KASP molecular marker primer set for detecting flower rust resistance and its application

Abstract

The present invention relates to a KASP molecular marker primer set for detecting flower rust resistance and its application. The KASP molecular marker SNP site Tif1_A02_3438294 is located on chromosome 2 of a cultivated peanut variety, and the mutation site is: G / A. The KASP primer set is designed according to the sequence of 100 bp before and after the molecular marker mutation site. A method for PCR identification using the KASP molecular marker primer set is used to extract DNA of a peanut material to be identified. When the genotype of the detected SNP site Tif1_A02_3438294 is G:G, the peanut material exhibits disease resistance; when the genotype of the detected SNP site Tif1_A02_3438294 is A:A, the peanut material exhibits disease susceptibility. The KASP molecular marker of the present invention can be used for genotype screening of peanut rust-resistant materials. The identification method is less affected by the environment, and the results are stable and reliable. Early gene screening can shorten the breeding period and improve breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a KASP molecular marker primer set for detecting flower rust resistance and an application technology. Background Art

[0002] Peanut (Arachis hypogaea L.) is an important oil crop and cash crop in the world. Peanut rust caused by Puccinia arachidis Speg is a worldwide peanut disease with a wide range of prevalence, seriously affecting the yield and quality of peanuts and causing huge losses to peanut production.

[0003] At present, the main methods of preventing and controlling peanut rust in production are chemical control and breeding of disease-resistant peanut varieties. Timely spraying of pesticides in the early stage of the disease can effectively reduce the occurrence of rust, but chemical pesticides have problems such as high cost, harm to the environment and human health, and long-term use can easily lead to drug resistance in pathogens, which is not in line with the concept of green production. The selection of disease-resistant peanut varieties is the most economical and effective prevention and control measure. Planting highly rust-resistant peanut varieties according to local conditions, such as Zhongkaihua No. 1, Shanyou 21, Yueyou 20, etc., can fundamentally reduce the occurrence of rust.

[0004] The use of traditional breeding methods to cultivate rust-resistant peanut varieties is somewhat blind and inefficient. The development of molecular markers to detect flower rust resistance can more accurately screen disease-resistant varieties with the help of molecular marker-assisted selection technology, thereby improving the efficiency of disease-resistant breeding. This technology has achieved a shift from empirical breeding to directional, efficient, and precise breeding. It can greatly improve breeding efficiency through early genotype selection, and molecular marker-assisted breeding is more accurate than traditional phenotypic selection methods. Therefore, the development and screening of molecular markers that are closely linked to flower rust resistance genes and their application in the identification of disease resistance in peanut varieties are of great significance to molecular marker-assisted selection breeding and the improvement of peanut disease resistance traits. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present application provides a KASP molecular marker primer set for detecting flower rust resistance and a method for detecting flower rust resistance using the KASP primer set, which enables early identification of the trait through genotype selection and greatly improves breeding efficiency.

[0006] The technical solution of the present invention is as follows:

[0007] A KASP molecular marker primer set for detecting flower rust resistance, comprising upstream primer 1, upstream primer 2 and downstream primer 3;

[0008] Upstream primer 1: ATTTCCTTCCTAATCCCGTAGGATTC (SEQ ID NO. 1)

[0009] Upstream primer 2: AATTTTCCTTCCTAATCCGTAGGATTT (SEQ ID NO. 2)

[0010] Downstream primer 3: TTACTCGTGAAAAACAATGGCCGTAAAC (SEQ ID NO. 3)

[0011] The SNP site of the KASP molecular marker is Tif1_A02_3438294, located on chromosome 2 of the cultivated peanut variety, the mutation site is: G / A, and the sequences of 100 bp before and after the mutation site are:

[0012] AGGTACACCGTGAGAGCCAATCACAGTTTCTACTCTATACATAAACAG TGGCTGATAGGGACAGATTACTCGTGAAAAACAATGGCCGTAAACCGTGGC T (SEQ ID NO. 4);

[0013] AATCCTACGGATTAGGAAGGAAAATTGGCAGGCATATACCGTGGTTGC CTACCACGGTTTACGAAGAGGAGACATTCAAAGGTAAAATCCCTTACTTCC C (SEQ ID NO. 5).

