Chimeric antigen receptor t cells targeting human dll3 and uses thereof
By using chimeric antigen receptor T cells prepared by combining highly efficient anti-DLL3 nanobodies with signal peptides, the problem of poor efficacy of existing treatments has been solved, and effective killing of various tumors has been achieved.
Patent Information
- Application Number
- CN202411039131.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-11
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2043-07-11
AI Technical Summary
The efficacy of existing chimeric antigen receptor T-cell therapies targeting human DLL3 still needs improvement.
A chimeric antigen receptor T cell targeting human DLL3 is provided, which uses a highly efficient anti-DLL3 nanobody as the antigen-binding domain and combines it with a signal peptide, hinge region, transmembrane region and signal transduction domain to prepare CAR-T cells.
The prepared CAR-T cells showed good anti-tumor activity and had significant killing effects on various tumors such as small cell lung cancer and neuroendocrine prostate cancer.
Smart Images

Figure CN118878683B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a chimeric antigen receptor T cell targeting human DLL3 and application thereof. BACKGROUND
[0002] Lung cancer is the disease with the highest number of global cancer deaths, which is mainly divided into two categories of small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). SCLC and NSCLC are two completely different diseases. SCLC is a high-grade neuroendocrine cancer, accounting for about 15% to 20% of all lung cancers, but its malignancy is higher than that of non-small cell lung cancer, and the available treatment is less. SCLC mainly occurs in smokers and former smokers, and the main clinical symptoms are cough, wheezing, dyspnea, hemoptysis, etc. Most patients have cancer cell metastasis to the contralateral lung, liver, brain, bone, adrenal gland and other parts at the first diagnosis, and the prognosis is abnormally poor. Most SCLC patients have good early efficacy after receiving cytotoxic drug combined with radiotherapy and chemotherapy, but this response is transient, and the median survival of patients is less than 2 years, and the metastatic patients only have about 1 year. Therefore, it is urgently needed for researchers to further study the epidemiology, pathogenesis, molecular pathways, cell pathways and new treatment methods of SCLC from the clinical and biological aspects, so as to provide a new direction for the treatment of SCLC.
[0003] Delta-like ligand 3 (DLL3) is a type I single transmembrane protein, which is one of the members of the Notch ligand family. Human DLL3 protein is composed of 618 amino acids, including a DSL domain (175-215 aa), six EGF-like repeat sequences (216-465 aa), a transmembrane domain (493-513 aa) and an intracellular domain (514-618 aa). The highly conserved DSL domain sequence at the N-terminal extracellular of DLL3 is a necessary structure for binding to the Notch receptor. Studies have shown that DLL3 is highly expressed in SCLC and other neural or neuroendocrine tumors, and is not expressed or expressed in small amounts (only expressed in the intracellular) in normal tissue cells. In particular, more than 80% of patients with SCLC have positive expression of DLL3 on the surface of cancer cells, while it is not expressed in normal tissues and paracancer tissues. This difference makes DLL3 a good target for targeted therapy.
[0004] Nanobody (Nb) is a natural antibody variable region (VHH) that exists in camelids and sharks, which lacks light chains and the first constant region of heavy chains. Nb is considered to be the smallest antibody molecule with the function of binding intact antigens currently discovered, which has an olive ball structure, a diameter of about 2.5 nm, a height of about 4 nm, and a molecular weight (15 kDa) of only 1 / 10 of the mass of a traditional IgG antibody molecule. Compared with other antibody fragments, Nb has high stability, good solubility, high affinity, strong specificity, easy coupling and easy modification, and the like. Based on the above characteristics, Nb is widely used in the diagnosis, treatment and scientific research of diseases.
[0005] Chimeric Antigen Receptor-T cell (CAR-T) as a new technology of tumor immunotherapy has made a breakthrough in the research of anti-tumor, especially in the treatment of various hematological malignancies, which has shown excellent curative effect, changed the treatment mode of hematological tumors and effectively promoted the development of other immunotherapies. CAR-T is a combination of a binding domain for tumor antigens and a co-stimulatory molecule domain expressed on the surface of T cells through genetic engineering technology. The antigen binding site on the surface of T cells can specifically recognize tumor antigens and initiate downstream signaling pathways, so that T cells are activated, proliferated and release perforin, granzyme, IL-2, IFN-gamma and TNF-alpha and other cytokines to kill tumor cells, so as to achieve the purpose of eliminating tumor cells.
[0006] At present, the forms of drugs under research for targeting DLL3 for the treatment of SCLC include monoclonal antibodies, ADCs, double antibodies, multiple antibodies, CAR-T and CAR-NK, but the curative effects still need to be improved.
[0007] In view of this, the present application is proposed. SUMMARY
[0008] The technical problem to be solved by the present application is that the treatment effect of the existing chimeric antigen receptor T cell targeting human DLL3 needs to be improved.
