A lipase mutant and its use in the synthesis of functional lipids opl
By directing the evolution of lipase, mutants with specific amino acid sequence substitutions were prepared, which improved the specific activity of the enzyme, solved the problem of insufficient enzyme activity in the enzymatic synthesis of OPL, realized the efficient synthesis of functional lipid OPL, and reduced production costs.
Patent Information
- Application Number
- CN202411108696.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-13
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2044-08-13
AI Technical Summary
Existing technologies struggle to efficiently synthesize OPL triglycerides, which have a similar structure to those found in breast milk fat, especially when synthesized enzymatically due to insufficient enzyme activity.
By directing the evolution of lipase, mutants with high amino acid sequence identity to SEQ ID NO:2 and substitutions at specific positions were prepared, including single-point or combined mutations of E287S, V306T, E335A, and D359L, which improved the specific activity of lipase and were expressed in host cells such as Pichia pastoris and Aspergillus niger.
It significantly improved the specific activity of lipase, reduced production costs, and achieved efficient synthesis of functional lipid OPL, with broad application prospects.
Smart Images

Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering and protein modification technology, specifically relating to a lipase mutant and its application in the synthesis of functional lipid OPL. Background Technology
[0002] Lipases are a class of hydrolytic enzymes that can hydrolyze triglycerides to produce free fatty acids and glycerol of varying chain lengths. From a catalytic perspective, lipases exhibit mild reaction conditions, produce few byproducts, and do not require coenzymes. They also possess high chemoselectivity and stereoisomerism. Furthermore, lipases can catalyze ester hydrolysis, ester synthesis, transesterification, ammonolysis, alcoholysis, and drug synthesis.
[0003] Lipases primarily originate from plants, animals, and microorganisms. Microorganisms are characterized by their diversity, rapid reproduction, and high variability, secreting a wide variety of lipases with broad substrate diversity. They can adapt to different pH and temperature ranges, and some microbial strains obtained from extreme environments exhibit even more pronounced enzymatic characteristics. Currently, lipase-producing microorganisms are widely distributed, with over 60 genera identified, including 10 genera of yeasts, 23 genera of other fungi, 4 genera of actinomycetes, and 28 genera of bacteria. High-producing lipase fungal strains are mostly derived from Rhizopus, Aspergillus, Penicillium, Mucor, Geotrichum, and others.
[0004] Breast milk is the best food source for infants, meeting their needs for various nutrients, significantly reducing their chances of diarrhea, infectious diseases, allergies, and malnutrition, lowering infant mortality, and potentially reducing the risk of chronic diseases in adulthood. Breast milk contains 3%-5% fat, including 98% triglycerides, 1% phospholipids, 0.5% cholesterol and cholesterol esters, and other fat byproducts. With advancements in scientific research on breast milk lipids, the industry has proposed increasingly more human milk lipid alternatives similar to breast milk fat, such as the currently well-known OPO, OPL, and UPU.
[0005] OPO is a well-known nutrient in infant formula. OPO stands for 1,3-dioleoyl-2-palmitoylglycerol, one of the most abundant triglycerides in human milk. As a human milk substitute, OPO mimics a type of triglyceride found in breast milk fat. However, many types of triglycerides with similar structures exist in breast milk fat, and adding only OPO makes it difficult to achieve a similar overall fatty acid composition and distribution as breast milk fat. Therefore, it is not a complete human milk substitute. Furthermore, research on breast milk composition in different countries shows significant differences. For example, OPO is most abundant in European and American breast milk, while in Chinese breast milk, the most abundant component is not OPO, but OPL, or 1-palmitoyl-2-oleoyl-3-linoleoylglycerol.
[0006] Currently, enzymatic synthesis of OPO and OPL is mainly employed. Its advantages include mild reaction conditions, environmental friendliness, product safety, and easy separation of the lipase from the product. The enzymatic synthesis of OPO utilizes an acid hydrolysis method, primarily using palmitic acid-rich oils and oleic acid at the sn-2 position as substrates. The reaction proceeds under the action of specific lipases at the sn-1 and 3 positions. This method can produce products with high purity and few byproducts. However, the enzymatic synthesis of OPL requires palmitic acid-rich oils and linoleic acid at the sn-2 position as substrates. Developing lipases suitable for OPL synthesis is currently a research hotspot in this field. Summary of the Invention
[0007] To address the problems of the prior art, this invention provides a lipase mutant with enhanced specific activity and its application in the synthesis of functional lipids (OPL).
[0008] The present invention provides a lipase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:2, and comprising an amino acid substitution at at least one position selected from the group consisting of 287, 306, 335, and 359 compared to SEQ ID NO:2.