[0014] Preferably, the method for detecting peanut rust disease using the KASP molecular marker primer set comprises: extracting DNA of the peanut material to be identified, performing PCR amplification and genotype detection on the SNP site Tif1_A02_3438294 using the KASP molecular marker primer set, and predicting the resistance of the peanut material to be identified to rust disease according to the genotype of the SNP site;

[0015] The judgment method is as follows: when the genotype of the SNP site Tif1_A02_3438294 is G:G, the peanut material is resistant to the disease; when the genotype of the SNP site Tif1_A02_3438294 is A:A, the peanut material is susceptible to the disease.

[0016] A detection reagent or kit for the KASP molecular marker primer set.

[0017] An application of the KASP molecular marker primer set in detecting floral rust disease.

[0018] Beneficial effects of the present invention:

[0019] (1) The molecular marker linked to the peanut rust resistance trait of the present invention is obtained by QTL positioning through linkage population constructed from peanut varieties with large differences in rust resistance. It is closely linked to peanut rust resistance and can be used for molecular marker-assisted selection breeding for rust resistance.

[0020] (2) The present invention uses the KASP molecular marker primer set for PCR identification, and predicts the rust resistance of the peanut material to be identified according to the genotype of the SNP site; when the genotype of the detected SNP site Tif1_A02_3438294 is G:G, the peanut material is resistant to the disease; when the genotype of the detected SNP site Tif1_A02_3438294 is A:A, the peanut material is susceptible to the disease. Comparison of the indoor and field verification results shows that the prediction result of the genotype is consistent with the judgment result of the disease index.

[0021] (3) The molecular markers linked to the rust resistance trait of the present invention can be used to detect the genotype of peanut materials, and then determine whether the materials are rust resistant. Through high-throughput genotyping system detection, manpower and material resources can be greatly saved. The detection is not affected by environmental factors, and the identification results are accurate and reliable. It can be used for early screening of peanut rust-resistant materials, which can shorten the breeding period and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : QTL positioning results on LG02, bin marker (A) and KASP marker (B);

[0023] Figure 2 : Phenotyping diagram of 318 RIL families using KASP marker Tif_A02_3438294 under indoor environment;

[0024] Figure 3 : Genotyping map of KASP marker Tif1_A02_3438294. DETAILED DESCRIPTION

[0025] Example 1 Development of a primer set for detecting KASP molecular marker (Tif1_A02_3438294) for flower rust resistance

[0026] 1. Plant material and bacterial strain preparation

[0027] Plant materials: Yuhua 15 (female parent, susceptible to rust) and W1202 (male parent, resistant to rust) were used as parents to cross and obtain the F1 generation. The RIL population was constructed by single seed descending method (SSD), which contained 318 families.

[0028] Yuhua 15 and W1202 were provided by Henan Institute of Crop Molecular Breeding.

[0029] The control peanut materials used were SK2803 (susceptible to rust) and Zhongkaihua 826 (resistant to rust), which were provided by the College of Agriculture, Zhongkai University of Agriculture and Engineering.

[0030] Source of strains: The strain material used in the present invention is the Puccinia rotundifolia strain Pa-1 purified by live culture, and provided by Shennong Seed Industry Laboratory.

[0031] 2. Extraction of Peanut Population DNA

[0032] 0.1 g of young peanut leaves were collected and peanut DNA was extracted using Tiangen Extraction Kit (model: DP305) in strict accordance with the kit instructions for use in subsequent PCR amplification and KASP genotyping.

[0033] 3. Indoor phenotypic identification of peanut rust

[0034] 3.1 Preparation of rust fungus spore suspension: Collect spores from rust-infected peanut leaves, add sterile distilled water containing 0.02-0.05% (v / v) Tween-80, and stir thoroughly to prepare a spore suspension with a concentration of 4×10 5 spores / mL;

[0035] 3.2 Rust fungus inoculation: Spray the whole peanut plant at the 6-leaf stage in an artificial climate room and inoculate with spore suspension at an inoculation volume of 20 mL / plant. Tie a rope around the unfolded top leaf as a mark before inoculation. The relative humidity during inoculation was 90% and the temperature was 25°C. The plant was kept in darkness for 48 hours after inoculation, and then cultured under normal light. The culture conditions were alternating light 16 hours / darkness 8 hours, light intensity 12000 lux, culture temperature 25°C, and culture humidity 90%. All inoculation tests were repeated at least 3 times, and 12 plants were inoculated in each family.

[0036] 3.3 Disease investigation: On the 14th day after inoculation, the marked leaves of all plants were taken, the leaves were scanned with an Epson Perfection V850 pro scanner, and the leaf area analysis system (Wanshen LA-S leaf analysis software) was used to calculate the percentage of diseased area (X).

