Rice os sbeii b gene mutant and application and improvement method thereof in improving starch components of rice
By using the CRISPR/Cas9 system to perform site-specific editing of the rice OsSBEIIb gene, replacing amino acid position 785, the problem of starch composition improvement in traditional methods was solved, resulting in significant improvement of rice starch composition and quality, and providing a rapid breeding strategy.
Patent Information
- Application Number
- CN202410805479.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-21
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-06-21
AI Technical Summary
Existing technologies struggle to alter starch composition and rice quality by precisely replacing key amino acids in rice SBEIIb protein. Traditional mutagenesis methods suffer from low mutation frequency, are time-consuming and labor-intensive, and lack relevant research based on CRISPR/Cas9.
Using the CRISPR/Cas9 system for single-base editing, the 785th amino acid of the rice OsSBEIIb gene was replaced with G to K, E, R, Q. Homozygous mutants were obtained through Agrobacterium-mediated genetic transformation, and homozygous mutants without exogenous genes were screened.
It significantly altered starch composition and functional properties, increased amylose content and gelatinization temperature, and provided efficient germplasm resources for the rapid breeding of high-quality functional rice varieties.
Smart Images

Figure CN118853704B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of gene editing technology and rice genetic breeding, and particularly relates to a rice OsSBEIIb gene mutant and application and improvement method thereof in improving starch components of rice. BACKGROUND
[0002] Rice quality determines its price in the market. Generally, rice quality mainly includes milling quality, appearance quality, nutritional quality and cooking taste quality. In recent years, with the increase of rice yield and the improvement of people's living standards, consumers pay more attention to the cooking taste and nutritional quality of rice. Rice is composed of starch, storage protein, non-starch carbohydrate, lipid, vitamin and mineral, etc., in which starch accounts for more than 80% of the dry weight of rice and is the main factor affecting rice quality. Starch is mainly composed of amylose and amylopectin. Amylose is a linear or slightly branched glucose polymer, while amylopectin is a highly branched macromolecular glucose polymer. The amylose content and amylopectin chain length distribution are referred to as starch components, which affect starch properties and rice quality and determine the end use of rice. For example, high amylose rice is rich in resistant starch, which can effectively control postprandial blood glucose levels and help diabetic patients delay the disease, and therefore can be used as a new type of dietary fiber in the functional food industry; low amylose rice has the characteristics of cold non-regeneration and cold rice palatability, and is often used to process various instant foods. In addition, the length and content of each side chain of amylopectin also have a very important influence on the digestion characteristics and cooking quality of rice. Therefore, it is of great significance to study rice mutants with changed starch components for high-quality functional rice breeding work.
[0003] The synthesis of starch requires the participation of multiple enzymes, among which, granule-bound starch synthase I (GBSSI) is responsible for the synthesis of amylose, and amylopectin is catalyzed by soluble starch synthase (SSS), starch branching enzyme (SBE) and starch debranching enzyme (DBE) in the form of a multi-enzyme complex. Among them, SBE is responsible for generating amylopectin branch side chains and is crucial for the formation of amylopectin. There are at least three isozymes of SBE in rice: SBEI, SBEIIa and SBEIIb. SBEI tends to transfer long branch side chains (>14 DP), while SBEII preferentially transfers shorter glucan chains (<14 DP). SBEI and SBEIIa are expressed in various tissues, while SBEIIb is mainly expressed in endosperm tissue, and studies have shown that SBEIIb plays a key role in the synthesis of short branch side chains of amylopectin in endosperm, and its function cannot be replaced by SBEI and SBEIIa. Therefore, regulating the expression or activity of SBEIIb can not only change the chain length distribution of amylopectin, but also regulate starch components, thereby improving starch properties and rice quality to meet the diversified needs of rice with different starch components.
