Application of β-ketoacyl-ACP synthase III in Bacillus in promoting the secretion efficiency of metabolites of Bacillus
By integrating the fabHB gene for β-ketoacyl-ACP synthase III, the secretion and expression of γ-PGA, AprE, and AprN are enhanced, addressing the limitations of existing technologies and facilitating their industrial application.
Patent Information
- Application Number
- CN202411298270.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-18
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2044-09-18
AI Technical Summary
Bacillus lichens have limitations in the efficient expression and secretion of metabolites such as polygamma-glutamic acid, alkaline proteases and nattokinase, resulting in high production costs, low enzyme expression levels and poor thermal stability, limiting its industrial application.
By integrating the overexpression of the fabHB gene (encoding β-ketoacyl-ACP synthase III) in Bacillus licheniformis, replacing the sigE gene, and using different promoters (such as P43, PykzA, PnadE), promoting efficient secretion and expression of metabolites.
It significantly improved the metabolites secretion efficiency of Bacillus lichens, promoted the efficient expression and industrial production of polyγ-glutamic acid, alkaline proteases and nattokinases, and reduced production costs.
Smart Images

Figure BDA0005046784450000051 
Figure BDA0005046784450000061 
Figure BDA0005046784450000081
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microorganisms, and particularly relates to the application of β-ketoacyl-ACP synthase III in Bacillus in promoting the secretion efficiency of metabolites of Bacillus Background Art
[0002] Bacillus licheniformis has important biological applications in the food industry and pharmaceuticals due to its strong protein expression and secretion capabilities, as well as its unique genetic background and safety characteristics. It can not only be used as an excellent industrial strain to produce foreign proteins or enzyme preparations, but also be used as an industrial production strain to ferment and produce high-value-added chemicals such as poly-γ-glutamic acid, antibiotics, nucleotides, and seasonings. However, the high-efficiency expression system of Bacillus licheniformis still limits the expression of many proteins, and currently it is only limited to the production of a small number of industrial enzymes
[0003] Poly-γ-glutamic acid (γ-PGA) is a multifunctional biopolymer formed by the polymerization of D-glutamic acid and / or L-glutamic acid monomers through γ-amide bonds, and has been applied in industries such as agriculture, cosmetics, food, water treatment, and medicine. Alkaline protease AprE, as the main hydrolase in industry, has excellent characteristics of high catalytic activity and water solubility, and is applied in fields such as detergents, leather processing, and even environmental governance. Nattokinase AprN, as an alkaline serine protease, can dissolve thrombus in vivo through various mechanisms to achieve the purpose of preventing or treating cardiovascular diseases, and has been developed into a new thrombolytic drug. Problems such as high production costs, low enzyme expression levels, and poor thermal stability limit its industrial production. Therefore, further promoting the industrialization process of poly-γ-glutamic acid and achieving the efficient secretion of alkaline protease and nattokinase in Bacillus licheniformis are of great significance for its industrial production, and obtaining excellent microbial chassis cells is the basis of economic benefits
[0004] β-ketoacyl-ACP synthase III in Bacillus is encoded by the gene fabHB, and the effect of enhanced expression of fabHB on the synthesis of target products has not been reported. The present invention promotes the secretion efficiency of various metabolites of Bacillus licheniformis by integrating and overexpressing the gene fabHB, providing effective guidance for increasing the metabolite yield of Bacillus licheniformis as a chassis cell Summary of the Invention
[0005] In view of the above problems, the object of the present invention is to provide the application of β-ketoacyl-ACP synthase III in Bacillus in promoting the secretion efficiency of metabolites of Bacillus
[0006] To achieve the above object, the present invention adopts the following technical solutions
[0007] Application of β-ketoacyl-ACP synthase III in Bacillus in promoting the secretion efficiency of metabolites of Bacillus, where the β-ketoacyl-ACP synthase III is shown as SEQ ID NO.2.
[0008] For the above-mentioned application, preferably, the Bacillus is Bacillus licheniformis.
[0009] For the above-mentioned application, preferably, the coding gene of the β-ketoacyl-ACP synthase III is shown as SEQ ID NO.1.
[0010] For the above-mentioned application, preferably, the Bacillus is Bacillus licheniformis WX-02.
[0011] For the above-mentioned application, preferably, the application process includes: replacing the sigE gene in Bacillus licheniformis WX-02 with the coding gene of β-ketoacyl-ACP synthase III in Bacillus.
