A method for constructing a VIGS silencing system of Zizania latifolia ZlPDS gene and its product

Abstract

The invention discloses a method for constructing a VIGS silencing system of a Zizania latifolia ZlPDS gene and a product thereof, by constructing a foxtail mosaic virus (FoMV)-mediated gene silencing expression vector pFoMV-PDS plasmid containing a Zizania latifolia ZlPDS gene-specific fragment, and transforming Zizania latifolia by Agrobacterium-mediated method, inducing the silencing of a target gene ZlPDS, effectively reducing the expression level of the ZlPDS gene, being able to diffuse and propagate for a long time in Zizania latifolia plants, and causing the leaf to become white. The invention establishes a Zizania latifolia ZlPDS gene VIGS silencing system with high silencing efficiency in Zizania latifolia, which can be used to verify the function of the target gene, overcomes the difficulty of Zizania latifolia genetic transformation, simplifies the operation steps, and lays a foundation for studying the gene function of Zizania latifolia.

Description

Technical Field

[0001] The invention relates to a method for constructing a Zizania latifolia Z1PDS gene VIGS silencing system and a product thereof, belonging to the field of biotechnology. Background Art

[0002] Zizania latifolia is an important aquatic vegetable formed by the interaction of Zizania latifolia and Zizania smut. It is delicious and nutritious, and is deeply loved by the people. It has now become the second largest aquatic vegetable in my country. For a long time, people have been trying to explore the unique mechanism of Zizania latifolia in the process of producing Zizania. However, the molecular biology research on the mechanism of Zizania latifolia in the process of producing Zizania is still in its infancy. Although a series of differentially expressed proteins or genes have been obtained through multi-omics sequencing, subsequent research is only in the stage of simple functional verification using qRT-PCR. Since the genetic transformation system of Zizania latifolia is not yet mature, it is impossible to conduct further in-depth research, which seriously restricts the research on its gene function.

[0003] Virus induced gene silencing (VIGS) is an effective means for analyzing and studying plant gene functions. This technology can obtain gene-silenced plants without genetic transformation and can quickly and easily identify the functions of related genes. However, there is no report on the VIGS silencing system of Zizania latifolia genes. Therefore, it is urgent to establish a method for quickly verifying the function of Zizania latifolia genes, simplify the operation steps, shorten the verification time, and improve the accuracy of verification, which lays a foundation for studying the function of Zizania latifolia genes. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a method for constructing a silencing system that can effectively reduce the expression of Zizania latifolia ZlPDS gene and its products.

[0005] Technical solution: The present invention provides a method for constructing a VIGS silencing system of Zizania latifolia ZlPDS gene, comprising the following steps:

[0006] (1) connecting the ZlPDS forward-FoMV-int-ZlPDS reverse specific fragment to the linearized pFoMV plasmid to construct pFoMV-ZlPDS; the nucleotide sequence of the ZlPDS forward-FoMV-int-ZlPDS reverse specific fragment is shown in SEQ ID NO.13;

[0007] (2) pFoMV-ZlPDS was transformed into Agrobacterium, and inoculated into the central leaf of Zizania latifolia by friction inoculation method, and cultured for at least 20 days.

[0008] Furthermore, obtaining the ZlPDS forward-FoMV-int-ZlPDS reverse specific fragment in step (1) includes the following steps: using the ZlPDS forward specific fragment and the FoMV-int fragment as templates to amplify the ZlPDS forward-Arabidopsis int fragment; then using the ZlPDS forward-Arabidopsis int fragment and the ZlPDS reverse specific fragment as templates to amplify the ZlPDS forward-FoMV-int-ZlPDS reverse specific fragment; the nucleotide sequence of the ZlPDS forward specific fragment is shown in SEQ ID NO.3, the nucleotide sequence of the FoMV-int fragment is shown in SEQ ID NO.11, and the nucleotide sequence of the ZlPDS reverse specific fragment is shown in SEQ ID NO.6.

[0009] Furthermore, the nucleotide sequences of the primers used to amplify the ZlPDS forward-Arabidopsis int fragment are shown in SEQ ID NO.1 and SEQ ID NO.10; the nucleotide sequences of the primers used to amplify the ZlPDS forward-FoMV-int-ZlPDS reverse specific fragment are shown in SEQ ID NO.1 and SEQ ID NO.5.