[0004] Most of the reported SBEIIb mutants are loss-of-function deletion mutants that have a serious impact on starch components and properties and rice quality, while there are few reports on SBEIIb amino acid substitution alleles, and their impact on starch components and the mechanism of regulating starch properties and rice quality are still unclear and need further study. Traditional mutagenesis methods have low mutation frequency, random mutation, time-consuming and laborious, and long breeding time, so it is difficult to obtain SBEIIb amino acid substitution mutants by this method. With the development of technology, the single base editing system based on CRISPR / Cas9 can precisely and directionally replace the target base, has high mutation efficiency and short cycle, and can obtain homozygous mutants in T0 and stable genetic homozygous mutants without exogenous genes in T1, which provides the possibility for rapid creation of excellent new rice lines. Therefore, using gene editing technology to create new SBEIIb alleles in rice is an effective new way to further analyze the mechanism of SBEIIb new alleles regulating starch components and rice quality, which helps to provide germplasm resources for the cultivation of high-quality functional rice varieties. So far, there has been no related research on using single base gene editing technology to replace important amino acids of rice SBEIIb protein to create new rice lines. SUMMARY
[0005] This section is intended to summarize some aspects of the embodiments of the present application and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the Abstract and Title of the specification to avoid obscuring the summary of the disclosure herein, which can not be used in limiting the scope of the present application.
[0006] In view of the above and / or problems existing in the prior art, the present application is proposed.
[0007] Therefore, the purpose of the present application is to overcome the deficiencies in the prior art, and provide a rice OsSBEIIb gene mutant.
[0008] To solve the above technical problems, the present application provides the following technical solutions, including,
[0009] The amino acid G at the 785th position of the OsSBEIIb protein encoded by the OsSBEIIb gene from Oryza L. is mutated to one of K, E, R and Q;
[0010] The nucleotide sequence of the OsSBEIIb gene is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2;
[0011] The nucleotide sequence of the amino acid G mutated to K is shown in SEQ ID NO. 3, and the amino acid sequence is shown in SEQ ID NO. 4;
[0012] The nucleotide sequence of the amino acid G mutated to E is shown in SEQ ID NO. 5, and the amino acid sequence is shown in SEQ ID NO. 6;
[0013] The nucleotide sequence of the amino acid G mutated to R is shown in SEQ ID NO. 7, and the amino acid sequence is shown in SEQ ID NO. 8;
[0014] The nucleotide sequence of the amino acid G mutated to Q is shown in SEQ ID NO. 9, and the amino acid sequence is shown in SEQ ID NO. 10.
[0015] The purpose of the present application is to overcome the deficiencies in the prior art, and provide an application of a rice OsSBEIIb gene mutant in improving the starch components of rice.
[0016] The purpose of the present application is to overcome the deficiencies in the prior art, and provide a method for improving the starch components of rice by using a rice OsSBEIIb gene mutant.
[0017] To solve the above technical problems, the present application provides the following technical solutions, including,
[0018] Designing the target site of OsSBEIIb gene site-directed editing
[0019] Constructing a single base editing vector containing the target fragment
[0020] Obtaining T0 transgenic rice plants: transforming Agrobacterium EHA105 with the single base editing vector, and obtaining T0 transgenic plants by Agrobacterium-mediated genetic transformation of rice
[0021] Identifying the mutation type of T0 transgenic rice plants: using primers SBEIIb-PCR-F and SBEIIb-PCR-R to amplify the target site sequence to identify the mutation of T0 transgenic seedlings, and the nucleotide sequence is shown in SEQ ID NO. 11 and SEQ ID NO. 12
[0022] Screening T1 mutant plants without exogenous genes
[0023] Identifying the mutation type of T1 plants without exogenous genes again and obtaining target gene homozygous mutant plants, which can be cultivated to obtain rice with improved starch components.
[0024] As a preferred scheme of the method for improving the starch components of rice by using the OsSBEIIb gene mutant of rice according to the application, wherein: the target site includes the target sequence of sgRNA, and the target sequence of sgRNA is the 20th-39th of the 21st exon of SEQ ID NO. 1 gene sequence.
[0025] As a preferred scheme of the method for improving the starch components of rice by using the OsSBEIIb gene mutant of rice according to the application, wherein: the nucleotide sequences of the linker sequences sgRNA-SBEIIb-F and sgRNA-SBEIIb-R of the target fragment are shown in SEQ ID NO. 13 and SEQ ID NO. 14.
[0026] As a preferred scheme of the method for improving the starch components of rice by using the OsSBEIIb gene mutant of rice according to the application, wherein: the vector includes a CRISPR / Cas9-based cytosine base editor and a specific nuclease targeting the OsSBEIIb gene.
