Method for establishing a strain of hermetia illucens

By cloning growth-related genes (giant) using gene editing technology and microinjecting them, a large-sized black soldier fly strain was successfully constructed, solving the problems of long breeding time and unstable strains in traditional breeding methods, and achieving efficient treatment of organic waste and stable yield.

CN118879785BActive Publication Date: 2025-12-09SHANGHAI MENGXUN BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410988739.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-23
Publication Date
2025-12-09
Estimated Expiration
2044-07-23

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently obtain large-sized black soldier fly strains. Traditional breeding methods are time-consuming and the strains are unstable, which cannot meet the growing demand for black soldier fly production.

Method used

Using gene editing technology, the growth-related gene giant was cloned, the PAM sequence was selected as the target of NGG, sgRNA was synthesized and mixed with Cas9 protein and microinjected into black soldier fly embryos, and stable large-sized strains were obtained through self-pollination and selection.

Benefits of technology

It has enabled the more efficient acquisition of large-sized black soldier fly strains, improved the efficiency of organic waste treatment, met the production requirements of black soldier flies, and the strains have good stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879785B_ABST
    Figure CN118879785B_ABST
Patent Text Reader

Abstract

The application relates to a method for establishing a large-size Hermetia illucens strain, which comprises the following steps: S1, cloning a growth and development related gene giant; S2, selecting a target point with a PAM sequence of NGG on a single exon of the gene giant; S3, synthesizing sgRNA corresponding to the gene target point based on the target point determined in step S2, and the sgRNA is respectively sgRNA1 and sgRNA2; S4, mixing sgRNA and Cas9 protein and injecting into newly born Hermetia illucens embryos; S5, culturing the injected Hermetia illucens embryos, feeding the hatched larvae for generation, and obtaining a stable large-size homozygous mutant strain through self-crossing screening, namely a large-size Hermetia illucens strain. Compared with the prior art, the gene editing technology is used to obtain the large-size Hermetia illucens strain, the method breaks through the barriers of long traditional breeding time and unstable strain, and the large-size Hermetia illucens strain can be more efficiently obtained, so that the increasing demand for the yield of the Hermetia illucens can be met, and the obtained large-size Hermetia illucens can more efficiently process organic waste.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method for establishing a large-size Hermetia illucens strain. BACKGROUND

[0002] Hermetia illucens L. belongs to the order Diptera and the family Stratiomyidae, and is commonly known as black soldier fly. It is an important resource insect. The growth cycle of black soldier fly is short, and it has strong reproductive capacity, which is suitable for large-scale artificial breeding. Black soldier fly larvae can handle a variety of complex organic waste, such as poultry manure, food residue, agricultural production fertilizer, and compost leachate. The protein content of the larvae is high (about 40%), and the feed-protein conversion efficiency is higher than that of traditional resource insects such as mealworms. At present, it has been used as a substitute for fish meal and soybean meal feed, and is the only insect species approved worldwide for use as a feed ingredient for aquaculture and poultry. The larvae also have abundant oil (about 35%) and chitin, which can be used for biofuel and biomembrane production. In addition, black soldier fly does not carry and spread pathogenic bacteria, and does not pose a threat to the environment and humans. In summary, black soldier fly has great application value in the fields of alternative resources and environmental governance.

[0003] In biological breeding, a traditional method is to obtain a strain with a corresponding excellent phenotype through artificial selection for a specific phenotype for several years. However, this method is time-consuming and is greatly affected by the environment, and is not suitable for black soldier fly in a complex waste environment. Physical methods such as radiation mutagenesis or chemical methods such as mutagenic agents can achieve gene mutation. However, both methods have the disadvantage of unclear target genes. The new gene mutation method such as CRISPR / Cas9 can achieve the purpose of gene mutation by operating a single gene, and has the advantages of clear target and no impact on other genes. Through the established black soldier fly microinjection platform, genetic manipulation of the black soldier fly genome can be achieved, and therefore research on growth and development-related genes can provide a theoretical and feasible solution for obtaining a large-size black soldier fly strain. This provides a reference for further molecular directional breeding of new varieties.