[0037] 3.4 Indoor survey grading standard for rust disease: A six-level classification method is adopted, namely, Level 0: no symptoms, the percentage of lesion area (X) is 0; Level 1: 0<X<6%; Level 3: 6%≤X<25%; Level 5: 25%≤X<50%; Level 7: 50%≤X<75%; Level 9: X≥75%.

[0038] 3.5 Field survey grading standard for flower rust: A six-level classification method is adopted, namely, Level 0: no symptoms, the percentage of lesion area (X) is 0; Level 1: a small amount of rust spore piles appear on the lower leaves, 0<X<6%; Level 3: necrotic spots appear on the lower leaves, more spore piles appear on the middle leaves, and a small amount of spore piles appear on the upper leaves, 6%≤X<25%; Level 5: obvious necrotic spots on the lower leaves, necrotic spots appear on the middle leaves, and a large number of spore piles appear on the upper leaves, 25%≤X<50%; Level 7: the lower and middle leaves are seriously damaged, and necrotic spots appear on the upper leaves, 50%≤X<75%; Level 9: the leaves of the whole plant are seriously damaged, X≥75%.

[0039] 3.6 Disease index calculation: DI = ∑ (number of diseased leaves at each level × representative level value) × 100 / (total number of leaves surveyed × the most severe representative level value);

[0040] According to the disease index (DI), resistance evaluation was performed according to the following criteria:

[0041] High resistance: 0≤DI<11.11;

[0042] Resistance: 11.11≤DI<33.33;

[0043] Medium resistance: 33.33≤DI<55.56;

[0044] Sense: 55.56≤DI<77.78;

[0045] High sensitivity: 77.78≤DI.

[0046] 4. Field phenotypic identification of peanut rust

[0047] 4.1 Field experiment design: In spring 2023 (Spring, S), the RIL population and its parent materials were planted in three environments: Huangpu District, Guangzhou City, Guangdong Province (HP2023S, 23°24′N, 113°36′E), Yingde City, Guangdong Province (YD2023S, 23°50′N, 112°45′E), and Dinghu District, Zhaoqing City, Guangdong Province (DH2023S, 23°06′N, 112°49′E); in autumn 2023 (Autumn, A), the RIL population and its parent materials were planted in three environments: Huangpu District, Guangzhou City, Guangdong Province (HP2023A), Yingde City, Guangdong Province (YD2023A), and Dinghu District, Zhaoqing City, Guangdong Province (DH2023A).

[0048] The field test adopted a randomized block design. A total of 10 seeds per material were evenly planted in 2 planting rows, with single seed sowing, a plant spacing of 20 cm, a row spacing of 30 cm, and 2 replicates. Every 20 materials were planted with a rust-resistant control material (Zhongkai 826) and a rust-susceptible control material (SK2803). Planting the rust-susceptible material SK2803 on the protection line is conducive to spore spread. No fungicide was sprayed throughout the growing season, and conventional measures such as pest control, weeding, and irrigation were carried out as needed.

[0049] 4.2 Rust inoculation: Rust summer spores were inoculated by whole plant spraying at the flowering stage, with an inoculation concentration of 4×10 5 spores / mL.

[0050] 4.3 Disease investigation: Field phenotyping should be carried out one week before peanut harvest. The peanut disease classification standard and disease index calculation and evaluation method are shown in steps 3.5 and 3.6.

[0051] 5. Analysis of floral rust phenotype

[0052] In 6 field environments and 1 indoor environment, the flower rust disease of the parent and offspring RIL families was identified and classified, and the disease index was calculated and analyzed. It was found that the maternal parent YuHua 15 (♀, YuHua 15) and the paternal parent W1202 (♂, W1202) had significant differences in flower rust disease resistance, and the disease index of YuHua 15 was higher than that of W1202. In the 7 environments, the average disease index of the RIL families was 33.71%-60.41%, the standard deviation was 9.55%-17.44%, and the coefficient of variation was 25.64%-48.90% (Table 1). The absolute values ​​of skewness and kurtosis were less than 1, and the W-test value was 0.96-0.98, all close to 1, and the data had a high degree of fit with the normal distribution. There was considerable phenotypic variation and super-segregation in the response to flower rust disease in the RIL population, indicating that flower rust disease is a quantitative trait controlled by multiple genes, and genetic statistics methods can be used for subsequent research.