[0027] As a preferred scheme of the method for improving the starch components of rice by using the OsSBEIIb gene mutant of rice according to the application, wherein: the transformation method includes one or more of callus induction, subculture, infection, recovery, screening, differentiation, and rooting.
[0028] As a preferred scheme of the method for improving the starch components of rice by using the OsSBEIIb gene mutant of rice according to the application, wherein: the exogenous gene includes an HPT marker gene, a Cas9, and a gRNA element.
[0029] The present application aims to overcome the deficiencies in the prior art and provide a biological material, which is any one of the following:
[0030] (a1) sgRNA specifically targeting the OsSBEIIb gene according to any one of claims 1-7;
[0031] (a2) sgRNA specifically targeting the target sequence according to claim 4;
[0032] (a3) DNA molecule encoding the sgRNA according to (a1) or (a2);
[0033] (a4) expression cassette containing the DNA molecule according to (a3);
[0034] (a5) recombinant vector containing the DNA molecule according to (a3), or recombinant vector containing the expression cassette according to (a4);
[0035] (a6) recombinant microorganism containing the sgRNA according to (a1) or (a2), or the DNA molecule according to (a3), or the expression cassette according to (a4), or the recombinant vector according to (a5);
[0036] (a7) transgenic plant cell line containing the sgRNA according to (a1) or (a2), or the DNA molecule according to (a3), or the expression cassette according to (a4), or the recombinant vector according to (a5).
[0037] As a preferred solution of the method for improving rice starch components by using the rice OsSBEIIb gene mutant according to the present application, wherein: the improvement of rice quality is at least one of the following:
[0038] (b1) the content of amylose is increased;
[0039] (b2) the proportion of long side chains of amylopectin is increased.
[0040] The present application has the following beneficial effects:
[0041] The application first uses single base gene editing technology to edit the coding region of rice OsSBEIIb gene. By constructing a cytosine base editor CBE vector targeting a specific sequence of OsSBEIIb gene, a transgenic plant is obtained by using rice as the transformation material and through an Agrobacterium-mediated rice genetic transformation method. After mutation identification and offspring screening, a homozygous mutant without exogenous gene insertion is obtained in T1, and the glycine at the 785th position of the OsSBEIIb protein is replaced by four different forms of mutations, including G785E, G785Q, G785K and G785R. The starch components and thermodynamic properties of the four mutants are significantly changed compared with the wild type, and the apparent amylose content and gelatinization temperature are increased to different degrees, and the grain contains transparent / chalky / powdery phenotypes. It is shown that replacing the important amino acid of the OsSBEIIb protein by using single base gene editing technology can significantly improve the starch components and functional properties of rice. The homozygous OsSBEIIb gene mutant provided by the application without exogenous gene is a very valuable germplasm resource, and the application provides an effective strategy for rapidly improving the starch components of rice and creating high-quality functional rice lines by using single base gene editing technology. BRIEF DESCRIPTION OF DRAWINGS
[0042] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor. Among them:
[0043] Figure 1 The vector structure of the edited target site and cytosine single base editor in the present application embodiments 1 and 2 Figure 1 A is the target site sequence of editing the OsSBEIIb gene; Figure 1 B is the vector structure of the cytosine single base editor.
[0044] Figure 2 The process of Agrobacterium-mediated rice genetic transformation in the present application embodiment 3 Figure 2 A is to induce rice callus; Figure 2 B is subculture; Figure 2 C is Agrobacterium infection; Figure 2 D is recovery culture; Figure 2 E is the first screening culture; Figure 2 F is the second screening culture; Figure 2 G is differentiation culture; Figure 2 H is to differentiate and regenerate seedlings; Figure 2 I is rooting culture.
[0045] Figure 3Mutant identification of T0 transgenic plant (part) OsSBEIIb gene target site sequence in Example 4 of the present application (the corresponding amino acid mutation and genotype are indicated in the brackets).
[0046] Figure 4 Screening and identification of homozygous T1 mutant without exogenous gene insertion in Example 5 of the present application Figure 4 A is the preliminary screening of HPT marker gene; Figure 4 B is further identification of Cas9 and gRNA elements for single plants without HPT marker gene; Figure 4 C is the homozygous mutant type obtained by target site mutation identification for single plants without exogenous genes HPT, Cas9 and gRNA; the corresponding amino acid mutation is indicated in the brackets.