[0010] Furthermore, the ZlPDS forward specific fragment is obtained by amplifying with Zizania latifolia cDNA as a template, and the nucleotide sequences of the primers used are shown in SEQ ID NOs. 1-2.

[0011] Furthermore, the FoMV-int fragment is obtained by using the nucleotide sequence of the Arabidopsis thaliana int fragment as a template, and the nucleotide sequences of the primers used are shown in SEQ ID NOs. 9-10.

[0012] Furthermore, the ZlPDS reverse specific fragment is obtained by amplifying with Zizania latifolia cDNA as a template, and the nucleotide sequences of the primers used are shown in SEQ ID NOs. 4-5.

[0013] Furthermore, the friction inoculation method described in step (2) comprises the following steps: injecting tobacco with Agrobacterium containing the pFoMV-ZlPDS plasmid, grinding the tobacco into juice after culturing for 4 to 6 days, gently wiping the 1 / 2 of the central leaf of Zizania latifolia with a brush, then wiping the transfer with the tobacco juice, and rinsing with clean water after 2 minutes.

[0014] Furthermore, the tobacco is cultured under conditions of 25° C. and 16h / 8h light / darkness.

[0015] Furthermore, the wild rice stem used for inoculation is at the 3-4 leaf stage.

[0016] Furthermore, the culture conditions of Zizania latifolia after inoculation are 25-28° C., 14h / 10h light / dark cycle, and a humidifier is used to maintain humidity at about 90% within 48 hours after inoculation, and then cultured at normal humidity after 48 hours.

[0017] The present invention also provides a Zizania latifolia ZlPDS gene VIGS silencing system constructed according to the above construction method.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and significant advantages: the present invention constructs a foxtail mosaic virus (FoMV)-mediated gene silencing expression vector pFoMV-PDS plasmid containing a specific fragment of the Zizania latifolia ZlPDS gene, and transforms Zizania latifolia by Agrobacterium-mediated method, thereby inducing silencing of the target gene ZlPDS, effectively reducing the expression level of the ZlPDS gene, and being able to diffuse and spread for a long time in Zizania latifolia plants, and causing the leaves to become white. The present invention establishes a Zizania latifolia ZlPDS gene VIGS silencing system with high silencing efficiency in Zizania latifolia, which can be used to verify the function of the target gene, overcomes the difficulty of Zizania latifolia genetic transformation, simplifies the operation steps, and lays a foundation for studying the gene function of Zizania latifolia. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the electrophoresis diagram of pFoMV agrobacterium injection method to infect wild rice stem, M: DL2000 DNA Marker; 1: Control; 2: wild rice stem injected with pFoMV agrobacterium;

[0020] Figure 2 This is the flow chart of the pFoMV Agrobacterium friction inoculation method, A. pFoMV Agrobacterium injection into tobacco; B. Grinding to obtain tobacco juice containing FoMV virus; C. Inoculating wild rice stem with tobacco juice containing pFoMV; D. Cleaning the bacterial solution;

[0021] Figure 3 Electrophoretic diagrams to verify the infection of wild rice with pFoMV by Agrobacterium tumefaciens. A. Tobacco infected with pFoMV by Agrobacterium tumefaciens; B. Wild rice infected with tobacco juice containing FoMV;

[0022] Figure 4 Screening for the appropriate seedling age of wild rice plants infected with pFoMV Agrobacterium, A. Survival rate; B. Inoculation rate; Control is wild rice rubbed with clean water;

[0023] Figure 5Electrophoresis diagram for the construction of pFoMV-ZlPDS recombinant plasmid, A. ZlPDS specific forward fragment and reverse fragment, 1. ZlPDS specific forward fragment, 2. ZlPDS specific reverse fragment; B. ZlPDS specific forward-reverse fragment; C. FoMV-int fragment; D. ZlPDS forward-FoMV-int fragment; E. ZlPDS forward-FoMV-int-ZlPDS reverse fragment; F. pFoMV plasmid linearization; G. pFoMV-ZlPDS recombinant plasmid verification; H. verification of Agrobacterium infection of tobacco containing pFoMV-ZlPDS; M: AE, G, H represent DL2000 DNA Marker; M in F represents: DL15000 DNA Marker;