[0009] In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:2.
[0010] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:2.
[0011] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: E287S, V306T, E335A, D359L.
[0012] In some embodiments of the present invention, the mutant comprises a substitution or combination of substitutions for at least one amino acid from the group consisting of:
[0013] E287S;
[0014] V306T;
[0015] E335A;
[0016] D359L;
[0017] E287S / V306T;
[0018] E287S / E335A;
[0019] E287S / D359L;
[0020] V306T / E335A;
[0021] V306T / D359L;
[0022] E335A / D359L;
[0023] E287S / V306T / E335A;
[0024] E287S / V306T / D359L;
[0025] E287S / E335A / D359L;
[0026] V306T / E335A / D359L;
[0027] E287S / V306T / E335A / D359L.
[0028] In some embodiments of the present invention, the amino acid sequence of the mutant is SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9.
[0029] The present invention also relates to DNA molecules encoding the above-mentioned lipase mutants.
[0030] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.
[0031] The present invention also relates to a host cell comprising the above-described recombinant expression vector.
[0032] When the plasmids were transferred into host cells, the specific activity of the recombinant lipase mutant was significantly increased.
[0033] The host cell was Pichia pastoris.
[0034] The host cell is Aspergillus niger.
[0035] The host cell was Trichoderma reesei.
[0036] The present invention also relates to the application of the above-mentioned lipase mutant in the synthesis of functional lipid OPL.
[0037] This invention provides mutants based on wild-type lipase RCL, containing single-point mutations of E287S, V306T, E335A, and D359L, and combinations thereof, which significantly improve the specific activity of the lipase. These lipase mutants can be widely used in the synthesis of functional lipids OPL, showing promising application prospects. Detailed Implementation
[0038] The method of the present invention will be further illustrated below with examples. Experimental methods in the following examples that do not specify specific conditions can generally be operated under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* by J. Sambrook et al., or according to the manufacturer's recommendations. Those skilled in the art can better understand and master the present invention through these examples. However, the protection and scope of the claims of the present invention are not limited to the specific examples provided, but should include the scope of protection that can be extended by those skilled in the art based on this specification without inventive effort.
[0039] Experimental materials and reagents:
[0040] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, and vector pPIC9k were purchased from Invitrogen.
[0041] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases were purchased from Fermentas, and plasmid extraction kits and gel purification and recovery kits were purchased from Omega.
[0042] Culture medium formulation:
[0043] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;
[0044] LB+Amp medium: LB medium with 100 μg / mL ampicillin;
[0045] LB+Kanamycin medium: LB medium supplemented with 50 μg / mL kanamycin;
[0046] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;
[0047] Yeast selection medium (MD medium): 2% glucose, 1.34% YNB, 4×10⁻⁶ -5 % Biotin, 2% Agar Powder;
[0048] BMGY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % Biotin, 1% Glycerin;
[0049] BMMY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % Biotin, 0.5% Methanol.
[0050] The present invention will now be described in detail with reference to the embodiments.
[0051] Example 1: Obtaining a high specific activity single-point mutant of lipase
[0052] 1.1 Amplification of the lipase gene
[0053] The wild-type lipase gene derived from *Rhizopus oryzae* was named RCL, with its nucleotide sequence SEQ ID NO: 1 and its encoding amino acid sequence SEQ ID NO: 2. This gene was synthesized by Shanghai Jereh Biotechnology Co., Ltd.
[0054] PCR primers were designed based on the 5' end of the gene, containing an EcoRI restriction enzyme site, and the 3' end, containing a NotI restriction enzyme site. The primer sequences are as follows:
[0055] 5' primer RCL-F: GGC GAATTC GTCCCTGTCTCCGGTAAATCC (The underlined part is the EcoRI restriction enzyme recognition site);
[0056] 3' primer RCL-R: ATA GCGGCCGC TTACAGGCAGGAGCCCTCGTT (The underlined part is the NotI restriction enzyme recognition site).
[0057] Using the synthesized lipase RCL gene SEQ ID NO: 1 as a template, PCR amplification was performed using the above primers. The PCR amplification system consisted of: 1 μL template, 1 μL upstream primer RCL-F, 1 μL downstream primer RCL-R, 10 μL 5×PS Buffer, 4 μL dNTPs (2.5 mM), 1 μL Primer-Star DNA polymerase, and 32 μL ddH2O, with a total reaction volume of 50 μL. The PCR cycling program was as follows: 95℃ pre-denaturation for 5 min, 30 cycles: 94℃ for 30 sec, 56℃ for 30 sec, 72℃ for 1 min, 72℃ for 10 min; the PCR product was recovered by gel extraction, digested with EcoRI and NotI, and then ligated with the pET-28a vector digested with the same enzymes overnight at 16℃ and transformed into E. coli DH5α. The transformed product was plated on LB+Kana plates and incubated upside down at 37℃. After the transformants appeared, the positive clones were verified by colony PCR. After sequencing verification, the correct recombinant plasmid pET-RCL was finally obtained.