[0047] Figure 5 Grain appearance quality of wild type japonica rice Zhonghua 11 (ZH11) and T2 homozygous mutants without exogenous genes derived therefrom in Example 6 of the present application Figure 5 A is the appearance phenotype of mature brown rice; Figure 5 B is the length of brown rice grain; Figure 5 C is the width of brown rice grain; Figure 5 D is the thickness of brown rice grain; Figure 5 E is the 100-grain weight of brown rice; Figure 5 F is the percentage of grains with chalkiness (PGWC) of brown rice; Figure 5 G is the area of chalky endosperm (ACE) of brown rice; Figure 5 H is the degree of endosperm chalkiness (DEC) of brown rice.
[0048] Figure 6 Starch iodine absorption spectrum and thermodynamic properties of wild type ZH11 and T2 homozygous mutants without exogenous genes derived therefrom in Example 6 of the present application Figure 6 A is the starch iodine absorption spectrum; Figure 6 B is the starch thermodynamic properties. DETAILED DESCRIPTION
[0049] In order to make the above objectives, features and advantages of the present application more obvious and easy to understand, the specific embodiments of the present application will be described in detail below in combination with the description examples.
[0050] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. However, it will be apparent to one skilled in the art that the present application can be practiced without the specific details set forth in this description. In other instances, well-known methods have not been described in detail in order not to unnecessarily obscure aspects of the present application.
[0051] Secondly, the "one embodiment" or "embodiment" referred to herein means a specific feature, structure, or characteristic that can be included in at least one implementation of the present application. The "in one embodiment" appearing in different places in the specification does not mean the same embodiment, nor is it an embodiment that is independent of or mutually exclusive with other embodiments.
[0052] The raw materials used in the present application are all commercially available unless otherwise specified.
[0053] The transformation receptor material selected in the present application is Zhonghua 11 (ZH11), which is a japonica conventional rice variety.
[0054] Example 1
[0055] Design of editing target of rice OsSBEIIb gene:
[0056] According to the OsSBEIIb gene sequence of japonica rice Nipponbare published in the NCBI database (http: / / www.ncbi.nlm.nih.gov / nuccore / AY 858 1 1.1), the OsSBEIIb gene has 22 exons and 21 introns. In order to obtain a mutant plant with changed starch components, the editing target was selected on the 21st exon. According to the editing characteristics of the CBE single base editing vector, the target sequence on the 21st exon was screened as AAATCCACCAAAGAGTCCAG, which is located at the 20th-39th base of the 21st exon (A). https: / / www.ncbi.nlm.nih.gov / Figure 1 Example 2
[0057] Construction of CBE single base editing vector:
[0058] The gene editing technology used in this embodiment is single base editing technology, and the vector structure is shown in B. The following oligonucleotides are synthesized according to the designed target sequence:
[0059] Figure 1 sgRNA-SBEIIb-F: 5'-TGTGTGAATCCACCAAAGAGTCCAG-3' (SEQ ID NO. 13);
[0060] sgRNA-SBEIIb-R: 5'-AAACCTGGACTCTTTGGTGGATTCA-3' (SEQ ID NO. 14);
[0061] sgRNA-SBEIIb-R: 5'-AAACCTGGACTCTTTGGTGGATTCA-3' (SEQ ID NO. 14); sgRNA-SBEIIb-R: 5'-AAACCTGGACTCTTTGGTGGATTCA-3' (SEQ ID NO. 14);
[0062] The synthesized primers sgRNA-SBEIIb-F and sgRNA-SBEIIb-R were dissolved with double distilled water, with a concentration of 10 μM stock solution. The dissolved primers were mixed in the following proportions: 8 μL double distilled water + 1 μL sgRNA-F + 1 μL sgRNA-R. Annealing reaction was performed to obtain double-stranded DNA fragments with adaptors. The CBE single base editing vector was digested with BsaI, and the digested linear vector fragment was recovered by agarose gel electrophoresis. The recovered vector was ligated with the annealed double-stranded DNA with sticky ends, and the ligation product was transformed into E. coli DH5α. Positive clones were identified and verified by sequencing to obtain the correctly constructed CBE-SBEIIb sgRNA vector.
