, and the treatment of injecting water was recorded as K MOCK, and the treatments of 2128, 2199, 21 MOCK were the same as above, 2128, 2199, MOCK respectively refer to the injection of AH28, PXO99 and water on T0 generation transgenic strain 21 T1 generation seedlings, 2228, 2299, 22 MOCK respectively refer to the injection of AH28, PXO99 and water on T0 generation transgenic strain 22 T1 generation seedlings;

[0088] 48h after taking the above samples and extracting RNA for fluorescence quantitative detection; wherein, the primers for amplifying PR10 gene are: qRT-PR10-F: 5'-GTCCGGGCACCATCTACACC-3'(SEQ ID NO. 27) and qRT-PR10-R: 5'-CAAGCTTCGTCTCCGTCGAGT-3'(SEQ ID NO. 28); the primers for amplifying agm gene are qRT-agm-F (SEQ ID NO. 23) and qRT-agm-R (SEQ ID NO. 24); the primers for internal reference gene are qRT-OSActin-F (SEQ ID NO. 25) and qRT-OSActin-R (SEQ ID NO. 26), and the results are shown in Figure 7 (As shown in Figure 7 In the above, K99 represents the treatment of injecting PXO99 bacterial liquid; 28 represents the treatment of injecting AH28 bacterial liquid; K MOCK represents the treatment of injecting water.

[0089] By Figure 7 It can be seen that, compared with wild type Kitaake, the expression amount of aGM and the anti-disease gene PR10 are all up-regulated by PXO99 induction, but not by AH28 induction.

[0090] In conclusion, by using the technical solution provided by the present application, the exogenous aGM gene is introduced into tobacco, which is beneficial to induce hypersensitive (HR) response and reactive oxygen species (ROS) burst of tobacco, thereby imparting the performance of tobacco resistance to pepper blight; the exogenous aGM gene is introduced into rice, which improves the performance of rice resistance to bacterial leaf blight.

[0091] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. An aGM gene, characterized in that, The nucleotide sequence of the aGM gene is shown in SEQ ID NO.

1.

2. The aGM protein encoded by the aGM gene according to claim 1, characterized in that, The amino acid sequence of the aGM protein is shown in SEQ ID NO.

2.

3. A biomaterial, characterized in that, The biological material is a recombinant vector containing the aGM gene of claim 1 or an engineered bacterium containing the recombinant vector.

4. The biomaterial according to claim 3, characterized in that, The recombinant vector also contains a promoter; the promoter is Xa23; The nucleotide sequence of Xa23 is shown in SEQ ID NO.

20.

5. The application of the aGM gene of claim 1, the aGM protein of claim 2, or the biomaterial of claim 3 in enhancing the resistance of rice to diseases caused by Blight of blight and / or cultivating rice resistant to diseases caused by Blight of blight.

6. The use of the aGM gene of claim 1, the aGM protein of claim 2, or the biomaterial of claim 3 or 4 in enhancing tobacco resistance to diseases caused by Phytophthora capsici and / or cultivating tobacco resistant to diseases caused by Phytophthora capsici.

7. A method for improving plant disease resistance and / or cultivating disease-resistant plants, characterized in that, include: The aGM gene described in claim 1 is introduced into the target tobacco to enhance the tobacco's resistance to diseases caused by Phytophthora capsici and / or to cultivate tobacco resistant to diseases caused by Phytophthora capsici. Alternatively, the aGM gene as described in claim 1 may be introduced into the target rice to enhance the rice's resistance to diseases caused by Blight of blast fungus and / or to cultivate rice resistant to diseases caused by Blight of blast fungus.

8. The method according to claim 7, characterized in that, The introduction involves injecting a transformation solution containing the aGM gene expression vector into the target plant.

Citation Information

Patent Citations

  • Method for cultivating bacterial blight-resistant rice through gene editing technology

    CN110272915A

  • Drought stress tolerant gene AGP and use thereof

    KR1020130126068A