[0058] 1.2 Amplification and Screening of Lipase Mutant Genes
[0059] To improve the specific activity of lipase RCL, the applicant screened for numerous mutations of the enzyme using directed evolution technology. Using the RCL gene as a template, and with the aforementioned primers RCL-F1 and RCL-R1, PCR amplification was performed using the GeneMorph II random mutation PCR kit (Stratagene). The PCR products were recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET-28a vector that had been digested with the same enzymes. The ligation was then transformed into E. coli BL21(DE3), plated on LB+Kana plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB+Kana medium containing 0.1 mM IPTG was added to each well, and the plates were incubated at 37°C and 220 rpm for about 6 hours. After centrifugation and discarding the supernatant, the cells were resuspended in buffer and repeatedly freeze-thawed to break up the cell walls, obtaining E. coli cell lysate containing lipase.
[0060] The lipase activity was determined at 37°C and pH 8.0. 20 μL of lysis buffer was transferred to a new 96-well plate, and 80 μL of substrate solution (prepared fresh by slowly mixing solution A and solution B in a 1:9 ratio; solution A: accurately weigh 18 mg of p-nitrophenol palmitate and dissolve it in 30 mL of isopropanol; solution B: 50 mmol / L phosphate buffer, pH 8.0) was added. The reaction was incubated at 37°C for 10 min, and then 80 μL of anhydrous ethanol was added to terminate the reaction. The absorbance was measured at 410 nm.
[0061] Experimental results showed that some mutations had no effect on the specific activity of lipase RCL, while others even worsened its specific activity, which did not meet the requirements. Ultimately, the applicant screened mutation sites that could significantly improve the specific activity of lipase RCL without affecting its original enzymatic properties: E287S, V306T, E335A, and D359L.
[0062] Based on the wild-type lipase RCL, this invention provides mutants containing single mutation sites of E287S, V306T, E335A, and D359L, respectively, with amino acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.
[0063] The above single-point mutants were amplified by PCR using primers RCL-F2 and RCL-R2, with Xba I sites introduced at both ends of the primers. The PCR reaction conditions were: denaturation at 94℃ for 5 min; followed by denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 1 min, for 30 cycles, and then incubation at 72℃ for 10 min.
[0064] The primer sequences are as follows:
[0065] RCL-F2: GCA GGTACC ATGCGCGGCCTCTACTCCCTGGG (The underlined part is the restriction endonuclease KpnI recognition site);
[0066] RCL-R2: GGC TCTAGA TTACTCGTCGACGGCGAAGCG (The underlined part is the restriction endonuclease XbaI recognition site).
[0067] The gene fragment of wild-type lipase RCL was amplified using the same PCR method described above.
[0068] 1.3 Construction of Pichia pastoris engineered strains
[0069] The genes of the wild-type lipase RCL and its mutant obtained from the above cloning were respectively linked to the expression vector pPIC9K through the EcoRI and NotI sites to construct the expression vector.
[0070] The expression vector was linearized with Sal I, and the linearized fragment of the expression vector was transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of genimycin.
[0071] Transformants of the recombinant lipase single-point mutant obtained through screening were transferred to BMGY medium and cultured at 30℃ and 220 rpm with shaking for 1 day; then transferred to BMMY medium and cultured at 30℃ and 220 rpm with shaking; 0.5% methanol was added daily for 4 days to induce expression; the bacterial cells were removed by centrifugation, and the fermentation supernatant was analyzed by SDS-PAGE electrophoresis. The results showed that the molecular weight of the recombinant lipase mutant expressed in the fermentation supernatant was approximately 40 kDa, which is the same as the theoretical molecular weight.
[0072] 1.4 Lipase Activity Detection
[0073] (1) Definition of lipase activity unit
[0074] Under conditions of 40°C and pH 7.5, the amount of enzyme required to hydrolyze a substrate to produce 1 μmol of titratable fatty acid in 1 minute is defined as one unit of enzyme activity, U.
[0075] (2) Enzyme activity assay method
[0076] Weigh 40g of polyvinyl alcohol (PVA: degree of polymerization 1750±50), add 800ml of water, soak for 4-6 hours, heat in a boiling water bath, stir until completely dissolved, stir and cool, then bring the volume to 1000ml, filter with 6-8 layers of clean gauze, and keep the filtrate for later use.
[0077] