KASP molecular markers, primers, kits and applications linked to pepper stylar color

By developing KASP molecular markers and primers that are tightly linked to the stigma color of chili peppers, and utilizing PCR and fluorescence signal scanning technologies, the problems of high cost and long time in the production of hybrid chili pepper seeds have been solved, enabling rapid and accurate seed purity identification and breeding assistance during the seedling stage.

CN118895381BActive Publication Date: 2025-11-25HUNAN AGRI UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411070404.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-06
Publication Date
2025-11-25
Estimated Expiration
2044-08-06

AI Technical Summary

Technical Problem

The existing artificial emasculation and pollination method in the production of hybrid chili seeds is costly, prone to errors, and time-consuming in the field, and is easily affected by the environment, resulting in economic losses and inaccurate identification.

Method used

We developed a KASP molecular marker closely linked to the stigma color of peppers. Using the 148515563 locus of the zhangshugang version of the gene, we designed specific primers and a kit to rapidly identify stigma color and seed purity via PCR and fluorescence signal scanning.

Benefits of technology

This method enables rapid and accurate identification of pepper stigma color and seed purity during the seedling stage, reducing environmental impact, shortening the breeding cycle, improving identification efficiency and accuracy, reducing later workload, and allowing seeds to be marketed earlier.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118895381B_ABST
    Figure CN118895381B_ABST
Patent Text Reader

Abstract

The application discloses a KASP molecular marker closely linked with pepper stem tip color, takes a zhangshugang version gene as a reference gene, and the KASP molecular marker is at 148515563 of a pepper 10th chromosome, a single nucleotide polymorphism at the position, and a base C to A replacement occurs at the position. The application further discloses primers, a kit for identifying the KASP molecular marker closely linked with the pepper stem tip color, and application of the KASP molecular marker in identifying the pepper stem tip color or identifying purity of pepper seeds. The KASP molecular marker closely linked with the pepper stem tip color gene, and the primers and the kit developed according to the KASP molecular marker can be used for identifying the pepper stem tip color and identifying the seed purity, can be detected at a seedling stage, and the identification method is carried out indoors, so that influences of natural factors such as weather, diseases and insect pests are avoided, and true and false hybrid seeds can be identified early, fast and accurately, and the seeds can be put on the market early.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of chili molecular breeding, and particularly relates to a KASP molecular marker, primer, kit, and application that is closely linked to the stigma color of chili peppers. Background Technology

[0002] Anthocyanins, also known as anthocyanidins, are a class of water-soluble natural pigments widely found in plants. They belong to the flavonoid family of compounds and are the main coloring substances in plant petals, contributing to the vibrant colors of fruits, vegetables, and flowers. The direct precursor in anthocyanin biosynthesis is phenylalanine, which forms 4-coumaryl-CoA under the catalysis of phenylalanine lyase (PAL), cinnamic acid hydroxylase (C4H), and coumarate-CoA ligase (4CL). Subsequently, 4-coumaryl-CoA is catalyzed by chalcone synthase (CHS) to produce yellow chalcone, which is then catalyzed by chalcone isomerase (CHI) and flavanone 3-hydroxylase (F3H) to form dihydroflavonol. Dihydroflavonol is further catalyzed by flavonoid 3′-hydroxylase (F3′H) and flavonoid 3′-hydroxylase. Catalyzed by 5′-hydroxylase (F3′5′H), the precursors for anthocyanin synthesis—dihydroquercetin and dihydromyricetin—are formed. These precursors are then converted into colorless anthocyanins by dihydroflavonol-4-reductase (DFR), which in turn catalyzes the formation of colored anthocyanins by colorless anthocyanin dioxygenase / anthocyanin synthase (LDOX / ANS). Finally, anthocyanins are converted into stable anthocyanins by forming glycosidic bonds with one or more glucose, rhamnose, galactose, xylose, and arabinose under the action of glucosyltransferase.

[0003] Current progress in cloning anthocyanin genes in chili peppers includes: Ouyang Bo from Huazhong Agricultural University screened a mutant with a green hypocotyl using EMS mutagenesis and located the HY5 gene using BSA. This gene can bind to the promoters of genes involved in anthocyanin synthesis, such as F3H, DFR, and ANS, directly regulating anthocyanin synthesis. Wangjin from Hunan Agricultural University obtained a mutant with a purple hypocotyl from Zhangshugang chili peppers using EMS mutagenesis and identified the TTG1 gene using BSA combined with KASP technology. This gene can form the MBW complex to regulate anthocyanin (purple) formation. The cloning of these two genes has improved the mechanism of color formation in chili peppers and provided important information for identifying hybrid F1 in chili pepper breeding, helping to reduce the cost of manual screening.