[0009] The technical solution of the present application to solve the above technical problem is to provide a chimeric antigen receptor T cell targeting human DLL3.
[0010] Firstly, the application provides an anti-DLL3 nanobody, which comprises a heavy chain variable region comprising CDR1, CDR2 and CDR3, wherein the amino acid sequence of the CDR1 is shown as SEQ ID NO:1, SEQ ID NO:5 or SEQ ID NO:9, the amino acid sequence of the CDR2 is shown as SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:10, and the amino acid sequence of the CDR3 is shown as SEQ ID NO:3, SEQ ID NO:7 or SEQ ID NO:11.
[0011] Further, the anti-DLL3 nanobody described above has the following characteristics: the amino acid sequence of the CDR1 is shown as SEQ ID NO:1, the amino acid sequence of the CDR2 is shown as SEQ ID NO:2, and the amino acid sequence of the CDR3 is shown as SEQ ID NO:3.
[0012] Or the amino acid sequence of the CDR1 is shown as SEQ ID NO:5, the amino acid sequence of the CDR2 is shown as SEQ ID NO:6, and the amino acid sequence of the CDR3 is shown as SEQ ID NO:7.
[0013] Or the amino acid sequence of the CDR1 is shown as SEQ ID NO:9, the amino acid sequence of the CDR2 is shown as SEQ ID NO:10, and the amino acid sequence of the CDR3 is shown as SEQ ID NO:11.
[0014] In the anti-DLL3 nanobody described above, a framework region is further included, and the structure of the VHH chain of the nanobody is FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
[0015] Further, in the anti-DLL3 nanobody described above, the amino acid sequence of the VHH chain of the nanobody is any one of SEQ ID NO:4, SEQ ID NO:8 or SEQ ID NO:12.
[0016] Further, in the anti-DLL3 nanobody described above, the amino acid sequence of the CDR1 is shown as SEQ ID NO:1, the amino acid sequence of the CDR2 is shown as SEQ ID NO:2, the amino acid sequence of the CDR3 is shown as SEQ ID NO:3, and the amino acid sequence of the VHH is shown as SEQ ID NO:4.
[0017] Or the amino acid sequence of the CDR1 is shown as SEQ ID NO:5, the amino acid sequence of the CDR2 is shown as SEQ ID NO:6, the amino acid sequence of the CDR3 is shown as SEQ ID NO:7, and the amino acid sequence of the VHH is shown as SEQ ID NO:8.
[0018] or the amino acid sequence of CDR1 is as shown in SEQ ID NO: 9, the amino acid sequence of CDR2 is as shown in SEQ ID NO: 10, the amino acid sequence of CDR3 is as shown in SEQ ID NO: 11, and the amino acid sequence of VHH is as shown in SEQ ID NO: 12.
[0019] The amino acid sequences of the antibodies are shown in Table 1 below.
[0020] Table 1 Amino acid sequences of antibodies
[0021]
[0022] Further, the anti-DLL3 nanobody is at least one of a monovalent nanobody, a multivalent nanobody or a fusion nanobody.
[0023] The application also provides a chimeric antigen receptor, the extracellular domain of which comprises the anti-DLL3 nanobody.
[0024] The chimeric antigen receptor further comprises a signal peptide, a hinge region, a transmembrane region and a signal transduction domain.
[0025] Further, the signal peptide comprises a CD8a signal peptide, the hinge region comprises a CD8a hinge region, the transmembrane region comprises a CD28 transmembrane domain, and the signal transduction domain comprises a CD3 zeta or 4-1BB intracellular region.
[0026] The application provides a CAR-T cell comprising the chimeric antigen receptor.
[0027] Further, the CAR-T cell comprises at least one of a universal CAR-T cell and an autologous CAR-T cell.
[0028] Further, the application also provides an isolated polynucleotide encoding the nanobody or the chimeric antigen receptor.
[0029] Further, the nucleotide sequence of the isolated polynucleotide is as shown in SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15.
[0030] The application also provides a recombinant vector comprising the isolated polynucleotide.
[0031] The application also provides a host cell comprising the recombinant vector.
[0032] The application also provides an immunoconjugate or a pharmaceutical composition comprising the anti-DLL3 nanobody or the chimeric antigen receptor.
[0033] Further, the application also provides a use of the anti-DLL3 nanobody, the chimeric antigen receptor, the CAR-T cell, the isolated polynucleotide and the host cell in the preparation of a drug for preventing, diagnosing or treating tumors.
[0034] Further, the tumors include at least one of small cell lung cancer, neuroendocrine prostate cancer, prostate cancer, melanoma, gastroenteropancreatic neuroendocrine tumor, metastatic castration-resistant prostate cancer, large cell neuroendocrine carcinoma, small cell bladder cancer, lung neuroendocrine tumor or glioblastoma multiforme.