[0004] The patent CN112111526A discloses a method for screening CRISPR / Cas9 gene edited black soldier fly, which comprises the following steps: (1) PCR is carried out by using white gene knockout template primers sgRNA1-F and sgRNA2-F respectively and a universal reverse primer, and the PCR product is recovered and purified to obtain a template sgRNA; (2) the sgRNA template is subjected to in vitro mass amplification to obtain sgRNA in a single-stranded state; (3) the sgRNA in the single-stranded state is mixed with cas9 protein, and microinjection is carried out into newly laid fertilized eggs of black soldier fly; (4) the eggs after the microinjection are treated in the dark until hatching, and the eye color phenotype of the hatched black soldier fly is observed, and the individual with white eyes is picked out. The gene editing technology realizes the successful knockout of the eye color related gene, and the obtained gene mutant black soldier fly can be judged by observing whether the white eyes appear, the phenotype is easy to observe in the early stage, and the excellent effect is achieved as a marker gene, and convenience is provided for subsequent black soldier fly gene function research. The scheme is a method for screening CRISPR / Cas9 gene edited black soldier fly.

[0005] The patent CN117683818A discloses a method for obtaining black soldier fly golden yellow pre-pupa and pupa based on CRISPR / Cas9 gene editing and application, which comprises the following steps: A, sgRNA preparation: taking the PAM sequence on the Yellow gene exon of black soldier fly as the target point of NGG, designing the template primer sgRNA-F for gene knockout, amplifying to obtain the sgRNA template, and then massively amplifying the sgRNA template to obtain sgRNA in a single-stranded state; B, black soldier fly embryo microinjection and culture: mixing the sgRNA obtained in step A with Cas9 protein, microinjecting into newly laid black soldier fly fertilized eggs, and culturing in an incubator to obtain black soldier fly pre-pupa and pupa with golden yellow surface. The scheme is a method for obtaining black soldier fly golden yellow pre-pupa and pupa.

[0006] At present, the demand for resource type edible insects black soldier fly is rapidly increasing. In the global food industry, about 1.3 billion tons of organic waste are generated annually and are increasing year by year, and it is urgent to treat them by economic and environmentally sustainable methods such as black soldier fly biological treatment. In addition, the insect breeding industry for animal feed and pet food is also developing, and the demand for insect protein is not met, and it is estimated that the global demand will increase by 50 times by 2030. Therefore, in view of the increasing demand for black soldier fly production, expanding its production scale and improving the production system is a conventional method; another angle is to use low-cost biological breeding means to increase the weight of individual insects and improve the production conversion efficiency of insects themselves, which can also achieve good results. SUMMARY

[0007] Based on the fact that there is a lack of efficient method for obtaining large-size black soldier fly strains in the prior art, the present application provides a method for establishing large-size black soldier fly strains.

[0008] The application adopts a gene editing technology to obtain a large-size black soldier fly strain, which breaks through the barriers of long traditional breeding time and unstable strain, and can more efficiently obtain a large-size black soldier fly strain to meet the increasing demand for black soldier fly yield.

[0009] The method for establishing the large-size black soldier fly strain provided in the application scheme comprises the following steps: cloning of a growth-related gene, selection of a target point, in-vitro synthesis of sgRNA corresponding to the gene target point, embryo microinjection, screening of a pure mutant, and observation of a growth and development phenotype.

[0010] The object of the application can be achieved by the following technical solutions.

[0011] The application provides a method for establishing a large-size black soldier fly strain, comprising the following steps:

[0012] S1, cloning a growth and development-related gene giant;

[0013] S2, selecting a target point with a PAM sequence of NGG on a single exon of the gene giant;

[0014] S3, synthesizing sgRNA corresponding to the gene target point based on the target point determined in step S2, which are sgRNA1 and sgRNA2 respectively;

[0015] S4, mixing sgRNA and Cas9 protein and injecting into a newly born black soldier fly embryo;

[0016] S5, culturing the black soldier fly embryo after injection, feeding the hatched larvae for passage, and obtaining a stable large-size homozygous mutant strain through self-crossing screening, which is a large-size black soldier fly strain.

[0017] In an embodiment of the application, in step S1, the nucleotide sequence of the growth and development gene giant is shown in SEQ ID NO. 1, and is specifically as follows:

[0018]

[0019] In one embodiment of the present application, in step S1, the RNA of black soldier fly is first extracted, reverse transcribed into cDNA, and the gene giant is cloned from the cDNA of black soldier fly by designing primers G-F: ATGTTTGATCGATTTATGAAGG and G-R: GAGCTAGCGTGAGTAGATAA, and connected to the pJET-1.2 vector for sequencing verification.

[0020] In one embodiment of the present application, in step S2, a target with a length of 23 bases and a PAM sequence of NGG (5'-3') is selected on the single exon of the gene giant.