[0063] Example 3
[0064] Agrobacterium-mediated genetic transformation of rice:
[0065] The medium formula in this example is shown in Table 1, and the transformation process is shown in Figure 2 .
[0066] 1. Callus induction: Mature brown rice of ZH11 was selected and sterilized with 75% ethanol (soaked for 1 min) and 3% NaClO (soaked for 30 min). After washing with sterile water and air-drying, it was placed on callus induction medium in a light incubator (16 h / 8 h light / dark, 28°C).
[0067] 2. Subculture: After about 28 days of callus culture, small yellowish callus particles were selected and transferred to subculture medium, and cultured for another 5-7 days under the same conditions.
[0068] 3. Agrobacterium transformation and infection: The successfully constructed editing vector was transformed into the EHA105 Agrobacterium strain, and positive colonies were selected after identification and shaken to OD600 of 0.6-0.8. Larger callus particles were selected from the subculture medium and placed in a 50 mL centrifuge tube. 15 mL of infection solution containing Agrobacterium was added (the volume of Agrobacterium solution added: V = 15*0.08 / OD600). The solution was discarded after 30 min of incubation in a 22°C dark incubator, and the callus was blown dry and transferred to co-culture medium pre-coated with a layer of filter paper, and incubated in a 22°C dark incubator for 2-3 days.
[0069] 4. Recovery: The callus was washed thoroughly with sterile water, and 40 mL of sterile water and 90 μL of 250 mg / mL carbenicillin were added to the centrifuge tube. After shaking for 30 min on a shaker, the callus was blown dry and transferred to recovery medium, and cultured in a light incubator (16 h / 8 h light / dark, 28°C) for 3-4 days.
[0070] 5. Screening: Pick compact large calli from recovery medium and transfer to 1st screening medium for 13-15 days; transfer all calli to 2nd screening medium for another 13-15 days.
[0071] 6. Differentiation: Pick up small yellowish calli scattered on screening medium or growing on blackened callus surface and transfer to differentiation medium for regeneration.
[0072] 7. Rooting: Pick up small green shoots with roots from differentiation medium, remove medium and transfer to rooting medium for further growth in artificial climate box.
[0073] Table 1. Medium formula for rice genetic transformation
[0074]
[0075] Example 4
[0076] T0 rice transformation plant target site mutation identification:
[0077] Take T0 rice transformation seedlings in Example 3, extract single plant leaf genomic DNA by CTAB method. DNA sample is positively detected by PCR using HPT amplification primers, and the amplification primers are:
[0078] HPT-F: 5'-CGAGAGCCTGACCTATTGCAT-3'(SEQ ID NO. 15);
[0079] HPT-R: 5'-CTGCTCCATACAAGCCAACCAC-3'(SEQ ID NO. 16)
[0080] To detect the mutation of the target site of the positive transgenic plants, the amplification primers were designed on both sides of the region to be edited, SBEIIb-PCR-F: 5'-CGTGCCCATTATGTTGACC-3'(SEQ ID NO. 11) and SBEIIb-PCR-R: 5'-AAAGCCGTTCACAGATTGCT-3'(SEQ ID NO. 12), and the amplified fragment was 499 bp. The PCR amplification system was 50 μL: template DNA 1 μL, upstream and downstream primers 2 μL each, 2 × Taq Master Mix 25 μL, ddH2O 20 μL. The amplification program was 95 °C for 5 min, (95 °C for 15 s, 55 °C for 15 s, 72 °C for 1 min for a total of 33 cycles), 72 °C for 7 min, and 16 °C for constant temperature. After the amplification product was identified by 1% agarose gel electrophoresis, it was entrusted to Nanjing Qikexi Biological Company for sequencing, and the sequencing results of the transgenic plants and wild type ZH11 were compared by using DNAMAN software to analyze the mutation type. The mutation of the 21st exon target site of the positive T0 transgenic plants (partially) is shown in Figure 3 As shown in the table, a total of 4 mutation forms were obtained: L-33 strain was a homozygous mutation of GG to AA at positions 34-35 of the 21st exon, corresponding to a G785K homozygous mutation of amino acid; L-45 strain was a homozygous mutation of G to A at position 35, corresponding to a G785E homozygous mutation of amino acid; L-79 strain was a double allelic mutation of GG to AA at positions 34-35 in one allele and G to A at position 34 in the other allele, corresponding to a G785K / R double allelic mutation of amino acid. L-97 strain was a double allelic mutation of GG to AA at positions 34-35 in one allele and GG to CA at positions 34-35 in the other allele, corresponding to a G785K / Q double allelic mutation of amino acid. All the detected mutant strains were propagated, and the T1 grains were collected from single plants.