[0024] Figure 6 Figure 4. FoMV-mediated silencing of the ZlPDS gene in Zizania latifolia. A. Analysis of the expression of ZlPDS 20 and 40 days after inoculation with FoMV-ZlPDS. The control was Zizania latifolia inoculated with Agrobacterium containing the empty vector of pFoMV. B. Phenotype of Zizania latifolia 40 days after inoculation with FoMV-ZlPDS. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0026] Example 1 Construction method of Zizania latifolia Z1PDS gene VIGS silencing system

[0027] 1. Study on the infectivity of pFoMV to Zizania latifolia

[0028] (1) Cultivation of wild rice stem plants

[0029] When the wild rice seedlings grow to 20-30 cm, they are dug out with a knife, divided into small mounds of 3-4 seedlings, and the leaves are cut off, transplanted into plastic flower pots (diameter × height = 16 cm × 15 cm), placed in a greenhouse for cultivation, and cultured to the 2-leaf stage, 3-leaf stage and 4-leaf stage for use. The culture temperature is 25°C light / 18°C dark, and the photoperiod is 14h light / 10h dark.

[0030] (2) pFoMV Agrobacterium transformation

[0031] Add 5 μL of pFoMV-sg vector (containing FoMV virus backbone vector pFoMV, patent application number for the vector: 2017103044791) to the EP tube containing 100 μL of Agrobacterium GV3101 competent cells, mix well, and place on ice for 10 min, liquid nitrogen for 5 min, 7°C water bath for 5 min, and ice bath for 5 min. Then add 600 μL of LB liquid medium without antibiotics, shake and culture at 200 rpm, 28°C for 2-3 hours, and evenly spread the bacterial solution on the LB medium plate containing Rif+Kan (20 μg / mL Rif, 50 μg / mL Kan) resistance, and culture at 28°C for 2-3 days.

[0032] (3) Study on the method of infecting Zizania macrophylla with pFoMV Agrobacterium

[0033] (3.1) Injection method

[0034] Use a 1mL disposable syringe to inject the growing point of the 3-leaf stage Zizania latifolia until the bacterial solution flows out. After inoculation, the Zizania latifolia plants are placed at 25-28°C, 14h / 10h light / dark cycle, and the humidity is maintained at about 90% in a humidifier within 48h after inoculation, and then cultured at normal humidity. 20 days after inoculation, RNA extraction reagent RNAiso Plus (Takara) was used to extract RNA from the new leaves of Zizania latifolia, and reverse transcribed into cDNA using the TransScripts One-Step gDNA Removaland cDNA Synthesis SuperMix (TransGen) kit, and the reaction program was: 25°C 10min; 42°C 15min; 85°C 5s. RT-PCR verification was performed using pFoMV forward primer (pFoMVF) SEQ ID NO.19: 5'-GGTGCGTTCGGTGC TTCGTTGT-3' and pFoMV reverse primer (pFoMVR) SEQ ID NO.20: 5'-AGCAGAAGGCAC TCACCATTCA-3, amplification system: 2×easyTag PCRSuperMix 10μL, pFoMVF and pFoMVR 1μL each, cDNA 1μL, ddH 2 O to 20 μL. The reaction procedure was 95℃ for 3 min, then 95℃ for 30 s, 56℃ for 30 s, 72℃ for 1 min for a total of 35 cycles, and 72℃ for 10 min. The amplified fragment size was 541 bp. It was found that there was no target band in the wild rice plants inoculated by injection, indicating that this method cannot be used for FoMV inoculation of wild rice ( Figure 1 , the control was wild rice stem injected with water).

[0035] (3.2) Friction method

[0036] ① Inoculate the single colony containing pFoMV into 20 mL of LB liquid medium containing 20 μg / mL Rif and 50 μg / mL Kan, and place it in a shaker at 200 rpm and 28 °C for 12 h of shaking culture; centrifuge at 5000 rpm for 15 min to collect the bacterial cells, and resuspend them with a buffer containing 10 mM MgCl 2 , 10 mM MES and 200 μM acetosyringone, with an OD600 of about 1.5, and place it in the dark at room temperature for 3 - 4 h.