[0012] For the above-mentioned application, preferably, the metabolite of Bacillus is the metabolite γ-PGA of Bacillus licheniformis.
[0013] The protection scope of the present invention also includes: the application of β-ketoacyl-ACP synthase III in Bacillus in promoting the expression of exogenous proteins in Bacillus licheniformis.
[0014] For the above-mentioned application, preferably, the exogenous protein is nattokinase or alkaline protease.
[0015] For the above-mentioned application, preferably, when the exogenous protein is nattokinase, the application process includes replacing the sigE gene in Bacillus licheniformis WX-02 with the coding gene of β-ketoacyl-ACP synthase III in Bacillus, and at the same time, the promoter of the coding gene of β-ketoacyl-ACP synthase III is the PnadE promoter; when the exogenous protein is alkaline protease, the application process includes replacing the sigE gene in Bacillus licheniformis WX-02 with the coding gene of β-ketoacyl-ACP synthase III in Bacillus, and at the same time, the promoter of the coding gene of β-ketoacyl-ACP synthase III is the P43 promoter.
[0016] Compared with the prior art, the present invention has the following advantages:
[0017] By integrating and overexpressing the fabHB gene (this gene encodes β-ketoacyl-ACP synthase III) on the genome of Bacillus licheniformis, the present invention obtains an expression system of Bacillus licheniformis that can efficiently secrete poly-γ-glutamic acid, nattokinase, and alkaline protease, laying a foundation for the efficient secretion of polypeptides, promoting the efficient synthesis of poly-γ-glutamic acid, the efficient expression of alkaline protease and nattokinase, and industrial production. Detailed implementation mode
[0018] The technical solutions described in the present invention are conventional solutions in the art unless otherwise specified; the reagents or materials are commercially available unless otherwise specified.
[0019] Example 1:
[0020] Construction of Bacillus licheniformis with high expression of β-ketoacyl-ACP synthase III
[0021] The construction method of WX-02::P43-fabHB includes the following steps:
[0022] (1) According to the gene sequence of the fabHB gene in the genomic DNA sequence of Bacillus licheniformis WX-02 (CN110951797A), the upstream primer (P43-fabHB-F2) and downstream primer (P43-fabHB-R2) of the fabHB gene were designed; using the genomic DNA of Bacillus licheniformis WX-02 as a template, the upstream primer and downstream primer of the fabHB gene were used for PCR amplification to obtain the fabHB gene fragment;
[0023] Among them, the sequences of primers P43-fabHB-F2 and P43-fabHB-R2 are:
[0024] P43-fabHB-F2: ATGAAAACTTTATCAAAAGCGCGAAP43-fabHB-R2: TCCGTCCTCTCTGCTCTTTCAGGAAGCTGGCGCGCC; the amplified fabHB gene is shown in SEQ ID NO.1, and the encoded protein is shown in SEQ IDNO.2.
[0025] (2) Using the genomic DNA of Bacillus subtilis 168 as a template, the P43 promoter was amplified by PCR (the primers used were fabHB-P43-F and fabHB-P43-R); using the genomic DNA of Bacillus licheniformis WX-02 as a template, the amylase terminator was amplified by PCR (the primers used were P43-fabHB-F3 and P43-fabHB-R3), and then the promoter, the target gene fabHB and the terminator were linked together by SOE-PCR (the primers used were fabHB-P43-F and P43-fabHB-R3) to form a complete fabHB expression element;
[0026] Among them, the sequences of the primers fabHB-P43-F, fabHB-P43-R, P43-fabHB-F3, and P43-fabHB-R3 are as follows: fabHB-P43-F: TGGGGCTGAAAAGCGACGTGATAGGTGGTATGTTTT fabHB-P43-R: TGGGGCTGAAAAGCGACGTGATAGGTGGTATGTTTT
[0027] P43-fabHB-F3: GGCGCGCCAGCTTCCTGAAAGAGCAGAGAGGACGGA
[0028] P43-fabHB-R3: CTCCGACAAGCCCGAAACCATCCGTCACAGTCTCAG
[0029] (3) According to the upstream and downstream sequences of the sigE gene in the genomic DNA sequence of Bacillus licheniformis WX-02, the upstream homologous arm primers (P43-fabHB-F1 and P43-fabHB-R1) and downstream homologous arm primers (P43-fabHB-F4 and P43-fabHB-R4) of the sigE gene were designed; and using the genomic DNA of Bacillus licheniformis WX-02 as a template, the upstream homologous arm of the sigE gene and the downstream homologous arm of the sigE gene were obtained by PCR amplification with the upstream homologous arm primers and downstream homologous arm primers of the sigE gene respectively;