[0004] Hybrid peppers play a vital role in my country's vegetable production and supply. Currently, the main method for producing hybrid pepper seeds is manual pollination, which involves removing pollinators and emasculating the seeds. This method is costly and prone to producing false hybrids due to incomplete or untimely emasculation, leading to economic losses. The primary method for identifying the purity of hybrid pepper seeds is field testing. Samples of hybrid seeds are planted in the field, and the agronomic traits of the plants are observed: fruit size, plant height, plant width, leaf shape, etc. If these traits match those of F1, the plant is identified as an F1 hybrid. This method is the most widely used and has the advantage of being intuitive, fully showcasing the characteristics of the variety. It can also clearly demonstrate if the seed purity of the producer is substandard, providing strong persuasiveness. However, it is time-consuming, requiring observation of traits throughout the entire growth period, from sowing to fruit maturity, typically taking 3-4 months. Furthermore, cultivation management is susceptible to natural or human factors such as pests, diseases, fertilizer burn, waterlogging, drought, and typhoons, affecting the identification of the current season's results. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a KASP molecular marker, primer, kit and application that is closely linked to the color of pepper stigma.

[0006] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0007] A KASP molecular marker closely linked to the stigma color of chili peppers, using the zhangshugang version of the gene as a reference gene, is described. The KASP molecular marker is located at position 148515563 on chromosome 10 of chili peppers, where a single nucleotide polymorphism occurs, and a C-to-A substitution occurs.

[0008] The nucleotide sequence of the KASP molecular markers closely linked to the color of the pepper stigma is as follows:

[0009] CGGCCTCGTGAGAGTGTGTGCCGCATATATAGATACTAAAATGTAGTAAAATATATGACTAAATTGGACTTGTTATGAATACTCCAATAATCTGTACAACATCGTTGCAAGTAAGGAAAGGTGCATGGAATGAAGAAGAAGATTTTCTTTTGAGAAAATGCATTGAAAAATATGGTGAAGGAAAGTGGCACCTTGTTCCTG[C / A]TAGAGCTGGTAAAACTAACCACTACTACTTTCTC CGTCTCATTTTAACGAGTTTCAAAAGTCTTTATTTCTTTATGTGCAGGTCTAAATAGATGT CGGAAGAGCTGCAGACTTCGGTGGTTGAATTATCTGAGGCCACATATCAAGAGAGGTGA CTTCGATCCAGATGAAGTGGATCTCATTTTGAGGCTTCATAAGCTCT.

[0010] As a general inventive concept, the present invention also provides primers for identifying KASP molecular markers closely linked to the color of pepper stigmas, comprising:

[0011] Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTGAAAGTGGCACCTTGTTCCTGC-3';

[0012] Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTGAAAGTGGCACCTTGTTCCTGA-3';

[0013] Reverse primer: 5'-TGCAGCTCTTCCGACATCTATTTA-3'.

[0014] Preferably, the 5' ends of the two forward primers are connected to different fluorescent adapter sequences. Forward primer 1 has a FAM fluorescent adapter sequence at its 5' end, and blue fluorescence is detected by fluorescence signal scanning. Forward primer 2 has a HEX fluorescent adapter sequence at its 5' end, and green fluorescence is detected by fluorescence signal scanning. The FAM and HEX fluorescent adapter sequences are as follows:

[0015] FAM fluorescent linker sequence: GAAGGTGACCAAGTTCATGCT;

[0016] HEX fluorescent linker sequence: GAAGGTCGGAGTCAACGGATT.

[0017] As a general inventive concept, the present invention also provides a kit for identifying KASP molecular markers closely linked to the color of pepper stigmas, comprising the primers described above.

[0018] As a general inventive concept, the present invention also provides the application of the above-mentioned KASP molecular marker, primer, or kit in identifying the color of pepper stigmas or the purity of pepper seeds.

[0019] In the above application, preferably, using the Zhangshugang genome version of chili pepper as a reference, when the base at position 148515563 on chromosome 10 of chili pepper is identified as homozygous C, the plant is determined to be a chili pepper plant with a white stigma; when the base at position 148515563 on chromosome 10 of chili pepper is identified as homozygous A, the plant is determined to be a chili pepper plant with a purple stigma; when the base at position 148515563 on chromosome 10 of chili pepper is identified as heterozygous C / A, the plant is determined to be a chili pepper plant with a purple stigma.