[0035] The application has the following beneficial effects:
[0036] The application screens the anti-DLL3 nanobody with remarkable effect, and prepares the CAR-T cell by taking the anti-DLL3 nanobody as the antigen binding domain, so that the CAR-T cell has good anti-tumor activity and can be applied to the preparation of a drug for preventing or treating tumors such as small cell lung cancer, neuroendocrine prostate cancer, prostate cancer, melanoma, gastroenteropancreatic neuroendocrine tumor, metastatic castration-resistant prostate cancer, large cell neuroendocrine carcinoma, small cell bladder cancer, lung neuroendocrine tumor or glioblastoma multiforme, and has wide application. BRIEF DESCRIPTION OF DRAWINGS
[0037] Figure 1 is the detection of the titer of the anti-DLL3 antibody by indirect ELISA in the embodiment of the application;
[0038] Figure 2 is the detection of the expression and purification of the anti-DLL3-Nb by SDS-PAGE in the embodiment of the application;
[0039] Figure 3 is the analysis of the binding specificity of the anti-DLL3-Nb by indirect ELISA in the embodiment of the application;
[0040] Figure 4 is the analysis of the binding activity of the anti-DLL3-Nb and the DLL3 antigen by indirect ELISA in the embodiment of the application;
[0041] Figure 5 is the analysis of the binding specificity of the anti-DLL3-Nb and the DLL3-SHP-77 cell surface DLL3 by FACS in the embodiment of the application;
[0042] Figure 6 is a schematic diagram of the chimeric antigen receptor structure of the anti-DLL3 in the embodiment of the application;
[0043] Figure 7 is the detection of the expression efficiency of the anti-DLL3 CAR on the T cell surface in the embodiment of the application;
[0044] Figure 8 is the in vitro killing efficiency detection of the CAR-T cell to the DLL3-SHP-77 cell in the embodiment of the application. DETAILED DESCRIPTION
[0045] The application provides an anti-DLL3 nanobody, which comprises a heavy chain variable region comprising CDR1, CDR2 and CDR3, the amino acid sequence of the CDR1 heavy chain variable region is as shown in SEQ ID NO: 1, SEQ ID NO: 5 or SEQ ID NO: 9, the amino acid sequence of the CDR2 heavy chain variable region is as shown in SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 10, and the amino acid sequence of the CDR3 heavy chain variable region is as shown in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 11.
[0046] Further, the anti-DLL3 nanobody described above is as follows: the amino acid sequence of CDR1 is as shown in SEQ ID NO: 1, the amino acid sequence of CDR2 is as shown in SEQ ID NO: 2, and the amino acid sequence of CDR3 is as shown in SEQ ID NO: 3.
[0047] Or the amino acid sequence of CDR1 is as shown in SEQ ID NO: 5, the amino acid sequence of CDR2 is as shown in SEQ ID NO: 6, and the amino acid sequence of CDR3 is as shown in SEQ ID NO: 7.
[0048] Or the amino acid sequence of CDR1 is as shown in SEQ ID NO: 9, the amino acid sequence of CDR2 is as shown in SEQ ID NO: 10, and the amino acid sequence of CDR3 is as shown in SEQ ID NO: 11.
[0049] Further, in the anti-DLL3 nanobody described above, the VHH chain of the nanobody further comprises a framework region, and the structure of the VHH chain of the nanobody is as follows: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
[0050] Further, in the anti-DLL3 nanobody described above, the amino acid sequence of the VHH chain of the nanobody is any one of SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 12.
[0051] Further, in the anti-DLL3 nanobody described above, the amino acid sequence of CDR1 is as shown in SEQ ID NO: 1, the amino acid sequence of CDR2 is as shown in SEQ ID NO: 2, the amino acid sequence of CDR3 is as shown in SEQ ID NO: 3, and the amino acid sequence of VHH is as shown in SEQ ID NO: 4.
[0052] or the amino acid sequence of CDR1 is as shown in SEQ ID NO: 5, the amino acid sequence of CDR2 is as shown in SEQ ID NO: 6, the amino acid sequence of CDR3 is as shown in SEQ ID NO: 7, and the amino acid sequence of VHH is as shown in SEQ ID NO: 8;
[0053] or the amino acid sequence of CDR1 is as shown in SEQ ID NO: 9, the amino acid sequence of CDR2 is as shown in SEQ ID NO: 10, the amino acid sequence of CDR3 is as shown in SEQ ID NO: 11, and the amino acid sequence of VHH is as shown in SEQ ID NO: 12.
[0054] Further, the nanobody is at least one of a monovalent nanobody, a multivalent nanobody or a fusion nanobody.