[0030] Among them, the sequences of the primers P43-fabHB-F1, P43-fabHB-R1, P43-fabHB-F4, and P43-fabHB-R4 are as follows: P43-fabHB-F1: ACGGCCAGTGCCAAGCTTAGGCCTGCATTGGTGAAC
[0031] P43-fabHB-R1: CGTCGCTTTTCAGCCCCA
[0032] P43-fabHB-F4: CTGAGACTGTGACGGATGGTTTCGGGCTTGTCGGAG
[0033] P43-fabHB-R4: TGACATGATTACGAATTCGAAAACTTAACATTGTGG
[0034] (4) The upstream homologous arm of the sigE gene, the fabHB expression element, and the downstream homologous arm of the sigE gene were ligated together by overlap extension PCR (the primers used were P43-fabHB-F1 and P43-fabHB-R4) to form a target gene fragment, and the arrangement order of this target gene fragment was: the upstream homologous arm of the sigE gene - the fabHB expression element - the downstream homologous arm of the sigE gene; where sigE is a gene in Bacillus that controls the spore formation process;
[0035] (5) The target gene fragment was double-digested with SacI and XbaI restriction endonucleases to obtain a digested gene fragment. At the same time, the plasmid T2(2)-ori was double-digested with SacI and XbaI restriction endonucleases to obtain a linear plasmid fragment;
[0036] (6) The digested gene fragment and the linear plasmid fragment were ligated with DNA ligase to obtain the integrated plasmid T2(2)-P43-fabHB;
[0037] (7) The integrated plasmid T2(2)-P43-fabHB was transferred into Bacillus licheniformis WX-02, and kanamycin resistance was used as a screening marker to screen for positive transformants;
[0038] (8) After the positive transformants were subcultured several times at 45°C, colony PCR detection was performed to obtain positive single crossover conjugant strains in which the upstream homologous arm of the sigE gene or the downstream homologous arm of the sigE gene had a single crossover with the genomic DNA of Bacillus licheniformis WX-02;
[0039] (9) Positive single crossover conjugant strains in which the upstream homologous arm of the sigE gene had a single crossover with the genomic DNA of Bacillus licheniformis WX-02 or positive single crossover conjugant strains in which the downstream homologous arm of the sigE gene had a single crossover with the genomic DNA of Bacillus licheniformis WX-02 were selected and mixed and inoculated in a medium at 37°C without kanamycin and subcultured several times, and Bacillus licheniformis WX-02::P43-fabHB integrated with the fabHB gene was screened by PCR method.
[0040] Other promoter groups: Replace the fabHB gene promoter P43 in WX-02::P43-fabHB;
[0041] Among them, WX-02::PykzA-fabHB is to replace the promoter P43 in the fabHB expression element with PykzA;
[0042] WX-02::PnadE-fabHB is to replace the promoter P43 in the fabHB expression element with PnadE.
[0043] Construction method of WX-02::PykzA-fabHB, comprising the following steps:
[0044] (1) Amplify the fabHB gene fragment according to the method of WX-02::P43-fabHB.
[0045] (2) Using the genomic DNA of Bacillus subtilis 168 as a template, PCR amplify the PykzA promoter (the primers used are fabHB-PykzA-F and fabHB-PykzA-R); using the genomic DNA of Bacillus licheniformis WX-02 as a template, PCR amplify the amylase terminator, and then connect the promoter, target gene and terminator together by SOE-PCR (the primers used are fabHB-PnadE-F and P43-fabHB-R3) to form a complete fabHB expression element;
[0046] Among them, the primers fabHB-PykzA-F, fabHB-PykzA-R,
[0047] fabHB-PykzA-F: TGGGGCTGAAAAGCGACGGAAATATTGATGTGACAC
[0048] fabHB-PykzA-R: TTTTGATAAAGTTTTCATATTTCCCAACCTCCTTAT.
[0049] The remaining steps are the same as those of WX-02::P43-fabHB, and finally Bacillus licheniformis WX-02::PykzA-fabHB integrated with the fabHB gene is prepared.
[0050] Construction method of WX-02::PnadE-fabHB, comprising the following steps:
[0051] (1) Amplify the fabHB gene fragment according to the method of WX-02::P43-fabHB.