[0037] ② Select Nicotiana benthamiana plants at the 6 - 8 leaf stage with good growth. Inject the back of the tobacco with the Agrobacterium suspension containing pFoMV until the bacterial liquid flows out. Place the injected tobacco in a greenhouse with a 16 h / 8 h (day / night) cycle for cultivation. After 5 days, extract the RNA from the injected tobacco leaves, reverse transcribe it into cDNA, and perform RT - PCR verification using pFoMV F and pFoMV R as primers. The amplified fragment size is 541 bp ( Figure 3 ).

[0038] ③ Put the tobacco leaves containing FoMV (i.e., the tobacco leaves from which the target fragment can be amplified after injection) into a mortar containing sterile water, add a little quartz sand and grind it into a juice - like state; select Zizania latifolia plants at the 2 - leaf stage, 3 - leaf stage and 4 - leaf stage respectively. At the 1 / 2 of the central leaf, first gently wipe it with a brush, and then dip it in the tobacco juice and wipe it for transfer. After 2 min, rinse it with water. Repeat three times for each stage with 50 plants each, and use normal Zizania latifolia plants inoculated with water as a control. The above flow chart is shown in Figure 2 .

[0039] ④ After inoculation, place the Zizania latifolia plants at 25 - 28 °C, with a 14 h / 10 h light / dark cycle. Keep the humidity at about 90% with a humidifier within 48 h after inoculation, and then cultivate them under normal humidity. After 20 days of inoculation, it is found that the survival rate and inoculation rate are different at different leaf stages. Among them, after inoculation of Zizania latifolia at the 3 - leaf stage and 4 - leaf stage, they can survive, and the survival rates are both above 60%, and the inoculation rates are 63% and 64.5% ( Figure 4 A), while all the Zizania latifolia plants at the 2 - leaf stage died ( Figure 4 B). It shows that Zizania latifolia plants at the 3 - leaf stage and 4 - leaf stage can be infected by the FoMV virus.

[0040] ⑤ After 20 days of inoculation, extract the RNA from the newly grown leaves of Zizania latifolia inoculated at the 3 - leaf stage, reverse transcribe it into cDNA, and perform RT - PCR verification using pFoMVF and pFoMV R primers to amplify the FoMV fragment, as shown in Figure 3 B. Among them, M: DL2000 DNA Marker; 1: Zizania latifolia infected with the tobacco juice containing FoMV; 2: control. It shows that the FoMV virus has infectivity to Zizania latifolia and can be inoculated into Zizania latifolia by the friction inoculation method.

[0041] 2. FoMV-mediated silencing of Zizania latifolia ZlPDS gene

[0042] (1) Obtaining the pFoMV-ZlPDS recombinant plasmid

[0043] (1.1) Obtaining the forward-specific and reverse-specific fragments of ZlPDS Obtaining the forward-specific fragment of ZlPDS: Primers were designed using the full-length nucleotide sequence of the Zizania latifolia ZlPDS gene (GenBank: PP196468.1) as a template. To facilitate connection, a 15-20 bp linker primer from the FoMV vector was added to both ends of the forward and reverse primers. Primers ZlPDS F1 (SEQ ID NO. 1): 5'-GCGTCTCGAGGCGCGCCGTTAACC CAAGGTTCTGAAGTACCA-3' and ZlPDS R1 (SEQ ID NO. 2): 5'-CAGAATTCCT CGAGGGGCACAAAGCTTCCCAGAT-3' were designed. RNA was extracted from Zizania latifolia leaves and reverse transcribed to obtain Zizania latifolia cDNA; Zizania latifolia cDNA was used as a template, SEQ ID NO.1 and SEQ ID NO.2 were used as primers, and the reaction system was 2×EasyTaq PCR SuperMix 10 μL; 1 μL of each primer; 1 μL of cDNA as a template; RNase Free ddH 2 O 7μL, amplification program is 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 10min. Amplify 223bp ZlPDS gene specific forward fragment, such as Figure 5 A, wherein 1: ZlPDS specific forward fragment. The nucleotide sequence of the ZlPDS gene forward specific fragment is shown in SEQ ID NO.3 (GCGTCTCGAGGCGCGCCGTTAACCCAAGGTTCTGAAGTACCATGTTGTGAA GACACCAAGGTCCGTTTACAAGACCATCCCGGACTGCGAACCTTGCCGACCTCCGCAAAGATCACCGATTGAAGGGTTTTATCTGGCTGGTGACTACACAAAGCAGAAATACCTGGCTTCCATGGAGGGTGCGGTTTTATCTGGGAAGCTTTGTGCCCCTCGAGGAATTCTG).