[0021] In one embodiment of the present application, in step S2, the two targets are target 1 and target 2, respectively, the sequence of target 1 (Target site1) is: 5' CCTTACAACACAGCTTCTAGCCC 3', and the sequence of target 2 (Target site2) is: 5' CCACGTTGCCATCATGCGAGTCC 3'.

[0022] In one embodiment of the present application, in step S3, the template primer of sgRNA1 is sgRNA1-F and a universal reverse primer, wherein the nucleotide sequence of sgRNA1-F is shown in SEQ ID NO. 2, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO. 4.

[0023] In one embodiment of the present application, in step S3, the template primer of sgRNA2 is sgRNA2-F and a universal reverse primer, wherein the nucleotide sequence of sgRNA2-F is shown in SEQ ID NO. 3, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO. 4.

[0024] sgRNA1-F: TAATACGACTCACTATAGGGCTAGAAGCTGTGTTGTAGTTTTAGAGCTAGAAATAGCAA;

[0025] sgRNA2-F:

[0026] TAATACGACTCACTATAGGACTCGCATGATGGCAACGGTTTTAGAGCTAGAAA TAGCAA,

[0027] The reverse primer is a universal primer R: AGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTA ACTTGCTATTTCTAGCT.

[0028] In one embodiment of the present application, in step S3, the nucleotide sequence of sgRNA1 is shown in SEQ ID NO. 5, and the nucleotide sequence of sgRNA2 is shown in SEQ ID NO. 6.

[0029] The nucleotide sequence of sgRNA1 is specifically: TAATACGACTCACTATAGGGCTAGAAGCTGTGTTGTAGTTTTAGAGCTAGAAA TAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTT.

[0030] The nucleotide sequence of sgRNA2 is specifically: TAATACGACTCACTATAGGACTCGCATGATGGCAACGGTTTTAGAGCTAGAAA TAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTT.

[0031] In one embodiment of the present application, in step S4, the synthesized sgRNA1 and sgRNA2 are mixed with the concentration of 150 ng / uL and the concentration of Cas9 protein of 300 ng / uL.

[0032] In one embodiment of the present application, in step S4, the sgRNA and Cas9 protein are mixed and injected into the newly born embryo by a microinjection instrument.

[0033] In one embodiment of the present application, step S5 comprises:

[0034] S5-1: First, 15-20 un-hatched injected fertilized embryos are taken to extract genomic DNA, primers are designed on the upstream and downstream of two target points to detect whether the genomic sequence changes by PCR, the fragments obtained by PCR amplification are sequenced to confirm whether the giant gene knockout is achieved, and if the knockout is achieved, the subsequent steps are performed.

[0035] S5-2: After S5-1, the remaining fertilized embryos are hatched and placed in a 200g water 60% wheat bran environment for feeding, and after obtaining a homozygote by self-crossing and passing screening, the growth and development state of the larvae is observed and counted, and a line with increased body size and stable inheritance is screened and obtained.

[0036] In one embodiment of the present application, in step S5-1, the mutation detection primers are G-TS-F: GCGAACAAGATGGCAGTGTC; and G-TS-R: GCATCTGTTGCCGTAAATGT, respectively.

[0037] Compared with the prior art, the present application has the following advantages:

[0038] The present application uses gene editing technology to obtain a large-size black soldier fly strain, which breaks through the barriers of traditional breeding time and unstable strain, and can more efficiently obtain a large-size black soldier fly strain to meet the growing demand for black soldier fly production. The obtained large-size black soldier fly strain can more efficiently process organic waste. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 To detect the giant gene knockout results, the red sequence represents the PAM base, the green represents the sgRNA target sequence, the number represents the number of deleted bases, WT represents the wild type individual, and M1-M2 represents two homozygous strains.

[0040] Figure 2 The growth of wild type individuals and mutant individuals is represented.

[0041] Through step S5, the giant gene knockout homozygous strain is obtained, the growth phenotype of the two strains is counted, the phenotype is recorded using a camera (a); and 40 randomly selected larvae of each strain are weighed and counted on the 12th day after hatching (b), the horizontal axis represents the wild type and the two strains, and the vertical axis represents the weight of the insects. It shows that the mutant giant gene leads to the phenotype of larger individuals in the larval stage. Figure 2 Figure 2 DETAILED DESCRIPTION

[0042] The present application will be described in detail below in combination with the drawings and specific embodiments.

[0043] The present application combines black soldier fly embryo microinjection technology, genome editing technology and molecular biological operation, and successfully constructs an embodiment of realizing the growth of black soldier fly individuals by using gene editing technology.