[0020] Alternatively, using the zhangshugang genome version of chili pepper as a reference, if the base at position 148515563 on chromosome 10 of chili pepper is homozygous C, the seed is determined to be the parent with a white stigma; if the base at position 148515563 on chromosome 10 of chili pepper is homozygous A, the seed is determined to be the parent with a purple stigma; if the base at position 148515563 on chromosome 10 of chili pepper is heterozygous C / A, the seed is determined to be a true hybrid with a purple stigma.

[0021] The above application, preferably, includes the following steps:

[0022] (1) Extract the DNA of the pepper population to be tested as a template, and perform PCR amplification using the molecular markers described in claim 1 or 2, the primers described in claim 3 or 4, or the kit described in claim 5 to obtain the amplification product;

[0023] (2) Perform fluorescence signal scanning and genotyping on the amplification products.

[0024] In the above application, preferably, the PCR amplification program in step (1) includes: 94℃ for 900 seconds; 94℃ for 20 seconds; 78℃ for 10 seconds; TD for 62℃; 0 Cyc->57 (-0℃), 10 cycles; 94℃ for 20 seconds; 57℃ for 60 seconds, 35 cycles; Cooling for 37℃ for 30 seconds.

[0025] In the above application, preferably, in step (2), when the fluorescent group and the corresponding fluorescence quencher group are close to each other, the fluorescence emitted by the fluorescent group will be absorbed by the quencher group, emitting fluorescence at a longer wavelength or releasing heat. At this time, the fluorescence signal of the group cannot be detected within the wavelength corresponding to this fluorescence. Once the two are separated, the fluorescence signal can be detected. PARMS uses the FRET principle to detect the amplification signals of FAM and HEX fluorescent primers. When the corresponding allele is amplified, the corresponding fluorescence signal will appear. When scanning the amplification products for fluorescence signals, if only the fluorescence signal (blue fluorescence) corresponding to the forward primer 1 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is a homozygous C:C genotype, and the plant is determined to be a chili pepper plant with a white stigma and / or the seed is determined to be a chili pepper parent with a white stigma; if only the fluorescence signal (green fluorescence) corresponding to the forward primer 2 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is a homozygous A:A genotype, and the plant is determined to be a chili pepper plant with a purple stigma and / or the seed is determined to be a chili pepper parent with a purple stigma; if the fluorescence signal (red fluorescence) corresponding to both the forward primers 1 and 2 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is a heterozygous C:A genotype, and the plant is determined to be a chili pepper plant with a purple stigma and / or the seed is determined to be a true hybrid of a chili pepper with a purple stigma.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] (1) This invention locates a novel gene controlling the stigma color of chili peppers and, based on the mutation site of this gene, develops a KASP molecular marker closely linked to the chili pepper stigma color gene. Primers and kits for this molecular marker have also been developed for the identification of chili pepper stigma color. Furthermore, relying on this molecular marker for assisted breeding can effectively solve the problems of long conventional breeding cycles and susceptibility to environmental influences. This marker can also be used for purity identification; hybrids can be quickly screened and their purity calculated during the seedling stage, allowing seeds to be marketed earlier. This effectively reduces the planting scale, decreases the workload of later identification, and improves the efficiency and accuracy of hybrid identification.

[0028] (2) The KASP molecular marker of the present invention can be detected in the seedling stage, that is, about 7 days after the seed germinates. The identification method is carried out indoors, avoiding the influence of natural factors such as weather and pests. It can quickly and accurately identify true and false hybrids in advance, and the seeds can be put on the market earlier.

[0029] (3) The KASP molecular marker of the present invention, which is closely linked to the stigma color gene of pepper, is of great significance for studying the formation mechanism of stigma color. Attached Figure Description

[0030] Figure 1 This is a graph of a 50K chip combined with a genome-wide association study (GWAS) in an embodiment of the present invention;

[0031] Figure 2 This is a genotyping diagram of the stigma color of the breeding population detected by KASP in an embodiment of the present invention;

[0032] Figure 3 This is a phenotypic diagram of the color of the parent and F1 stigmas in an embodiment of the present invention;

[0033] Figure 4 This is a genotyping diagram for KASP detection of hybrid purity in an embodiment of the present invention. Detailed Implementation

[0034] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0035] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0036] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0037] Example:

[0038] I. Obtaining KASP molecular markers linked to the pepper stigma color gene

[0039] 1. Phenotypic identification of the population

[0040] The 191 collected chili pepper materials were planted, and the stigma color phenotype of the population was investigated during the full bloom period. The phenotypic identification of the stigma color trait was completed in accordance with the chili pepper germplasm resource survey specifications.