[0044] Obtaining ZlPDS reverse specific fragment: The nucleotide sequence of the full-length Zizania latifolia ZlPDS gene was used as a template to design primers. To facilitate connection, a 15-20 bp linker primer on the FoMV vector was added to both ends of the forward primer and the reverse primer, respectively. The primers ZlPDS F2 (SEQ ID NO.4): 5'-CAAGCTTACGCGTGGGCACAAAGCTTCCCAGATA-3' and ZlPDS R2 (SEQ ID NO.5): 5'-GGGTCGAGTGG CGCGCCACTAGTCCAAGGTTCTGAAGTACCATGT-3' were designed. RNA was extracted from Zizania latifolia leaves and reverse transcribed to obtain Zizania latifolia cDNA; Zizania latifolia cDNA was used as a template and SEQ ID NO.4 and SEQ ID NO.5 were used as primers to amplify a 222 bp ZlPDS gene specific reverse fragment, such as Figure 5 A, wherein 2: ZlPDS specific reverse fragment. The nucleotide sequence of the Zl PDS gene reverse specific fragment is shown in SEQ ID NO.6 (CAAGCTTACGCGTGGGCAC AAAGCTTCCCAGATAAAACCGCACCCTCCATGGAAGCCAGGTATTTCTGCTTTGTGTAGTCACCAGCCAGATAAAACCCTTCAATCGGTGATCTTTGCGGAGGTCGGCAAGGTTCGCAGTCCGGGATGGTCTTGTAAACGGACCTTGGTGTCTTCACAACATGGTACTTCAGAACCTTGGACTAGTGGCGCGCCACTCGACCC).

[0045] (1.2) Obtaining the siRNA stem-loop structure required for FoMV virus-mediated silencing of the endogenous ZlPDS gene of Zizania latifolia:

[0046] Method 1: Obtaining ZlPDS forward-ZlPDS reverse specific fragment: Using ZlPDS forward specific fragment SEQ ID NO.3 and ZlPDS reverse specific fragment SEQ ID NO.6 as templates, primers ZlPDS F1 and ZlPDS R2 were used to amplify ZlPDS forward-ZlPDS reverse specific fragment by fusion PCR to construct the siRNA stem-loop structure required for FoMV virus-mediated silencing of endogenous ZlPDS gene in Zizania latifolia. The expected nucleotide sequence of ZlPDS forward+ZlPDS reverse specific fragment is 445 bp, such as SEQ ID NO.7 (GCGTCTCGAGGCGCGCCGTTAACCC AAGGTTCTGAAGTACCATGTTGTGAAGACACCAAGGTCCGTTTACAAGACCATCCCGGACTGCGAACCTTGCCGACCTCCGCAAAGATCACCGATTGAAGGGTTTTATCTGGCTGGTGACTACACAAAGCAGAAATACCTGGCTTCCATGGAGGGTGCGGTTTTATCTGGGAAGCTTTGTGCCCCTCGAGGAATTCTGCAAGCTTACGCGTGGGCACAAAGCTTCCCAGATAAAACCGCACCCTCCATGGAAGCCAGGTATTTCTGCTTTGTGTAGTCACCAGCCAGATAAAACCCTTCAATCGGTGATCTTTGCGGAGGTCGGCAAGGTTCGCAGTCCGGGATGGTCTTGTAAACGGACCTTGGTGTCTTCACAACATGGTACTTCAGAACCTTGGACTAGTGGCGCGCCACTCGACCC). Due to the short loop, it is difficult to obtain the expected ZlPDS forward + ZlPDS reverse specific fragment, and there is no target band, such as Figure 5 B. Further use of the method of artificially synthesizing ZlPDS forward + ZlPDS reverse nucleotide fragments also encountered a similar problem, and the designed 445 bp nucleotide fragment could not be synthesized.