[0055] Further, the antibody can be any one of a heavy chain antibody, a chimeric antibody, a multispecific antibody, a humanized antibody or an antigen binding fragment.
[0056] The application also provides a chimeric antigen receptor, the extracellular domain of which comprises the above-mentioned anti-DLL3 nanobody.
[0057] The chimeric antigen receptor further comprises a signal peptide, a hinge region, a transmembrane region and a signal transduction domain.
[0058] Further, the signal peptide comprises a CD8α signal peptide, the hinge region comprises a CD8α hinge region, the transmembrane region comprises a CD28 transmembrane domain, and the signal transduction domain comprises a CD3ζ or 4-1BB intracellular region.
[0059] The "chimeric antibody" of the application is an antibody in which the variable region of a non-human antibody is fused with the constant region or the framework region of a human antibody, so as to reduce the immune response induced by the non-human antibody.
[0060] The application provides a CAR-T cell comprising the above-mentioned chimeric antigen receptor.
[0061] Further, the CAR-T cell comprises at least one of a universal CAR-T cell and an autologous CAR-T cell.
[0062] Further, the application also provides an isolated polynucleotide encoding the above-mentioned nanobody or chimeric antigen receptor.
[0063] Further, the nucleotide sequence of the isolated polynucleotide is as shown in SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15.
[0064] SEQ ID NO: 13 is the nucleotide sequence encoding the antibody Nb15
[0065] CAGGTGCAGCTGCAGGAGTCTGGGGGAGATAGCGTGCAGGCGGGCGGCAGCCTGCGCCTGAGCTGCGCGGCGAGCGGCTTTGATGAACTGAGCTATAGCTGGTTTCGCCAGGCGCCGGGCAAAGGCCTGGAATGGGTGAGCGGCATTGATAGCCAGGGCGATGTGCCGGAAAGCAAATATGCGGAAAGCGTGAACGGCCGCTTTACCATTAGCCAGGATGATGCGAAATATACCGTGTATCTGCGCATGAACAACCTGAAACCGGAAGATACCGCGGTGTATACCTGCGCGGCGCGCAGCACCTGGGATGTGGATAGCTTTTGCCATCGCATTAGCGCGTTTACCTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCG.
[0066] SEQ ID NO: 14 nucleotide sequence encoding antibody Nb63
[0067] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCAGCGTGCAGACCGGCGGCAGCCTGCGCGTGAGCTGCGCGTGCAGCAAATTTAACCGCGTGCATTATACCTGGTTTCGCCAGGCGCCGGGCAAAGAACGCGAAGGCGTGAGCTTTATTTATCGCGGCTTTAGCACCCTGTATGCGGATAGCGTGAACGGCCGCTTTGCGATTAGCAAAAACAACGCGAAAAACACCCTGTATCTGCTGATGAACAGCCTGCGCCCGGAAGATACCGCGATGTATTTTTGCGCGGCGGTGGATCCGTGCGGCACCAGCAAATGGGGCCAGGGGACCCAGGTCACCGTCTCCTCG.
[0068] SEQ ID NO: 15 nucleotide sequence encoding antibody Nb86
[0069] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCAGCGTGCAGCCGGGCGGCAGCCTGCGCCTGAGCTGCGCGGGCCCGCGCTTTCTGAGCCAGGAAGCGTATTGCTGGTATCGCCAGGCGCCGGGCAAAGAACTGGAAGGCGTGGCGACCATTAGCAACGGCCCGATGCGCGCGCAGACCTATTATGCGCCGAGCGTGAAAGGCCGCTTTACCATTAGCCAGGATAGCGCGAAAAACACCGTGTTTCTGAGCATGAACAGCCTGAAACCGGAAGATACCGCGATGTATAGCTGCGCGGCGGATAGCTATCGCTGCCATTATGATTATGGCCAGGCGTGGCATAAAAACTATAGCTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCG.
[0070] The present application also provides a recombinant vector comprising the isolated polynucleotide described above.
[0071] The recombinant vector is an expression vector or a cloning vector, preferably an expression vector, which can refer to any recombinant polynucleotide construct that can be used to introduce a DNA fragment of interest into a host cell for expression of the gene of interest by transformation, transfection or transduction. One type of vector is a plasmid, which is a circular double-stranded DNA molecule that can be used to ligate a DNA fragment of interest into the plasmid circle. Another type of vector is a viral vector, which can be used to ligate a DNA fragment of interest into the viral genome (e.g. adenovirus, adeno-associated virus, retrovirus, lentivirus, oncolytic virus), which can be used to express the gene of interest after the vector enters the host cell.
[0072] The present application also provides a host cell comprising the recombinant vector described above.