[0041] 2. GWAS analysis of column head color

[0042] Using a 50K chip for capture sequencing, a genome-wide association study (GWAS) was performed on the pepper stigma color trait based on the sequencing results. 29,450 SNPs (MAF > 0.05) were extracted for chlorate-sensitive trait GWAS analysis, and an MLM linear mixture model association analysis was performed using TASSEL 4.0 software. A Manhattan plot was generated using R language. Genome-wide association analysis (GWAS) involves searching for sequence variations, i.e., single nucleotide polymorphisms (SNPs), across different individuals in the entire genome to detect genes or QTLs significantly associated with the trait. GEMMA uses a mixed linear model (MLM) to detect the significance of associations between traits and genetic markers. MLM incorporates population genetic structure (as a fixed effect) and individual kinship matrix (as a random effect) to correct for the influence of population structure and individual kinship. The p-value obtained from the association significance test was corrected through multiple hypothesis testing. A genome-wide association analysis was then performed on stigma color, as shown below. Figure 1 As shown, a strong GWAS signal was found on chromosome 10, and the significantly associated SNP site was ultimately identified at Chr10_148515563, whose nucleotide sequence is shown in SEQ ID NO:1:

[0043] CGGCCTCGTGAGAGTGTGTGCCGCATATATAGATACTAAAATGTAGTAAAATATATGACTAAATTGGACTTGTTATGAATACTCCAATAATCTGTACAACATCGTTGCAAGTAAGGAAAGGTGCATGGAATGAAGAAGAAGATTTTCTTTTGAGAAAATGCATTGAAAAATATGGTGAAGGAAAGTGGCACCTTGTTCCTG[C / A]TAGAGCTGGTAAAACTAACCACTACTACTTTCTC CGTCTCATTTTAACGAGTTTCAAAAGTCTTTATTTCTTTATGTGCAGGTCTAAATAGATGT CGGAAGAGCTGCAGACTTCGGTGGTTGAATTATCTGAGGCCACATATCAAGAGAGGTGA CTTCGATCCAGATGAAGTGGATCTCATTTTGAGGCTTCATAAGCTCT.

[0044] 3. Development of molecular markers linked to stigma color

[0045] Marker development was conducted on the highest GWAS values ​​around 2M. The SNP screening criteria were as follows: the SNP quality of a single sample was prioritized for filtering, the depth of a single sample was <200, and loci with a minimum allele frequency below 0.05 were discarded; loci with a heterozygosity greater than 0.2 in the population were also discarded. Marker screening was then carried out, and the design was based on KASP markers, which were tested in the breeding population.

[0046] Ultimately, Chr10_148515563 was chosen for KASP marking. It was found that they could all be well classified and could distinguish different column head colors (purple and white), laying the groundwork for better differentiation of material types.

[0047] II. Application of KASP molecular markers linked to the pepper stigma color gene

[0048] 1. DNA was extracted from 43 individual plants in the GWAS population using the CTAB method.

[0049] (1) Dithiothreitol (DTT, 0.2%) was added to the CTAB extract;

[0050] (2) Add two fresh leaves the size of the centrifuge tube cap to a 2.0 ml centrifuge tube; grind them thoroughly into powder with liquid nitrogen, add 800-900 μL of CTAB buffer, and mix well;

[0051] (3) Bath in a 65℃ water bath for 30 minutes, gently inverting and shaking twice during the bath. After the water bath, cool the room temperature to below 15℃.

[0052] (4) Add 500 chloroform / isoamyl alcohol (24:1) and mix well for 4 min to ensure that the sample is fully mixed with chloroform;

[0053] (5) Centrifuge at 12,000 rpm for 10 min, take 500 μL of the supernatant, add it to a 1.5 mL centrifuge tube containing 500 μL of isopropanol, and gently invert to mix; let stand in a 4℃ refrigerator for 30 minutes.

[0054] (6) Centrifuge at 12,000 rpm for 15 min, discard the supernatant, wash the precipitate with 500 μL of 75% alcohol, centrifuge at 12,000 rpm for 5 min, and discard the supernatant.