[0081] Example 5
[0082] Screening and identification of T1 homozygous mutant strains without foreign genes
[0083] In order to screen the mutant strains without carrying foreign gene elements, the present application detected the foreign gene elements of the T1 plants of the 4 mutation forms identified in Example 4. The screening process is shown in Figure 4 As shown in the table, first, the genomic DNA of the T1 plants was extracted from single plants, and the HPT marker gene was preliminarily amplified by PCR in the first round using primers HPT-F (SEQ ID NO. 15) and HPT-R (SEQ ID NO. 16) for identification, and single plants with negative results were selected Figure 4A); further amplification of the single plants without HPT was performed in the second round, in which primer Cas9-F (SEQ ID NO. 17) and Cas9-R (SEQ ID NO. 18) were used to identify the Cas9 element, primer gRNA-F (SEQ ID NO. 19) and gRNA-R (SEQ ID NO. 20) were used to identify the gRNA element, primer Actin-F (SEQ ID NO. 21) and Actin-R (SEQ ID NO. 22) were used to amplify the Actin gene as an internal reference, and finally the single plants without HPT, Cas9 and gRNA elements were screened Figure 4 B).
[0084] In order to further obtain homozygous mutant strains without exogenous genes, the primer SBEIIb-PCR-F (SEQ ID NO. 11) and SBEIIb-PCR-R (SEQ ID NO. 12) were used to perform PCR amplification of the target site fragment of the single plants without HPT, Cas9 and gRNA elements again, and the company was sequenced. The sequencing results are shown in Figure 4 C, the present application obtained 4 kinds of homozygous mutants of OsSBEIIb gene without exogenous genes, including the 21st exon 34-35 GG mutation to AA, corresponding to the G785K homozygous mutation of amino acid, the mutation gene sequence is shown as SEQ ID NO. 3, and the mutant amino acid sequence is shown as SEQ ID NO. 4; the 35th G mutation to A, corresponding to the G785E homozygous mutation of amino acid, the mutation gene sequence is shown as SEQ ID NO. 5, and the mutant amino acid sequence is shown as SEQ ID NO. 6; the 34th G mutation to A, corresponding to the G785R homozygous mutation of amino acid, the mutation gene sequence is shown as SEQ ID NO. 7, and the mutant amino acid sequence is shown as SEQ ID NO. 8; the 34th-35th GG mutation to CA, corresponding to the G785Q homozygous mutation of amino acid, the mutation gene sequence is shown as SEQ ID NO. 9, and the mutant amino acid sequence is shown as SEQ ID NO. 10. The T1 homozygous mutant strains without exogenous genes were propagated and T2 seeds were collected.
[0085] The variation of the 34th-35th base GG of the 21st exon of the OsSBEIIb gene identified by the present application, and the four variations of the 785th glycine caused thereby are all reported for the first time.
[0086] Example 6
[0087] Analysis of mutant grain appearance quality, starch components and thermodynamic properties:
[0088] The four homozygous mutant T2 grains without exogenous genes obtained in Example 5 and wild type ZH11 mature brown rice were used to analyze the grain appearance quality and starch components and thermodynamic properties.
[0089] 1. Appearance quality of mutant grains
[0090] To compare the differences between the grain appearance quality of the mutants and the wild type ZH11, the appearance of the mature brown rice was observed under reflected light and transmitted light, and the results are shown in Figure 5 As shown in A, the grains of the wild type ZH11 were transparent, while the four mutants contained transparent, chalky and chalky grains. Further, 100 brown rice grains were randomly selected to measure the weight per 100 grains, 30 brown rice grains were selected to measure the grain length and width with the automatic grain measuring instrument, and the grain thickness was measured with a vernier caliper. It was found that the grain length of the mutants did not change significantly compared with ZH11 Figure 5 B), while the grain width, thickness and weight of the mutants were reduced to different degrees Figure 5 C, D, E). To further compare the chalky traits of the mutants, 100 brown rice grains were selected for scanning analysis with the automatic grain measuring instrument, and the results showed that the chalky grain rate (PGWC), chalky area / chalky size (ACE) and chalkiness degree (DEC) of the mutants were increased to different degrees Figure 5 F, G, H). The above results show that the mutants G785E, G785Q, G785K and G785R have different grain appearance qualities and are different from the wild type ZH11.