[0044] The present application successfully knocks out the growth gene by using gene editing technology, and detects the mutation of two corresponding target points on the genome. The material with gene mutation can be judged by observing and counting the size and weight of the insects compared with the wild type, and the correctness of the detection of gene mutation is detected by PCR amplification and sequencing.

[0045] The primer synthesis and sequencing are completed by Shengong Bioengineering (Shanghai) Co., Ltd. ​​

[0046] Molecular biology experiments including plasmid construction, enzyme digestion, preparation of competent cells, transformation, etc. are mainly performed according to the Guide to Molecular Cloning Experiments (3rd edition), J. Sambrook, D. W. Russell (USA) edited, Huang Peitang et al. translation, Science Press, Beijing, 2002.

[0047] The operation can be performed according to the relevant kit instructions. If necessary, the specific experimental conditions such as PCR conditions can be determined by simple tests.

[0048] Example 1: sgRNA template for giant gene knockout

[0049] The primer sgRNA1-F and sgRNA2-F and the universal reverse primer are obtained by PCR annealing extension.

[0050] The reaction system is as follows:

[0051]

[0052]

[0053] The PCR reaction conditions are as follows:

[0054] 98℃, 2min

[0055]

[0056] 72℃, 2min

[0057] The obtained PCR product is recovered and purified to obtain the template sgRNA.

[0058] sgRNA1-F: TAATACGACTCACTATAGGGCTAGAAGCTGTGTTGTAGTTTTAGAGCTAGAAATAGCAA;

[0059] sgRNA2-F:

[0060] TAATACGACTCACTATAGGACTCGCATGATGGCAACGGTTTTAGAGCTAGAAA TAGCAA,

[0061] The reverse primer is a universal primer R: AGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTA ACTTGCTATTTCTAGCT.

[0062] Example 2: Large-scale synthesis of sgRNA

[0063] The sgRNA template obtained was amplified in vitro by an in vitro transcription kit (Thermo Fisher) to obtain sgRNA in a single-stranded state. The reaction system was as follows:

[0064]

[0065] After mixing well at 37°C for 12 hours, purification was performed to obtain sgRNA1 and sgRNA2.

[0066] The nucleotide sequence of sgRNA1 was specifically as follows: TAATACGACTCACTATAGGGCTAGAAGCTGTGTTGTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT

[0067] The nucleotide sequence of sgRNA2 was specifically as follows: TAATACGACTCACTATAGGACTCGCATGATGGCAACGGTTTTAGAGCTAGAAA TAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTT.

[0068] Example 3: Microinjection of black soldier fly embryos

[0069] The sgRNA1 and sgRNA2 obtained in Example 2 and the Cas9 protein stored in the laboratory were mixed, the concentration of each of the two sgRNAs was controlled at 150 ng / μL, and the concentration of the Cas9 protein was 300 ng / μL. The black soldier fly embryos were microinjected.

[0070] The embryos after injection were cultured under the conditions of a temperature of 30°C, a relative humidity of 60%, and a light-dark cycle L:D of 16h:8h. The hatched larvae were fed in 60% water-containing wheat bran.

[0071] Example 4: Detection of target point mutation

[0072] Randomly select 15-20 injected embryos to extract genomic DNA, and after extraction, select Mix enzyme (Yisheng Biotechnology) for target amplification. PCR is performed according to the operation (note that the template DNA concentration should be controlled between 100 ng-150 ng, and should not be too much; the system is 50ul); run 2% agarose gel to cut the trailing bands or notched bands of the gel map, collect the gel, ligate T vector for sequencing, and compare to confirm whether the injected embryos are mutated and the mutation form of the giant gene. Subsequently, the injected black soldier fly is self-crossed and passed on, and the genome of each generation is subjected to PCR sequencing screening to obtain a pure mutant line with consistent mutation forms of the giant allele site.

[0073] Figure 1 The results of detecting the mutation of the genomic giant gene are shown. The red sequence represents the PAM base, the blue sequence represents the sgRNA target sequence, the yellow sequence represents the mutant sequence, WT represents the wild type sequence, and the lower two columns of sequences represent the detected mutant sequences. Figure 2 The individual size and weight of the black soldier fly giant mutant are shown. The above experiments show that the present application can successfully achieve the knockout of the growth-related gene giant in the black soldier fly and obtain an individual enlargement line, and therefore this non-transgenic biological breeding method is of great significance for improving the conversion efficiency of the black soldier fly.