[0055] (7) Air-dry the DNA to allow the alcohol to evaporate completely; add 100 μL of pure water (containing RNase at a final concentration of 1%) to dissolve the DNA;

[0056] (8) Remove RNA by water bath at 37℃ for 1 hour; take DNA for electrophoresis detection, and after confirming that the bands are intact, use a micro spectrophotometer to determine the DNA concentration. The ratio of 260 / 280 and 260 / 230 should be greater than 1.8. Dilute the DNA to 100 ng and store at -20℃ for later use.

[0057] 2. Detection of KASP markers in column head color

[0058] (1) KASP primer reagents generally consist of 3 primers, of which 2 are allele-specific forward primers and 1 is a universal reverse primer. The 3' bases of the 2 allele-specific forward primers are different, corresponding to different alleles. The allele-specific forward primers will produce different fluorescence signals through competitive PCR reactions. The adapter sequence that matches FAM fluorescence is GAAGGTGACCAAGTTCATGCT (as shown in SEQ ID NO:2), and the adapter sequence that matches HE X fluorescence is GAAGGTCGGAGTCAACGGATT (as shown in SEQ ID NO:3).

[0059] KASP primers were designed by SNPWay (http: / / www.snpway.com / ) and synthesized by Qingke Biotechnology (PAGE purification).

[0060] Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTGAAAGTGGCACCTTGTTCCTGC-3' (as shown in SEQ ID NO: 4);

[0061] Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTGAAAGTGGCACCTTGTTCCTGA-3' (as shown in SEQ ID NO: 5);

[0062] Reverse primer: 5'-TGCAGCTCTTCCGACATCTATTTA-3' (as shown in SEQ ID NO:6).

[0063] (2) PCR amplification was performed using the above primers, and the reaction system is shown in Table 1.

[0064] Table 1: PCR reaction system

[0065]

[0066] PCR amplification was used, and the amplification program was as follows:

[0067] Preincubation: 94℃ for 900 seconds; 94℃ for 20 seconds; 78℃ for 10 seconds, TD at 62℃, 0 Cyc → 57 (-0℃), 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, 35 cycles; Cooling: 37℃ for 30 seconds.

[0068] (3) Genotyping analysis: When performing fluorescence detection on the amplification products, if only the fluorescence signal (blue fluorescence) corresponding to the forward primer 1 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is a homozygous C:C genotype, and it is determined to be a single plant with a white pepper stigma; if only the fluorescence signal (green fluorescence) corresponding to the forward primer 2 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is a homozygous A:A genotype, and it is determined to be a single plant with a purple pepper stigma; if the fluorescence signal (red fluorescence) corresponding to both the forward primers 1 and 2 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is a heterozygous C:A genotype, and it is determined to be a single plant with a purple pepper stigma.

[0069] The results are as follows Figure 2 As shown, three fluorescent signals appeared. Some results are shown in Table 2. The genotype identification results are consistent with the phenotypic identification results.

[0070] Table 2. Stigma color and genotype of KASP in breeding materials

[0071]

[0072]

[0073] III. Application of KASP molecular markers linked to the pepper stigma color gene in seed purity identification

[0074] Xingshu 215 is a purple-stigma hybrid obtained by crossing the backbone parents 8214 (purple stigma) and 6421 (white stigma). Using the Chr10_148515563 marker for KASP typing and combined with field survey phenotypes, it was found that this marker can be used to identify the purity of Xingshu 215. It can identify true and false hybrids at the seedling stage and calculate seed purity (seed purity = true hybrid / total number of seeds), which can save field identification work and allow the variety to be marketed earlier, thus creating economic benefits.

[0075] 188 samples of "Xingshu 215" were tested using Chr10_148515563. Figure 3 Phenotypic diagrams of the female parent (left), male parent (middle), and hybrid (right) of "Xingshu 215"; Figure 4 Table 2 shows the genotyping results of the F1 hybrids detected by KASP molecular markers, and Table 3 shows the purity identification results.

[0076] Table 2. Genotypes and determination of true and false hybrids based on Chr10_148515563 marker detection.