[0091] 2. Starch components of the mutants
[0092] The starch components of the mutants were first analyzed by iodine colorimetry, as follows:
[0093] (1) 10 mg of starch was weighed into a glass tube, 5 mL of 10% dimethyl sulfoxide solution containing 6M urea (UDMSO) was added, and vortexed at the same time, and then placed in a 95°C water bath for incubation for 1 h.
[0094] (2) The glass tube was removed and cooled at room temperature, a small amount of ddH2O was added to a 50 mL volumetric flask, 1 mL of sample solution (blank control added with 1 mL of UDMSO) and 1 mL of 0.2% iodine solution were taken, and ddH2O was used to make up the volume.
[0095] (3) After mixing, the solution was reacted for 15 min in the dark, and then scanned with a full wavelength spectrophotometer, with a scanning range of 400-900 nm. The experiment was repeated three times.
[0096] Because amylose and amylopectin have different iodine affinity and molecular weight distribution, amylose and amylopectin will produce different iodine absorption spectrum. The iodine absorption spectrum of starch can be further converted into starch molecular structure parameters: maximum absorption wavelength (λ max ), iodine blue value (absorbance at 680 nm), OD620 / 550 and apparent amylose content AAC. λ max Generally related to the average chain length of starch; iodine blue value reflects the affinity of starch and iodine; OD620 / 550 reflects the relative content of long chain in starch; AAC reflects the degree of absorption of amylose and part of amylopectin long side chain to iodine, which is usually calculated by the absorbance of iodine absorption spectrum at 620 nm.
[0097] Further, the present application uses the amylose / amylopectin detection kit of Megazyme Company in Ireland to determine the amylose content of the mutants. ConA can specifically bind to amylopectin and form a precipitate, and the measured amylose content (AC) is the percentage of amylose in the total amount of amylose and amylopectin, so the measured value is the true amylose content.
[0098] The measured starch iodine absorption spectrum of the present application is shown in Figure 6 A, and the amylose content and the converted starch molecular structure parameters are shown in Table 2. The results show that the four mutants have different starch iodine absorption characteristics compared with wild type ZH11. Compared with wild type ZH11, the OD550, OD620, OD680, AAC and AC of mutants G785E, G785Q, G785K and G785R are different degrees of increase; in addition, the λ max and OD620 / 550 of the four mutants are also significantly different compared with ZH11. The above results show that mutants G785E, G785Q, G785K and G785R have different starch components and are different from wild type ZH11.
[0099] Table 2 Starch iodine absorption spectrum parameters and amylose content
[0100]
[0101] Note: The data in the table are mean ± standard deviation, and the data with different letters in the same column are significantly different (p<0.05). AAC: apparent amylose content; AC: amylose content.
[0102] 3. Thermodynamic properties of mutant starch
[0103] The starch thermodynamic properties of the mutants are further analyzed. 5 mg of starch is weighed in an aluminum crucible, 15 μL of ddH2O is added and mixed thoroughly, and then sealed and placed in a 4°C refrigerator overnight. The starch thermodynamic properties are determined by a differential scanning calorimeter (DSC) (200-F3, Netzsch, Germany), with a heating range of 20-140°C and a rate of 10°C / min. The starch DSC spectrum is as shown in Figure 6 B, and the starch thermodynamic parameters are shown in Table 3. The results show that the gelatinization temperatures of the mutants G785E, G785Q, G785K and G785R are significantly higher than that of wild type ZH11. It is indicated that the four mutants have different thermodynamic properties from wild type ZH11.
[0104] Table 3 Starch thermodynamic parameters
[0105]
[0106] Note: The data in the table are mean ± standard deviation, and the data with different letters in the same column are significantly different (p<0.05). To: gelatinization onset temperature; Tp: gelatinization peak temperature; Tc: gelatinization termination temperature; ΔT: gelatinization temperature range (Tc-To); ΔH: gelatinization enthalpy.