[0052] (2) Using the genomic DNA of Bacillus subtilis 168 as a template, PCR amplify the PnadE promoter (the primers used are fabHB-PnadE-F and fabHB-PnadE-R); using the genomic DNA of Bacillus licheniformis WX-02 as a template, PCR amplify the amylase terminator (the primers used are P43-fabHB-F3 and P43-fabHB-R3), and then connect the promoter, target gene and terminator together by SOE-PCR (the primers used are fabHB-PnadE-F and P43-fabHB-R3) to form a complete fabHB expression element;
[0053] fabHB-PnadE-F: TGGGGCTGAAAAGCGACGCTTTGCGCACCTCAATATTC
[0054] fabHB-PnadE-R: TTTTGATAAAGTTTTCATCCGTCACTCCTCCTTTTG。
[0055] The remaining steps are the same as those of WX-02::P43-fabHB, and finally, Bacillus licheniformis WX-02::PnadE-fabHB integrated with the fabHB gene was prepared.
[0056] Example 2:
[0057] Application of Bacillus licheniformis WX-02::P43-fabHB in highly expressing alkaline protease:
[0058] (1) Construction of alkaline protease expression strains: The expression vector (ZL202210471439.7) containing the expression cassette of the alkaline protease gene aprE was electrotransformed into Bacillus licheniformis WX-02, WX-02::PykzA-fabHB, WX-02::P43-fabHB, and WX-02::PnadE-fabHB respectively to obtain Bacillus licheniformis WX / aprE, WX-02::PykzA-fabHB / aprE, WX-02::P43-fabHB / aprE, and WX-02::PnadE-fabHB / aprE with high-yield alkaline protease.
[0059] (2) The above-constructed alkaline protease engineering strains were activated on tetracycline-resistant plates, and then single colonies were picked into PA bottles containing the corresponding resistance and cultured at 37°C and 230 rpm for 12 h. Inoculate into 50 mL of seed liquid containing the corresponding resistance at an inoculation amount of 2%, and culture at 37°C and 230 rpm for 12 h until OD600 reaches 4.0 - 4.5. Finally, inoculate into 20 mL of alkaline protease fermentation medium at an inoculation amount of 3% and culture at 37°C and 230 rpm for 63 h to obtain the fermentation broth. Pipette 2 mL of the fermentation broth and centrifuge at 12000 rpm for 10 min, and the supernatant is the crude alkaline protease solution.
[0060] The described seed liquid: 10 g / L peptone, 5 g / L yeast extract powder, 10 g / L sodium chloride, pH 7.2 - 7.4, and the liquid loading amount in a 250 mL Erlenmeyer flask is 50 mL;
[0061] Fermentation medium: soybean meal 80 g / L, peptone 5 g / L, sodium caseinate 2 g / L, ferric chloride 0.02 g / L, dipotassium hydrogen phosphate 2 g / L, calcium chloride 4 g / L, glucose 20 g / L, pH 7.2 - 7.4, and the liquid loading is 20 mL dispensed in a 250 mL Erlenmeyer flask.
[0062] Add 100 μL of 3% azocasein solution to 1.3 mL of glycine - NaOH (pH 10.0) buffer, incubate in a 50 °C water bath for 2 min; add 100 μL of appropriately diluted enzyme solution thereto, react for 20 min; immediately add 500 μL of 10% TCA solution to terminate the reaction, shake well, and let stand at room temperature for 20 min; centrifuge at 12000×g for 10 min to precipitate the unreacted substrate; take 1.6 mL of the supernatant, add it to 400 μL of 2 mol·L-1 NaOH solution for color development, mix well, and measure the absorbance at 440 nm. Enzyme activity definition: Under specific conditions, the amount of enzyme required to produce an absorbance change of 0.01 within 1 min is defined as one enzyme activity unit.
[0063]
[0064] It can be seen that although the fabHB gene was transferred into all of them, compared with the wild - type strain, for the engineered bacteria using only the P43 promoter, the alkaline protease activity was significantly improved.
[0065] Example 3:
[0066] Application of Bacillus licheniformis WX - 02::PnadE - fabHB in highly expressing nattokinase:
[0067] (1) Construction of nattokinase - expressing strains: The expression vectors
[0068] (ZL201410417443.0) containing the aprN expression cassette of the nattokinase gene were electro - transformed into Bacillus licheniformis WX - 02 and WX - 02::PykzA - fabHB, WX - 02::P43 - fabHB, WX - 02::PnadE - fabHB respectively, to obtain Bacillus licheniformis WX / aprN, WX - 02::PykzA - fabHB / aprN, WX - 02::P43 - fabHB / aprN, WX - 02::PnadE - fabHB / aprN with high - yield nattokinase.