[0077]

[0078]

[0079]

[0080]

[0081]

[0082] Table 3. Purity Identification Results

[0083]

[0084]

Claims

1. A KASP molecular marker closely linked to the color of the stigma of chili peppers, characterized in that, Using the zhangshugang version of the gene as a reference gene, the KASP molecular marker is located at position 148515563 on chromosome 10 of pepper, where a single nucleotide polymorphism occurs, indicating a C-to-A substitution. Its nucleotide sequence is as follows: CGGCCTCGTGAGAGTGTGTGCGCATATATAGATACTAAAATGTAGTAAAATATATGACTAAATTGGACTTGTTATGAATACTCCAATAATCTGTACAACATCGTTGCAAGTAAGGAAAGGTGCATGGAATGAAGAAGAAGATTTTCTTTTGAGAAAATGCATTGAAAAATATGGTGAAGGAAAGTGGCACCTTGTTCCTG[C / A]TAGAGCTGGTAAAACTAACCACTACTTTCTCCGTCTCATTTTAACGAGTTTCAAAAGTCTTTATTTCTTTATGTGCAGGTCTAAATAGATGTCGGAAGAGCTGCAGACTTCGGTGGTTGAATTATCTGAGGCCACATATCAAGAGAGGTGACTTCGATCCAGATGAAGTGGATCTCATTTTGAGGCTTCATAAGCTCT.

2. A primer for identifying a KASP molecular marker closely linked to the color of the stigma of chili pepper, characterized in that, include: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTGAAAGTGGCACCTTGTTCCTGC-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTGAAAGTGGCACCTTGTTCCTGA-3'; Reverse primer: 5'-TGCAGCTCTTCCGACATCTATTTA-3'.

3. The primer as described in claim 2, characterized in that, The 5' ends of the two forward primers are connected to different fluorescent adapter sequences. Forward primer 1 has a FAM fluorescent adapter sequence at its 5' end, and forward primer 2 has a HEX fluorescent adapter sequence at its 5' end. The FAM and HEX fluorescent adapter sequences are as follows: FAM fluorescent linker sequence: GAAGGTGACCAAGTTCATGCT; HEX fluorescent linker sequence: GAAGGTCGGAGTCAACGGATT.

4. A kit for identifying KASP molecular markers closely linked to the color of pepper stigmas, characterized in that, Includes the primers described in claim 2 or 3.

5. The application of a primer as described in claim 2 or 3 or a kit as described in claim 4 in identifying the color of pepper stigmas or in identifying the purity of pepper seeds by pepper stigma color, wherein the pepper stigma color is white or purple.

6. The application as described in claim 5, characterized in that, Using the Zhangshugang genome version of chili pepper as a reference, when the base at position 148515563 on chromosome 10 of chili pepper is identified as homozygous C, the plant is determined to be a chili pepper with a white stigma; when the base at position 148515563 on chromosome 10 of chili pepper is identified as homozygous A, the plant is determined to be a chili pepper with a purple stigma; when the base at position 148515563 on chromosome 10 of chili pepper is identified as heterozygous C / A, the plant is determined to be a chili pepper with a purple stigma. Alternatively, using the Zhangshugang genome version of chili pepper as a reference, if the base at position 148515563 on chromosome 10 of chili pepper is homozygous C, the seed is determined to be the parent with a white stigma; if the base at position 148515563 on chromosome 10 of chili pepper is homozygous A, the seed is determined to be the parent with a purple stigma; if the base at position 148515563 on chromosome 10 of chili pepper is heterozygous C / A, the seed is determined to be a true hybrid with a purple stigma.

7. The application as described in claim 5, characterized in that, Includes the following steps: (1) Extract the DNA of the pepper population to be tested as a template, and perform PCR amplification using the primers as described in claim 2 or 3 or the kit as described in claim 4 to obtain the amplification product; (2) Perform fluorescence signal scanning and genotyping on the amplification products.

8. The application as described in claim 7, characterized in that, In step (2), when scanning the amplification product for fluorescence signals, if only the fluorescence signal corresponding to the forward primer 1 connected to the fluorescent adapter sequence is detected in the amplification product, the detection site is a homozygous C:C genotype, and the plant is determined to be a plant with a white stigma of pepper or / and the seed is determined to be a parent of pepper with a white stigma; if only the fluorescence signal corresponding to the forward primer 2 connected to the fluorescent adapter sequence is detected in the amplification product, the detection site is a homozygous A:A genotype, and the plant is determined to be a plant with a purple stigma of pepper or / and the seed is determined to be a parent of pepper with a purple stigma; if the fluorescence signal corresponding to both the forward primers 1 and 2 connected to the fluorescent adapter sequence is detected in the amplification product, the detection site is a heterozygous C:A genotype, and the plant is determined to be a plant with a purple stigma of pepper or / and the seed is determined to be a true hybrid of pepper with a purple stigma.

Citation Information

Patent Citations

  • KASP molecular marker closely linked with pepper fruit width gene as well as acquisition method, primer, kit and application of KASP molecular marker

    CN117965784A

  • Selection of mature fruit color in pepper plants

    US20140380516A1