[0107] In summary, by single base gene editing technology, the present application causes the mutation of the 34th-35th base of the 21st exon of the OsSBEIIb gene, and the substitution of the 785th glycine of the protein, including four mutant forms of G785E, G785Q, G785K and G785R. Compared with wild type ZH11, the starch components and starch thermodynamic properties of several mutants are significantly changed, and have different application potentials.
[0108] The present application first uses single base gene editing technology to perform site-directed editing on the OsSBEIIb gene, and successfully obtains four new allelic mutants with single amino acid substitution and changed starch components, providing a new idea for rapidly improving the starch components and functional properties of rice by using single base gene editing technology.
[0109] It should be noted that the above examples are only used to illustrate the technical solutions of the present application and not to limit the present application. Although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced equivalently without departing from the spirit and scope of the technical solutions of the present application, and they should be covered in the scope of the claims of the present application.
Claims
1. Oryza sativa OsSBEIIb a gene mutant characterized in that: comprising, From the genus *Oryza* ( Oryza L. ),Depend on OsSBEIIb The 785th amino acid G of the OsSBEIIb protein encoded by the gene is mutated to one of K, E, R, or Q; The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO.
2. OsSBEIIb The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO.
2. The nucleotide sequence of the amino acid G mutated to K is shown in SEQ ID NO. 3, and the amino acid sequence is shown in SEQ ID NO.
4. The nucleotide sequence of the amino acid G mutated to E is shown in SEQ ID NO. 5, and the amino acid sequence is shown in SEQ ID NO.
6. The nucleotide sequence of the amino acid G mutated to R is shown in SEQ ID NO. 7, and the amino acid sequence is shown in SEQ ID NO.
8. The nucleotide sequence of the amino acid G mutated to Q is shown in SEQ ID NO. 9, and the amino acid sequence is shown in SEQ ID NO.
10.
2. The rice plant of claim 1 OsSBEIIb Use of a gene mutant in improving starch components in rice, characterized in that: The improved rice starch component is to increase the content of amylose or increase the proportion of long side chains of amylopectin.
3. A rice plant comprising the water use efficiency gene of claim 1. OsSBEIIb A method for improving starch composition in rice by mutating a gene, characterized by: comprising, determining OsSBEIIb target sequence for gene site-directed editing; Constructing a single base editing vector containing the target fragment; Obtaining T0 transgenic rice plants: the single base editing vector is transformed into Agrobacterium EHA105, and T0 transgenic plants are obtained by Agrobacterium-mediated rice genetic transformation method; Identifying the mutation type of T0 transgenic rice plants: using primers amplifying the sequence of the target site SBEIIb -PCR-F and SBEIIb -PCR-R for mutation identification of T0 transgenic seedlings, the SBEIIb -PCR-F and SBEIIb The nucleotide sequences of -PCR-F and -PCR-R are shown in SEQ ID NO. 11 and SEQ ID NO. 12, respectively. Screening T1 mutant plants without exogenous genes; Again identifying the mutation type of T1 plants without exogenous genes and obtaining target gene homozygous mutant plants, which can be cultivated to obtain rice with improved starch component. The improved rice starch component is to increase the content of amylose or increase the proportion of long side chains of amylopectin.
4. The method of claim 3, wherein: The target sequence is 20-39 of the 21st exon of SEQ ID NO. 1 gene sequence.
5. The method of claim 4, wherein: Oligonucleotides designed to target sequences sgRNA - SBEIIb -F and sgRNA - SBEIIb - The nucleotide sequence of R is set forth in SEQ ID NO. 13 and SEQ ID NO.
14.
6. The method of claim 3, wherein: The single base editing vector comprises a CRISPR / Cas9-based cytosine base editor that targets OsSBEIIb genes.
7. The method of claim 3, wherein: The step of obtaining the transformed plant includes callus induction, subculture, infection, recovery, screening, differentiation, and rooting.
8. The method of claim 3, wherein: The exogenous gene comprises HPT a marker gene, Cas9 and gRNA an element.
Citation Information
Patent Citations
Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene
CN102816778A
Application of CRISPR / nCas9 mediated site-directed base substitution in plant
CN107043779A