[0074] The above description of the embodiments is for the purpose of facilitating the understanding and use of the present application by those skilled in the art. Those skilled in the art can easily make various modifications to these embodiments, and apply the general principles described herein to other embodiments without having to go through creative labor. Therefore, the present application is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present application without departing from the scope of the present application should be within the scope of protection of the present application.

Claims

1. A method for establishing a strain of Hermetia illucens of large size, characterized in that, The method comprises the following steps: S1, cloning growth development related genes giant ; S2, select target sites with PAM sequence of NGG on the single exon of the gene giant S2, select target sites with PAM sequence of NGG on the single exon of the gene S3, based on the target points determined in step S2, synthesizing sgRNAs corresponding to the gene target points, respectively sgRNA1 and sgRNA2; S4, mixing sgRNAs and Cas9 protein and injecting into the newly born black soldier fly embryos; S5, culturing the injected black soldier fly embryos, feeding the hatched larvae for passage, and obtaining a stable giant homozygous mutant strain through self-crossing screening, i.e. a giant black soldier fly strain; In step S1, genes related to growth and development giant The nucleotide sequence is shown in SEQ ID NO.

1.

2. The method of claim 1, wherein the Hermetia illucens strain is a large size strain. In step S1, the RNA of black soldier fly is first extracted, reverse transcribed into cDNA, and the gene is cloned from the cDNA of black soldier fly, connected to the pJET-1.2 vector for sequencing verification by designing primers G-F: ATGTTTGATCGATTTATGAAGG and G-R: GAGCTAGCGTGAGTAGATAA. giant cloned from the cDNA of black soldier fly, connected to the pJET-1.2 vector for sequencing verification.

3. The method of claim 1, wherein the method is for establishing a strain of Hermetia illucens having a large body size. In step S2, a target of 23 bases in length and a PAM sequence of NGG (5'-3') is selected on a single exon of the gene giant of the gene.

4. The method of claim 1, wherein the method is for establishing a strain of Hermetia illucens having a large body size. In step S2, the two target points are target point 1 and target point 2, the sequence of target point 1 is: 5' CCTTACAACACAGCTTCTAGCCC 3', and the sequence of target point 2 is: 5' CCACGTTGCCATCATGCGAGTCC 3'.

5. The method of claim 1, wherein the method is for establishing a strain of Hermetia illucens having a large body size. In step S3, the template primer of sgRNA1 is sgRNA1-F and a universal reverse primer, wherein the nucleotide sequence of sgRNA1-F is shown as SEQ ID NO. 2, and the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO.

4.

6. The method of claim 1, wherein the black soldier fly strain is Hermetia illucens. In step S3, the template primer of sgRNA2 is sgRNA2-F and a universal reverse primer, wherein the nucleotide sequence of sgRNA2-F is shown as SEQ ID NO. 3, and the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO.

4.

7. The method of claim 1, wherein the black soldier fly strain is Hermetia illucens.

8. The method of claim 1, wherein the black soldier fly strain is Hermetia illucens. The nucleotide sequence of sgRNA1 is shown as SEQ ID NO. 5, and the nucleotide sequence of sgRNA2 is shown as SEQ ID NO.

6.

8. The method of claim 1, wherein the black soldier fly strain is of the species Hermetia illucens. In step S4, the synthesized sgRNA1 and sgRNA2 are mixed with the final concentration of 150 ng / uL and the final concentration of Cas9 protein of 300 ng / uL, respectively.

9. The method for establishing a large-sized black soldier fly strain according to claim 1, characterized in that, Step S5 comprises: S5-1: First, extract genomic DNA from 15-20 un-hatched injected fertilized embryos, design primers upstream and downstream of two target sites, and detect whether genomic sequence has changed by PCR, sequence the fragments obtained by PCR amplification, and confirm whether knockout has been achieved giant Gene knockout, if knockout is achieved, proceed to subsequent steps; S5-2: After the remaining fertilized embryos in S5-1 are hatched, they are placed in a 200g water-containing 60% wheat bran environment for feeding, and after the homozygous body is obtained through self-crossing passage screening, the growth and development state of the larvae is observed and counted to determine the strain with increased body size and stable inheritance; In step S5-1, the mutation detection primers are G-TS-F: GCGAACAAGATGGCAGTGTC; and G-TS-R: GCATCTGTTGCCGTAAATGT.

Citation Information

Patent Citations

  • Marker gene of CRISPR / Cas9 gene editing system applied to hermetia illucens

    CN112111526A

  • Preparation method for enlarging body type of hermetia illucens based on gene editing

    CN118773261A