[0047] Method 2: In order to successfully construct the siRNA stem-loop structure required for FoMV virus-mediated silencing of endogenous genes in Zizania latifolia, a 159 bp Arabidopsis int fragment was designed and introduced to form the stem-loop structure loop. The experimental steps are to first amplify the int fragment, and then obtain the ZlPDS forward-Arabidopsis int-ZlPDS reverse fragment by fusion PCR. The specific method is as follows:

[0048] Obtaining the Arabidopsis int fragment: The loop in the siRNA stem-loop structure required for FoMV virus-mediated Zizania endogenous gene silencing is composed of a 159 bp Arabidopsis int fragment, and the nucleotide sequence is shown in SEQ ID NO.8 (GATTACGTAAG TAGATCTTAAACACCTACACCATTTTTTTAATCACTACTACCCATTGCATTGAACAA ACTTCAAGTTCTTCTTAGCTTCAGATTAAGAAAGTACCCTTCCTTGGCTTTGTTGAT GTGGTACCATTGTCCATTGTCTTGTGTGTTTGCA). Using the nucleotide sequence of Arabidopsis thaliana int fragment (GenBank: U27981.1) as a template, in order to facilitate connection, the linker sequences of the forward fragment and reverse fragment of the above-mentioned ZlPDS gene were added when designing specific primers: At-int F1 (SEQ ID NO.9): 5'-CTCGAGGA ATTCTGGATTACGTAAGTAGATCTTAAACACC-3' and At-int R1 (SEQ ID NO.10): 5'-ACGCGTAAGCTTGTGCAAACACACAAGACAATGG-3'. Using Zizania latifolia cDNA as a template, SEQ ID NO.9 and SEQ ID NO.10 as primers, the amplified fragment size was 186 bp, as shown in FIG. Figure 5 C and named FoMV-int, and its nucleotide sequence is shown in SEQ ID NO.11 (CTCGAGGAATTCTGGATTACGT AAGTAGATCTTAAACACCTACACCATTTTTTTAATCACTACTACCCATTGCATTGAA CAAACTTCAAGTTCTTCTTAGCTTCAGATTAAGAAAGTACCCTTCCTTGGCTTTGTTGATGTGGTACCATTGTCCATTGTCTTGTGTGTTTGCACAAGCTTACGCGT).

[0049] The ZlPDS forward-FoMV-int-ZlPDS reverse specific fragment was obtained by using ZlPDS forward specific fragment SEQ ID NO.3 and FoMV-int fragment SEQ ID NO.11 as templates, primers ZlPDS F1 and At-int R1, and fusion PCR was used to amplify the ZlPDS forward-Arabidopsis int fragment, which was 395 bp in size. Figure 5As shown in D, the nucleotide sequence is as SEQ ID NO.12 (GCGTCTCGAGGCGCGCCGTTAACCCAAGGTTCTGAA GTACCATGTTGTGAAGACACCAAGGTCCGTTTACAAGACCATCCCGGACTGCGAACCTTGCCGACCTCCGCAAAGATCACCGATTGAAGGGTTTTATCTGGCTGGTGACTACACAAAGCAGAAATACCTGGCTTCCATGGAGGGTGCGGTTTTATCTGGGAAGCTTTGTGCCCCTCGAGGA ATTCTGGATTACGTAAGTAGATCTTAAACACCTACACCATTTTTTTAATCACTACTACCCATTGCATTGAACAAACTTCAAGTTCTTCTTAGCTTCAGATTAAGAAAGTACCCTTCCTTGGCTTTGTTGATGTGGTACCATTGTCCATTGTCTTGTGTGTTTGCACAAGCTTACGCGT). Using ZlPDS forward-Arabidopsis int fragment SEQ ID NO.12 and ZlPDS reverse specific fragment SEQ ID NO.6 as templates, primers ZlPDS F1 and ZlPDS R2 were used to amplify the ZlPDS forward-FoMV-int-ZlPDS reverse specific fragment by fusion PCR, with a size of 604 bp. Figure 5 E, the nucleotide sequence is shown in SEQ ID NO.13

[0050] shown.

[0051] Obtaining the linearized fragment of pFoMV: The pFoMV vector plasmid was digested with restriction endonuclease Asc I. The digestion system was: 10×QuickCut Buffer 2μL, AscI 1μL, pFoMV 2μL, ddH 2 O 15 μL, react at 37 °C for 30 min, and use FastPure Gel DNA Extraction Mini Kit (Vazyme) to recover the linearized vector fragment. Figure 5 As shown in F.