[0053] Table 1 Phenotypic variation of floral rust in parents and RIL families under seven planting environments

[0054]

[0055] Note: HP2023S means planting in Huangpu District, Guangzhou City, Guangdong Province in the spring of 2023; YD2023S means planting in Yingde City, Guangdong Province in the spring of 2023; DH2023S means planting in Dinghu District, Zhaoqing City, Guangdong Province in the spring of 2023; HP2023A means planting in Huangpu District, Guangzhou City, Guangdong Province in the autumn of 2023; YD2023A means planting in Yingde City, Qingyuan City, Guangdong Province in the autumn of 2023; DH2023A means planting in Dinghu District, Zhaoqing City, Guangdong Province in the autumn of 2023; LT2024 means planting in the artificial climate chamber of Shennong Laboratory in Xinxiang City, Henan Province in the spring of 2024.

[0056] 6. QTL Mapping for Floral Rust

[0057] QTL positioning was performed based on the linkage map constructed by Henan Institute of Crop Molecular Breeding using 318 RIL population family materials obtained by hybridization of Yuhua 15 and W1202. The genetic map contains 20 linkage groups and 4561 bin markers. QTL positioning was performed using the composite interval mapping method (ICIM), and the parameters were set as follows: scanning step size 0.1cM, LOD value threshold set to 2.5. MapChart 2.3 was used to draw the QTL region of LG02.

[0058] Combining the genetic map with the phenotypic data of indoor and field RIL populations, QTL analysis was performed. A stable major QTL interval associated with flower rust resistance was located on chromosome 2, named qPRDA02, which was detected in the above seven environments. The major QTL interval was located at markers Chr2_bin428 to Chr2_bin430, and the physical position was A02:3326229 to A02:3524275 (198.046 kb). A single QTL covered a 1.30 cM region with LOD values ​​of 9.42 to 35.45, which could explain 10.49% to 33.00% of the phenotypic variation ( Figure 1 -A).

[0059] In order to accurately locate the qPRDA02 interval, two parental polymorphic SNP loci were selected in the candidate interval and developed as KASP markers (Table 2). The SNPlineLGC high-throughput genotyping detection platform of Henan Institute of Crop Molecular Breeding was used to genotype 318 RIL families.

[0060] The results of five KASP marker gene analysis were combined with the phenotypic identification results in seven environments for localization analysis. The results showed that the interval Tif1_A02_3282528 to Tif1_A02_3438294 could be detected in all seven environments, with LOD values ​​ranging from 6.97 to 25.62, explaining 9.62% to 29.88% of the phenotypic variation. That is, qPRDA02 was finely localized between Tif1_A02_3282528 and Tif1_A02_3438294, and the candidate interval was shortened from 198.05 kb to 155.77 kb ( Figure 1 -B).

[0061] Table 2 KASP marker primer information

[0062]

[0063] 7. Determination of primer set for KASP molecular marker Tif1_A02_3438294 for flower rust resistance

[0064] The polymorphic SNPs were screened using the annotation database of the Tifrunner1 reference genome (https: / / www.peanutbase.org / ), and 54 SNPs and 5 InDels were found in the qPRDA02 confidence interval (A02: 3132528-3588294, 455.766 kb). Among them, the variation of 2 SNPs was located at the position where the gene sequence existed, at A02.3282528 (intron region of gene arahy.PFB3JH) and A02.3379195 (5'UTR region of gene arahy.1M3QP5), neither of which was involved in encoding amino acids. In the confidence interval of qPRDA02, there is only one large fragment InDel, located at the promoter position of the disease resistance-related gene arahy.60VTT9, that is, compared with the Tifrunner1 reference genome and the Yuhua 15 genome, W1202 lacks 32bp (TGCCCGTTGGCCCTAATGATGCATAAGGAGCG) (SEQ ID NO.18). The existence of the 32bp deletion was confirmed by biotechnology such as gene cloning and positive single clone sequencing. Large fragment deletions usually involve frameshift mutations of tens to tens of thousands of base pairs. This deletion can affect the structure and function of the gene. Therefore, it is speculated that the large fragment deletion will cause changes in the function of the gene arahy.60VTT9, thereby leading to differences in rust resistance in peanut materials. There is a KSAP marker Tif1_A02_3438294 upstream of this gene that can successfully type the family genotype and is presumed to be linked to the floral rust trait. Therefore, the primer set of the KASP molecular marker Tif1_A02_3438294 in Table 2 was determined as the primer set for detecting floral rust resistance.