[0069] (2) The nattokinase engineering strain constructed above was activated on a tetracycline resistance plate, and then a single colony was picked into a PA bottle containing the corresponding resistance, and cultured at 37°C, 230rpm for 12h. A 2% inoculum was inoculated into 50mL seed solution containing the corresponding resistance, and cultured at 37°C, 230rpm for 12h until OD600 reached 4.0-4.5. Finally, a 3% inoculum was inoculated into 30mL nattokinase fermentation medium, and cultured at 37°C, 230rpm for 48h to obtain a fermentation broth.
[0070] The seed solution: 10g / L peptone, 5g / L yeast extract powder, 10g / L sodium chloride, pH 7.2-7.4, 250mL triangular bottle liquid volume is 50mL
[0071] The fermentation medium comprises: 10 g / L soybean peptone, 10 g / L corn steep liquor centrifuge, 10 g / L bone peptone, 15 g / L yeast extract, 3 g / L dipotassium hydrogen phosphate, 6 g / L ammonium sulfate, 20 g / L glucose, the pH value is adjusted to 7.2, and the liquid volume is 30 mL per 250 mL conical flask.
[0072] 2 mL of fermentation broth was centrifuged at 12000 rpm for 10 min, and the supernatant was the crude enzyme solution of nattokinase. In this application, the crude enzyme solution of nattokinase was used to detect enzyme activity, and the crude enzyme solution was diluted to a suitable multiple with Tris-Hcl (50 mM, pH 7.8) for enzyme activity detection.
[0073] Fibrinogen is converted into fibrin, and fibrin is the substrate for the nattokinase enzyme activity detection reaction. First, take 0.4mL of fibrinogen solution (0.72%) into a test tube, add 1.4mL of Tris-Hcl (50mM, pH7.8), place it in a 37℃ water bath for 3min, add 0.1mL of thrombin (20U / mL), shake it gently and then bathe it in 37℃ water bath for 10min, and wait for fibrinogen to be converted into fibrin. After 10min, the conversion is completed, add 0.1mL of diluted nattokinase crude enzyme solution, shake the test tube gently to mix, set the blank group without adding enzyme solution, react in a 37℃ water bath for 60min, then add 2mL of trichloroacetic acid (200mM) to terminate the reaction, and then add trichloroacetic acid and diluted enzyme solution to the blank group. React at 37℃ for 20min, and centrifuge the reaction solution at 12000rpm for 10min. The absorbance at 275 nm was detected using a quartz cuvette and an ultraviolet spectrophotometer, and the blank group was used for zero calibration to control the absorbance between 0.060 and 0.080.
[0074]
[0075] It can be seen that although the fabHB gene was introduced into all of them, compared with the wild-type strain, the alkaline protease activity of the engineered bacteria using only the PnadE promoter was significantly improved.
[0076] Example 4:
[0077] Application of Bacillus licheniformis WX-02::P43-fabHB in highly expressing poly-γ-glutamic acid:
[0078] The WX-02 strain itself can produce poly-γ-glutamic acid.
[0079] In this example, the abilities of Bacillus licheniformis WX-02::PykzA-fabHB, WX-02::P43-fabHB, and WX-02::PnadE-fabHB to produce poly-γ-glutamic acid were investigated. It was found that the abilities of the three fabHB engineered bacteria to produce poly-γ-glutamic acid were significantly improved compared to the control strain WX-02, indicating that the replacement of the promoter had no significant effect on this gene, as long as the gene could be activated for overexpression.
[0080] Furthermore, taking WX-02::P43-fabHB as an example, the applicant investigated the ability of Bacillus licheniformis WX-02::P43-fabHB to produce poly-γ-glutamic acid for different poly-γ-glutamic acid fermentation medium formulations (meanwhile, Bacillus licheniformis WX-02 was also inoculated in these 18 media as a control). The 18 groups of medium formulations are specifically shown in Table 1:
[0081] Table 1
[0082] Glucose (g / L) Sodium glutamate (g / L) Sodium citrate (g / L) Formulation 1 60 20 10 Formulation 2 60 30 10 Formulation 3 60 40 10 Formulation 4 60 30 12.5 Formulation 5 60 30 15 Formulation 6 60 30 17.5 Formulation 7 70 20 10 Formulation 8 70 30 10 Formulation 9 70 40 10 Formulation 10 70 30 12.5 Formulation 11 70 30 15 Formulation 12 70 30 17.5 Formulation 13 80 20 10 Formulation 14 80 30 10 Formulation 15 80 40 10 Formulation 16 80 30 12.5 Formulation 17 80 30 15 Formulation 18 80 30 17.5
[0083] The other components in the 18 media are all: 10 g / L NaNO3, 8 g / L NH4Cl, 1 g / L K2HPO4·3H2O, 1 g / L MgSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.15 g / L MnSO4·H2O, 1 g / L CaCl2, pH 7.2.