[0073] The present application also provides a host cell comprising the recombinant vector described above. Specifically, the host cell comprises at least one of a prokaryotic host cell, a eukaryotic host cell and a bacteriophage. The prokaryotic host cell can be E. coli, Streptomyces or Bacillus subtilis, etc. The eukaryotic host cell can be 293 cell, 293T cell, 293FT cell, CHO cell, COS cell, Per6 cell, Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Candida, part of insect cells and plant cells. 293 series cells, Per6 cells and CHO cells are commonly used mammalian cells for producing antibodies or recombinant proteins, which are well known to those skilled in the art.
[0074] The present application also provides an immunoconjugate or a pharmaceutical composition comprising the anti-DLL3 Nanobody or chimeric antigen receptor as described above.
[0075] Further, the immunoconjugate further comprises a therapeutic agent.
[0076] The therapeutic agent comprises at least one of an immune checkpoint related agent, an antibody conjugate drug, a bi(multi)-specific antibody, a radionuclide, a toxin, a factor, a kinase inhibitor, and a cytotoxic agent.
[0077] The "pharmaceutical composition" of the present application refers to a combination of at least one drug and optionally a pharmaceutically acceptable carrier or excipient combined together to achieve a certain specific purpose. In some embodiments, the pharmaceutical composition comprises combinations separated in time and / or space as long as they can act together to achieve the purpose of the present application. Some pharmaceutical compositions are achieved by combining some pharmaceutically acceptable ingredients or compounds to enhance the biological efficacy of the present application or to reduce the side effects of the drug (for example, it can be used in combination with other anti-tumor drugs to enhance the anti-tumor effect). The purpose of some other pharmaceutical compositions is to facilitate the administration to the organism, facilitate the absorption of the active ingredients, enhance the stability or targeting, prolong the half-life, and thus better exert the biological efficacy of the present application.
[0078] Further, the pharmaceutical composition comprises at least one of a pharmaceutically acceptable excipient, carrier and diluent.
[0079] Further, the present application also provides a use of the anti-DLL3 Nanobody, chimeric antigen receptor, CAR-T cell, isolated polynucleotide and host cell as described above in the preparation of a medicament for preventing or treating tumors.
[0080] The "treatment" of the present application includes curing, improving, reducing the condition or pathological characteristics of the patient, or inhibiting the deterioration of the condition.
[0081] Optionally, the product comprises at least one of an immune cell, a reagent, a kit, a drug and a pharmaceutical composition.
[0082] Optionally, the product for treating tumors comprises a drug targeting DLL3 for treating or adjuvant treatment of tumors.
[0083] Optionally, the tumor comprises at least one of small cell lung cancer, neuroendocrine prostate cancer, prostate cancer, melanoma, gastroenteropancreatic neuroendocrine tumor, metastatic castration-resistant prostate cancer, large cell neuroendocrine carcinoma, small cell bladder cancer, lung neuroendocrine tumor or glioblastoma multiforme.
[0084] The present application also provides a method for preparing an antibody, which comprises culturing the host cell as described in the foregoing embodiments to obtain the antibody. Specifically, the culture conditions of the host cell are not specifically limited in the present application, and the culture conditions capable of enabling the host cell to express the antibody can be obtained based on conventional technical knowledge.
[0085] The features and performances of the present application are further described in detail below in combination with embodiments.
[0086] Example 1 Construction of DLL3 protein eukaryotic expression vector and expression and purification thereof
[0087] 1.1 Vector construction
[0088] A plasmid containing a DLL3 full-length gene (Gene No. NM_016941.4) was used as a template to design primers for amplification to obtain a DLL3 extracellular domain (ECD) gene, and the gene was connected to a pcDNA3.1-His vector digested by restriction enzymes Hind III and Kpn I by means of homologous recombination. The vector was transformed into a DH5a competent cell, coated on an ampicillin-resistant plate, and cultured in a 37℃ incubator overnight. A single colony was picked and sequenced to identify a successfully constructed clone, which was expanded and cultured to extract a plasmid.
[0089] 1.2 Expression and purification of DLL3 recombinant protein
[0090] A successfully constructed recombinant plasmid pcDNA3.1-DLL3-His containing the DLL3 extracellular domain gene was transfected into HEK293T cells. After 8 hours of transient transfection, the cells were cultured in 293freestyle medium for 5 days, and then the cell culture supernatant was collected. A high-purity recombinant protein DLL3-His was obtained by affinity chromatography using an NTA-Ni column.