[0065] That is, the primers for KASP molecular marker Tif1_A02_3438294 include:

[0066] Upstream primer 1: ATTTCCTTCCTAATCCCGTAGGATTC (SEQ ID NO. 1)

[0067] Upstream primer 2: AATTTTCCTTCCTAATCCGTAGGATTT (SEQ ID NO. 2)

[0068] Downstream primer 3: TTACTCGTGAAAAACAATGGCCGTAAAC (SEQ ID NO. 3)

[0069] The KASP molecular marker SNP site Tif1_A02_3438294 is located on peanut chromosome 2, and the mutation site is: G / A,

[0070] The sequence of the first 100 bp of the mutation site is:

[0071] AGGTACACCGTGAGAGCCAATCACAGTTTCTACTCTATACATAAACAGTGG

[0072] CTGATAGGGACAGATTACTCGTGAAAAACAATGGCCGTAAACCGTGGCT(SEQ ID NO.4)

[0073] The sequence of 100 bp after the mutation site is:

[0074] AATCCTACGGATTAGGAAGGAAAATTGGCAGGCATATACCGTGGTTGCCTA

[0075] CCACGGTTTACGAAGAGGAGACATTCAAAGGTAAAATCCCTTACTTCCC (SEQ ID NO. 5).

[0076] 8. Validation of KASP molecular marker (Tif1_A02_3438294) primer set

[0077] To verify the above markers, statistical analysis was performed based on the rust phenotypes of the RIL population in the artificial climate chamber and in the field. Figure 2 This is the phenotyping diagram of 318 RIL families using the KASP marker (Tif1_A02_3438294) in an indoor environment. It can be seen that for the marker Tif1_A02_3438294, the average disease index of the family with the same maternal genotype (A:A type) was 65.94, which was significantly higher than the average value (48.28) of the family with the same paternal genotype (G:G type) (P < 0.05).

[0078] At the same time, when the detected material is consistent with the maternal genotype, showing A:A type, the disease index of the material is high, and the disease resistance evaluation is rust susceptible; when the detected material is consistent with the paternal genotype, showing G:G type, the disease index of the material is low, and the disease resistance evaluation is rust resistant. This shows that the molecular marker typing effect of the present invention is good, and it is linked to the flower rust trait, and the marker can be used for genotype selection to achieve early identification of rust traits.

[0079] Example 2. Detection and application of peanut SNP locus genotype

[0080] 100 peanut families were randomly selected from the RIL population constructed from Yuhua 15 (female parent, susceptible to rust) and W1202 (male parent, resistant to rust), and the DNA of the peanut families was extracted using the steps in Example 1. Then, the KASP molecular marker (Tif1_A02_3438294) primer set was used to add a fluorescent label to perform PCR amplification and genotype detection on the SNP site.

[0081] The primer set for Tif1_A02_3438294 is:

[0082] Upstream primer 1: ATTTCCTTCCTAATCCCGTAGGATTC (SEQ ID NO. 1)

[0083] Upstream primer 2: AATTTTCCTTCCTAATCCGTAGGATTT (SEQ ID NO. 2)

[0084] Downstream primer 3: TTACTCGTGAAAAACAATGGCCGTAAAC (SEQ ID NO. 3)

[0085] Fluorescent tag 1: 5'-gaaggtgaccaagttcatgct (SEQ ID NO. 19), which is a universal tag sequence corresponding to FAM fluorescence;

[0086] Fluorescent tag 2: 5'-gaaggtcggagtcaacggatt (SEQ ID NO. 20), which is the universal tag sequence corresponding to HEX fluorescence;

[0087] The fluorescent label is directly added to the front end of the corresponding primer, that is, the upstream primer 1 becomes the upstream primer 1-FAM:

[0088] 5'-gaaggtgaccaagttcatgctATTTTCCTTCCTAATCCGTAGGATTC (SEQ ID NO. 21) (the lowercase letters are the universal tag sequence corresponding to FAM fluorescence);

[0089] Upstream Primer 2 becomes Upstream Primer 2-HEX:

[0090] 5'-gaaggtcggagtcaacggattAATTTTCCTTCCTAATCCGTAGGATTT (SEQ ID NO. 22) (the lowercase letter part is the universal tag sequence corresponding to HEX fluorescence).