[0052] The ZlPDS forward-FoMV-int-ZlPDS reverse specific fragment was connected to the linearized plasmid of pFoMV containing the Fo MV virus backbone by homologous recombination technology to construct the recombinant viral vector pFoMV-ZlPDS. The competent E. coli DH5α (100 μL) was mixed with the recombinant viral vector pFoMV-ZlPDS (20 μL), placed on ice for 30 minutes, and then quickly placed on ice for 2 minutes after being placed in a 42°C water bath for 45 seconds. 700 μL of LB culture medium was added to the tube, and the culture was shaken at 37°C and 180 rpm for 1 hour. Finally, the bacterial solution was spread on an LB medium plate containing 50 μg / mL Kan resistance and cultured at 28°C for 2 days. Pick a single colony transformed with the recombinant plasmid and place it in a 1.5 mL EP tube containing LB culture medium with Kan resistance. Shake and culture for 8-10 hours. Use pFoMVF and At-int R1 as primers to amplify a 664 bp fragment. Verify the correct bacterial solution and extract the plasmid to obtain the pFoMV-ZlPDS plasmid. Figure 5 As shown in G.

[0053] (2) pFoMV-Z1PDS inoculation with Zizania latifolia

[0054] Agrobacterium transformation: The recombinant viral vector pFoMV-ZlPDS plasmid was transformed into Agrobacterium GV3101 using the freeze-thaw method, spread on LB medium plates containing Rif+Kan resistance, and cultured upside down at 28°C for 2 days to screen positive bacteria.

[0055] pFoMV-ZlPDS virus infection of tobacco: The positive single colony containing the pFoMV-ZlPDS plasmid after transformation was inoculated into LB liquid culture medium, and cultured in a shaker at 200 rpm and 28 °C for 12 h; the bacteria were collected by centrifugation at 5000 rpm for 15 min, and then washed with 10 mM MgCl 2 , resuspended in 10 mM MES and 200 μM acetosyringone buffer, OD 600 = 1.5, and place in the dark at room temperature for 3-4 hours. Then transform tobacco by injection. Grow at 25°C with a light / dark cycle of 16h / 8h for 4-6d, preferably 5d. Extract tobacco RNA, reverse transcribe into cDNA, and perform RT-PCR detection using pFoM VF and At-int R1 as primers. The infection of FoMV-ZlPDS in tobacco was detected by electrophoresis. The fragment sizes were 664bp, such as Figure 5 As shown in H.

[0056] Inoculation of Zizania latifolia plants with pFoMV-ZlPDS: Grind the tobacco containing the pFoMV-ZlPDS virus into juice, and inoculate the central leaves of Zizania latifolia at the 3-4 leaf stage through the friction inoculation method tested previously. Incubate at 25-28°C, 14h / 10h light / dark cycle, and maintain humidity at about 90% in a humidifier within 48h after inoculation, and then culture at normal humidity.

[0057] Identification of FoMV-mediated silencing effect of Zizania latifolia ZlPDS gene: RNA was extracted from the newly grown central leaves of Zizania latifolia at 20 and 40 days after inoculation, and reverse transcribed into cDNA. RT-PCR was performed with pFoMVF and At-int R1 as primers to detect whether pFoMV-ZlPDS had infected Zizania latifolia. RT-qPCR was then performed with ZlPDS F3 (SEQ ID NO.14): 5'-GTTAACCCAAGGTTCTGAAGTACCA-3' and ZlPDS R3 (SEQ ID NO.15): 5'-GGGCACAAA GCTTCCCAGAT-3' as primers to detect the expression level of ZlPDS. The Zizania abam Actin gene (SEQ ID NO.16) was used as the internal reference gene, and the specific primers were Actin F (SEQ ID NO.17): 5'-CGAGC TGCGTGTGGCACCTG-3' and Actin R (SEQID NO.18): 5'-CATTGCTGGGCAGTTG AAGG-3'. Zizania abam inoculated with Agrobacterium containing pFoMV empty vector was used as the control. The results showed that 20 days after inoculation, the expression level of ZlPDS gene in Zizania abam plants containing pFoMV-ZlPDS decreased significantly, and the expression level was about 30% ( Figure 6 A). 40 days after inoculation, it was found that the leaves of Zizania latifolia plants inoculated with FoMV-ZlPDS showed obvious bleaching ( Figure 6 B). This indicates that the silencing system of Zizania latifolia phytoene dehydrogenase gene ZlPDS has been successfully constructed, and this system can be used to study the verification of Zizania latifolia gene function.