[0091] Example 2 Screening and preparation of anti-DLL3 protein nanobody
[0092] 2.1 Animal immunization
[0093] 1 mg of purified DLL3-His recombinant protein was emulsified with an equal volume of Freund's complete adjuvant, and then the first immunization was performed on an Alashan double-humped camel through the neck subcutaneously. Then, 1 mg of protein was emulsified with incomplete Freund's adjuvant every 2 weeks for 3 times of continuous immunization. Peripheral anti-coagulation blood and coagulation blood were collected 7 days after the impact immunization, and the DLL3-His recombinant protein was coated on a 96-well enzyme-labeled plate. The antibody titer was detected by indirect ELISA. As shown in Figure 1 , the antibody titer of the camel peripheral blood against the DLL3-His recombinant protein was 1:512000, indicating that the immunization effect was good, and the subsequent antibody library construction could be performed.
[0094] 2.2 Construction and panning of VHH phage antibody library
[0095] 2.2.1 Isolation of peripheral blood lymphocytes
[0096] 200 mL of peripheral anticoagulated blood was aseptically collected from the jugular vein of a camel. The blood was diluted with an equal volume of sterile PBS, and then 8 x 10 8 Peripheral blood lymphocytes were obtained by centrifugation using Ficoll-Paque Plus lymphocyte separation medium (catalog 17144002, Cytiva) and a lymphocyte separation tube. The obtained lymphocytes were directly extracted for total RNA or stored at -80°C for later use.
[0097] 2.2.2 Amplification of VHH genes
[0098] First, total RNA was extracted from the lymphocytes according to the instructions (catalog 74134, RNeasy Plus Mini Kit, QIAGEN). Then, cDNA was obtained by reverse transcription using an RNA template and a reverse transcription kit (catalog 18080051, Superscript III First-Strand Synthesis System, Invitrogen). Next, VHH genes were amplified using a nested PCR with the cDNA as a template. The primers used in the first round of PCR were CALL001 (nucleotide sequence as shown in SEQ ID NO: 16) and CALL002 (nucleotide sequence as shown in SEQ ID NO: 17). The 700 bp band was separated and recovered using agarose gel electrophoresis. Then, the 700 bp product was used as a template for the second round of PCR amplification. The primers used in the second round of PCR were VHH-FOR (nucleotide sequence as shown in SEQ ID NO: 18) and VHH-REV (nucleotide sequence as shown in SEQ ID NO: 19). The 400 bp band was separated and recovered using agarose gel electrophoresis. The primer sequences are shown in Table 2 below.
[0099] Table 2 Primer sequences required for VHH gene amplification
[0100] Primer name Sequence number Primer sequence (5'-3') CALL001 SEQ ID NO: 16 GTCCTGGCTGCTCTTCTACAAGG CALL002 SEQ ID NO: 17 GGTACGTGCTGTTGAACTGTTCC VHH-FOR SEQ ID NO: 18 CAGGTGCAGCTGCAGGAGTCTGGGGGAGR VHH-REV SEQ ID NO: 19 CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT
[0101] 2.2.3 Construction of VHH phage display vector
[0102] The 400 bp product recovered in 2.2.2 and the phage display vector pMECS were both digested with Pst I and Not I and then recovered. Then, the T4 DNA ligase was used for ligation.
[0103] 2.2.4 Electroporation of the ligation product into TG1 competent cells and harvesting of the phage antibody library
[0104] The ligation product from section 2.2.3 was added to E. coli TG1 competent cells and electroporated to allow it to enter TG1 cells. Immediately after electroporation, SOC medium was added and the cells were incubated at 37°C and 200 rpm for 1 h. The cells were then plated on LB / AMP-GLU plates and incubated at 37°C for 6–8 h. The bacterial colony was collected and 1 / 3 volume of 50% glycerol was added to obtain the prepared phage library.
[0105] 2.2.5 Determination of phage library diversity and library capacity
[0106] The electroconversion products were serially diluted 10-fold and plated on LB / Amp-Glu plates. After incubation at 37°C for 12 h, the number of transformants was counted, yielding a library capacity of 3.92 × 10⁻⁶. 9 Phage library.
[0107] 2.2.6 Screening for specific nanobodies against DLL3 protein
[0108] Using the prepared phage library as the antibody source, three rounds of screening were conducted using phage display technology. First, purified DLL3-His recombinant protein (2 μg / mL) was coated onto a 96-well microplate. The next day, the plate was blocked with 3% skim milk powder at 37°C for 1 hour. 1×10⁻⁶ ppm of the protein was added to each well. 10 Recombinant phages containing nanobodies were incubated at 37°C for 1 hour, washed five times with PBST, and then eluted with 0.1M glycine (pH 1.5) to remove phages bound to DLL3-His. The elution was neutralized with 1M Tris-HCl (pH 8.0). The eluent was then used to infect the host bacterium TG1 and cultured on a large scale. Three rounds of screening were performed. From the plates selected in the third round of screening, 96 clones were randomly selected for further culture. Single-clone ELISA was used to identify nanobodies that specifically bound the DLL3 protein. The results showed that 85 of the 96 clones were positive (P / N > 3.0, where P represents the OD of the DLL3 well). 450 The numerical value, N, represents the OD of the control well. 450 Numerical values); comparative analysis of sequencing results of positive clones yielded a total of 3 anti-DLL3 specific nanobodies.