[0091] The PCR amplification system was: 2 μL DNA at a concentration of 20 ng / μL, 1 μL 1×PARMS master mix, and 1 μL Primer Mix. The Primer Mix included upstream primer 1 (1-FAM primer), upstream primer 2 (2-HEX primer), and downstream primer 3 (Com primer). The concentrations of the two upstream primer working solutions were both 150 nM; the concentration of the downstream primer working solution was 400 nM. The PCR amplification program was: 94°C pre-denaturation for 15 min; 94°C denaturation for 20 s, 55-61°C annealing / extension for 60 s, 0.6°C lowered for each cycle, 10 cycles; 94°C denaturation for 20 s, 55°C annealing / extension for 60 s, 26 cycles.

[0092] High-throughput genotyping was performed using the SNP Line typing platform (LGC, UK), and SNP viewer software was used to perform genotyping and data analysis on PCR products.

[0093] During the detection, if the homozygous susceptible is detected, the pattern is red; if the homozygous resistant is detected, the pattern is blue; the heterozygous resistant signal is green; the blank sample has no signal and is black. Figure 3 shown.

[0094] Figure 3 In the figure, black dots represent the blank control NTC without template DNA; red dots represent families carrying the A allele variant site, where there is a FAM fluorescence signal value; blue dots represent families carrying the G allele variant site, where there is a HEX fluorescence signal value. Figure 2 There are no heterozygotes and no green FAM HEX fluorescence signal value.

[0095] Then, the rust resistance of the material was predicted and identified based on the genotype of the locus, that is, when the genotype was A:A, the disease index of the material was high, and the disease resistance evaluation should be shown as susceptible to rust; when the genotype was G:G, the disease index of the material was low, and the disease resistance evaluation should be shown as resistant to rust, and the prediction results were verified indoors and in the field. The results are shown in Table 3. Among the 100 peanut materials, there were 70 materials with the genotype of A:A at the locus, and 30 materials with the genotype of G:G, so it was predicted that there were 70 susceptible materials and 30 resistant materials.

[0096] Indoor rust phenotype verification results: Among the 100 peanut materials, 32 materials were highly susceptible, 38 materials were susceptible, and a total of 70 materials were susceptible; 11 materials were resistant, 19 materials were moderately resistant, and a total of 30 materials were resistant, which was consistent with the predicted results.

[0097] Field rust phenotypic verification results: Among the 100 peanut materials, 42 materials were highly susceptible, 27 materials were susceptible, and a total of 69 susceptible materials; 10 materials were resistant, and 21 materials were moderately resistant, and a total of 31 resistant materials, which were basically consistent with the predicted results.

[0098] Table 3 Genotypes, disease index and disease resistance evaluation of 100 materials

[0099]

[0100]

[0101]

Claims

1. A KASP molecular marker primer set for detecting flower rust resistance, characterized in that: The primer set includes upstream primer 1, upstream primer 2 and downstream primer 3; Upstream primer 1: ATTTCCTTCCTAATCCCGTAGGATTC, SEQ ID NO. 1; Upstream primer 2: AATTTTCCTTCCTAATCCGTAGGATTT, SEQ ID NO. 2; Downstream primer 3: TTACTCGTGAAAAACAATGGCCGTAAAC, SEQ ID NO. 3; The SNP site of the KASP molecular marker is Tif1_A02_3438294, located on chromosome 2 of the cultivated peanut variety, the mutation site is: G / A, and the sequences of 100 bp before and after the mutation site are: SEQ ID NO.4: AGGTACACCGTGAGAGCCAATCACAGTTTCTACTCTATACATAAACAGTGG CTGATAGGGACAGATTACTCGTGAAAAACAATGGCCGTAAACCGTGGCT; SEQ ID NO.5: AATCCTACGGATTAGGAAGGAAAATTGGCAGGCATATACCGTGGTTGCCTA CCACGGTTTACGAAGAGGAGACATTCAAAGGTAAAATCCCTTACTTCCC.

2. A detection reagent or kit containing the KASP molecular marker primer set according to claim 1.

3. A method for detecting flower rust using the KASP molecular marker primer set according to claim 1, characterized in that: Extract DNA from the peanut material to be identified, use KASP molecular marker primer set to perform PCR amplification and genotype detection on the SNP site Tif1_A02_3438294, and predict the resistance of the peanut material to be identified to rust according to the genotype of the SNP site; The judgment method is as follows: when the genotype of the SNP site Tif1_A02_3438294 is G:G, the peanut material is resistant to the disease; when the genotype of the SNP site Tif1_A02_3438294 is A:A, the peanut material is susceptible to the disease.

4. Use of the KASP molecular marker primer set according to claim 1 in detecting floral rust.

Images