Claims

1. A kind of wild rice stem ZlUT The method for constructing a gene VIGS silencing system is characterized in that: The steps include: (1) ZlUT Positive-FoMV- int - ZlUT The reverse specific fragment was connected to the linearized pFoMV plasmid to construct pFoMV-ZlPDS; ZlUT Positive-FoMV- int - ZlUT The nucleotide sequence of the reverse heterosexual fragment is shown in SEQ ID NO. 13; (2) Transform pFoMV-ZlPDS into Agrobacterium tumefaciens and inoculate it into the central leaf of Zizania latifolia using the friction inoculation method.

2. wild rice stem according to claim 1 ZlUT The method for constructing a gene VIGS silencing system is characterized in that: As described in step (1) ZlUT Positive-FoMV- int - ZlUT The acquisition of reverse specific fragments includes the following steps: by ZlUT Forward specific fragment and FoMV- int The fragment was used as a template and amplified ZlUT Forward-Arabidopsis int fragment; ZlUT Forward-Arabidopsis int Fragments and ZlUT The reverse specific fragment was used as a template to amplify ZlUT Positive-FoMV- int - ZlUT Reverse specific fragment; ZlUT The nucleotide sequence of the forward specific fragment is shown in SEQ ID NO. 3, FoMV- int The nucleotide sequence of the fragment is shown in SEQ ID NO. 11, ZlUT The nucleotide sequence of the reverse specific fragment is shown in SEQ ID NO.

6.

3. Wild rice stem according to claim 2 ZlUT The method for constructing a gene VIGS silencing system is characterized in that: Amplification ZlUT Forward-Arabidopsis int The nucleotide sequences of the primers used for the fragments are shown in SEQ ID NO. 1 and SEQ ID NO. 10; ZlUT Positive-FoMV- int - ZlUT The nucleotide sequences of the primers used for the reverse specific fragment are shown in SEQ ID NO. 1 and SEQ ID NO.

5.

4. wild rice stem according to claim 2 ZlUT The method for constructing a gene VIGS silencing system is characterized in that: Said ZlUT Acquisition of forward specific fragments: Zizania latifolia cDNA was used as a template for amplification, and the nucleotide sequences of the primers used were shown in SEQ ID NO. 1~2.

5. Wild rice stem according to claim 2 ZlUT The method for constructing a gene VIGS silencing system is characterized in that: The FoMV- int Obtaining the fragment: The nucleotide sequence of the Arabidopsis thaliana int fragment was used as a template, and the nucleotide sequences of the primers used were shown in SEQ ID NOs. 9-10.

6. Wild rice stem according to claim 2 ZlUT The method for constructing a gene VIGS silencing system is characterized in that: Said ZlUT Obtaining the reverse specific fragment: Amplification was performed using Zizania latifolia cDNA as a template, and the nucleotide sequences of the primers used are shown in SEQ ID NOs. 4-5.

7. Wild rice stem according to claim 1 ZlUT The method for constructing a gene VIGS silencing system is characterized in that: The friction inoculation method described in step (2) comprises the following steps: injecting tobacco with Agrobacterium containing the pFoMV-ZlPDS plasmid, grinding the tobacco into juice after culturing for 4 to 6 days, gently wiping the 1 / 2 of the central leaf of Zizania latifolia with a brush, then wiping the transfer with the tobacco juice, and rinsing with clean water after 2 minutes.

8. Wild rice stem according to claim 7 ZlUT The method for constructing a gene VIGS silencing system is characterized in that: The wild rice stem used for inoculation is at the 3-4 leaf stage.

9. Wild rice stem according to claim 1 ZlUT The method for constructing a gene VIGS silencing system is characterized in that: The culture conditions of Zizania latifolia after inoculation were 25-28 ℃, 14 h / 10 h light / dark cycle, and the humidity was maintained at 90% in a humidifier within 48 hours after inoculation, and then cultured at normal humidity after 48 hours.

Images