[0109] Example 3: Preparation of specific nanobodies against DLL3 protein
[0110] Using the plasmid containing the nanobody gene from Example 2.2.6 as a template, the VHH gene was amplified and constructed into the eukaryotic expression vector pcDNA3.1-hFc via homologous recombination. After sequencing confirmed, the plasmid was extracted and transfected into HEK293T cells. After 5 days of expression, the supernatant was collected and purified by affinity chromatography using an NTA-Ni column to obtain recombinant nanobodies (110 kDa, non-reduced) (e.g.). Figure 2 (As shown).
[0111] Example 4: Specificity analysis of anti-DLL3 protein nanobodies
[0112] Using the anti-DLL3 specific nanobody prepared in Example 3 as the primary antibody (2 μg / mL), it was co-incubated with the DLL3-His recombinant protein and other irrelevant antigens (CD276-His, PD1-His, CD5-His, CD7-His, and CD47-His) coated on an ELISA plate (200 ng / well) at 37°C for 1 h. After washing three times with PBST, 100 μL of HRP-labeled Goat anti-human antibody (1:4000) was added to each well and incubated at 37°C for 1 h. After washing three times with PBST, the reaction was terminated with 2M H2SO4 after TMB staining for 5 min, and the OD450 nm absorbance was read. The results are as follows: Figure 3 As shown, the three obtained nanobodies can all bind to the DLL3 protein and do not react with other unrelated antigens, indicating that the above nanobodies and DLL3 protein all have good specific binding activity.
[0113] Example 5: Indirect ELISA detection of the binding of nanobodies to DLL3 protein
[0114] DLL3-His recombinant protein was coated into 96-well microplates at a rate of 200 ng per well. The plates were blocked with 3% skim milk at 37°C for 1 h. After washing three times with PBST, 100 μL of different concentrations of (10) [unclear text - likely a specific ingredient or solution] was added to each well. 2 ~10 -5 The recombinant nanobody prepared in Example 3 (μg / mL) was incubated at 37°C for 1 h. After washing three times with PBST, 100 μL of HRP-labeled Goat anti-human antibody (1:4000) was added to each well and incubated at 37°C for 1 h. After washing three times with PBST, TMB was used for color development for 5 min, and the reaction was terminated with 2M H2SO4. The absorbance at OD450 nm was read. The results are as follows: Figure 4 As shown, the three obtained nanobodies all exhibited good binding activity with the DLL3 protein, while the control protein hFc did not bind.
[0115] Example 6: Biacore detection of the affinity between nanobodies and DLL3 protein.
[0116] To further investigate the affinity of the nanobodies for the DLL3 protein, the prepared anti-DLL3 recombinant nanobodies were used to bind with the DLL3-His antigen coated on a CM5 chip using a Biacore 8k instrument. The results are shown in Table 3. The affinity of the three nanobodies for the DLL3 protein was within 10... -10 ~10 -9M, belongs to high affinity antibody.
[0117] Table 3 Anti-DLL3 Nanobody in vitro binding affinity and kinetics analysis with DLL3 protein
[0118] Antibody Association rate ka (1 / M*s) Dissociation rate kd (1 / s) Affinity KD (M) Nb15 4.23E+05 5.23E-05 1.24E-10 Nb63 1.24E+05 3.87E-04 3.12E-09 Nb86 4.92E+05 9.24E-04 1.88E-09
[0119] Example 7 FACS detection of nanobody binding with cell level DLL3
[0120] The recombinant nanobody prepared in Example 3 (5 μg / mL) was incubated with SHP-77 cells (small cell lung cancer) overexpressing DLL3 and SHP-77 cells knocked out of DLL3 (DLL3-KO-SHP-77) respectively at 37°C for 1 h, washed with PBS for 3 times, then incubated with APC-labeled Goat anti-human secondary antibody (1:600) at 37°C for 1 h, washed with PBS for 3 times, and then detected by flow cytometry. The results are shown in Figure 5 The above nanobody has good binding activity with DLL3-SHP-77 cells and does not bind with DLL3-KO-SHP-77 cells, indicating that the three anti-DLL3 nanobodies prepared in the application have good specific binding activity with cell level DLL3.
[0121] Example 8 Chimeric antigen receptor (CAR) lentivirus vector construction
[0122] The anti-DLL3 nanobody plasmid in the application was used as a template to amplify the nanobody gene targeting DLL3 and cloned into the lentivirus vector pSLCAR-BBz by homologous recombination to construct a second-generation CAR. The CAR mainly contains the following elements: CD8α signal peptide, antigen binding domain (αDLL3-Nb), CD8α hinge region, CD28 transmembrane domain, 4-1BB intracellular signal transduction domain and CD3ζ signal transduction domain. Figure 6 ).