[0084] Among them, the strains constructed for the present invention in the above examples; the specific steps for obtaining the seed liquid are as follows: First, activate Bacillus licheniformis, that is, inoculate it from the glycerol tube at a volume percentage of 1% into 5 mL of LB medium, culture at 180 - 300 r / min and a temperature of 37 °C for 10 - 14 hours, and then inoculate the activated bacterial liquid of the strain into the seed fermentation medium at a volume percentage inoculation amount of 1% and culture at 180 - 300 r / min and 37 °C for 10 - 12 hours to obtain the bacterial liquid for seed culture;
[0085] The specific steps of fermentation are as follows: 50 mL of the production fermentation medium is loaded into a 500 mL Erlenmeyer flask, and then the bacterial liquid from seed culture is inoculated at an inoculation amount of 3% (volume percentage), a rotation speed of 230 r / min, a temperature of 37 °C, and fermented for 30 hours to obtain the bacterial liquid for production fermentation. The specific steps for obtaining the above-mentioned seed liquid and fermentation are all prior arts.
[0086] The CTAB method (Halmschlag et al, 2009) is used to measure the γ-PGA yield, and the specific operation steps are as follows: Take 2.00 g of the fermentation broth, add 4 mL of HCl solution with pH = 1 and mix well, centrifuge at 12000 rpm / min for 5 min; Take the supernatant and adjust the pH to neutral, add three times the volume of ethanol and shake, then take the wet sample for re-dissolution, and control the concentration of the test sample at 0 - 0.10 g / L. Add 100 μL of 2% NaOH solution of 0.15 M CTAB for reaction, and measure OD400 nm after reacting for 3 - 5 min. Calculate the γ-PGA concentration according to the standard curve.
[0087] Table 2
[0088]
[0089] As can be seen from Table 2, under the same fermentation conditions, the γ-PGA yield in the fermentation bacterial liquid of Bacillus licheniformis WX-02::P43-fabHB of the present invention has been greatly improved compared with the control bacteria (increased by more than 31.02%), indicating that: the technical solution of the present invention has great application value in improving the γ-PGA yield of Bacillus licheniformis.
Claims
1. Use of β-ketoacyl-ACP synthase III in promoting the secretion efficiency of metabolites of Bacillus licheniformis WX-02, wherein the β-ketoacyl-ACP synthase III is shown as SEQ ID NO.2, and the metabolites are γ-PGA, nattokinase or alkaline protease; When the metabolite is γ-PGA, its application process includes replacing the coding gene of β-ketoacyl-ACP synthase III in Bacillus licheniformis WX-02 sigE gene, and the promoters of the coding gene of β-ketoacyl-ACP synthase III are P43, PnadE or PykzA; When the metabolite is nattokinase, its application process includes replacing the coding gene of β-ketoacyl-ACP synthase III in Bacillus licheniformis WX-02 sigE gene, and at the same time, the promoter of the coding gene of β-ketoacyl-ACP synthase III is the PnadE promoter; When the metabolite is alkaline protease, its application process includes replacing the coding gene of β-ketoacyl-ACP synthase III in Bacillus licheniformis WX-02 sigE gene, and at the same time, the promoter of the coding gene of β-ketoacyl-ACP synthase III is the P43 promoter.
2. The use according to claim 1, wherein the coding gene of the β-ketoacyl-ACP synthase III is shown as SEQ ID NO.1.
Citation Information
Patent Citations
Bacillus licheniformis engineering bacterium capable of efficiently secreting nattokinase
CN105368762A
Alkaline protease gene sequence and application suitable for expression in Bacillus licheniformis
CN114807100B
Method for improving heterologous protein secretion level of bacillus licheniformis
CN106893736A
Application of Peptostreptococcus asaccharoly glutamate dehydrogenase (GdhA) in increasing yield of Bacillus licheniformis poly-gamma-glutamic acid
CN110951797A