[0123] Example 9 Detection of CAR-T cell anti-tumor activity in vitro
[0124] 9.1 Preparation of CAR-T cells
[0125] Peripheral blood of healthy donors was collected and lymphocytes were separated, stimulated by CD3 / CD28 magnetic beads for 48 h, and activated and expanded to obtain high-purity T cells. The CAR lentivirus plasmid constructed in the application was co-transfected with the packaging plasmids psPAX2 and pMD2.G into HEK293T cells for 48 h, and the culture supernatant was collected, filtered by 0.45 μm filter, concentrated by ultracentrifugation to obtain CAR lentivirus, and then the obtained CAR lentivirus was used to infect the stimulated and activated T cells to prepare CAR-T cells. The results are shown in Figure 7As shown, the expression efficiencies of CAR-15, CAR-63, and CAR-86 were 80.79%, 77.52%, and 79.67%, respectively.
[0126] 9.2 Detection of CAR-T cell antitumor activity
[0127] The anti-tumor effect of CAR-T cells was detected by in vitro co-culture assay, using DLL3-SHP-77-luciferase (2×10⁻⁶) in logarithmic growth phase. 4 / well) cells were seeded in 96-well cell culture plates, and CAR-T cells were added at an effector-to-target ratio (10:1). After co-culturing for 24 h, 3 μL of fluorescein potassium salt (15 mg / mL) was added to each well, mixed and incubated for 5 min, and then the absorbance at 562 nm was detected in a multi-functional microplate reader. The killing efficiency of CAR-T cells was calculated based on the absorbance values of different treatment groups. The killing efficiency was calculated as follows: Killing efficiency % = (1 - fluorescence value of experimental group / fluorescence value of negative control group) × 100%, where the negative control group was the DLL3-SHP-77-luciferase group with normal growth without the addition of CAR-T cells.
[0128] The results are as follows Figure 8 As shown, the killing efficiencies of CAR-15, CAR-63, CAR-86 targeting DLL3 and CAR-CD19 targeting CD19 (an unrelated control) against DLL3-SHP-77 cells were 74.20%, 75.78%, 72.18%, and 5.06%, respectively, indicating that the CAR-T cells targeting DLL3 prepared in this invention have good specific killing activity against DLL3-positive tumor cells (P<0.0001).
[0129] This invention is not limited to the specific embodiments described above. Any modifications made by those skilled in the art based on the above concept without creative effort are within the scope of protection of this invention.
Claims
1. A nanobody against DLL3, characterized in that, The nanobody comprises a heavy chain variable region containing CDR1, CDR2 and CDR3, wherein the amino acid sequence of CDR1 is as shown in SEQ ID NO:9, the amino acid sequence of CDR2 is as shown in SEQ ID NO:10, and the amino acid sequence of CDR3 is as shown in SEQ ID NO:
11.
2. The anti-DLL3 nanobody according to claim 1, characterized in that: It also includes a backbone region, and the structure of the VHH chain of the nanobody is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
3. The anti-DLL3 nanobody according to claim 2, characterized in that: The amino acid sequence of the VHH chain of the nanobody is SEQ ID NO:
12.
4. A chimeric antigen receptor, characterized in that: The structure of the chimeric antigen receptor, from N-terminus to C-terminus, comprises: a signal peptide, an extracellular domain, a hinge region, a transmembrane region, and a signal transduction domain. The signal peptide is a CD8α signal peptide, the extracellular domain is the anti-DLL3 nanobody according to any one of claims 1-3, the hinge region is a CD8α hinge region, the transmembrane region is a CD28 transmembrane domain, and the signal transduction domain is the CD3ζ and 4-1BB intracellular regions.
5. CAR-T cells, characterized by: Including the chimeric antigen receptor as described in claim 4.
6. An isolated polynucleotide, characterized in that: The nanobody as described in any one of claims 1-3 or the chimeric antigen receptor as described in claim 4 is encoded.
7. The isolated polynucleotide according to claim 6, characterized in that: The nucleotide sequence is shown in SEQ ID NO:
15.
8. Use of the anti-DLL3 nanobody according to any one of claims 1-3, the chimeric antigen receptor according to claim 4, the CAR-T cell according to claim 5, and the isolated polynucleotide according to claim 6 or 7 in the preparation of a medicament for treating small cell lung cancer.
Citation Information
Patent Citations
Fully human specific chimeric antigen receptor targeting human DLL3 antigen and application of fully human specific chimeric antigen receptor
CN116003628A
Anti-DLL3 nano antibody, related product and application
CN116041519A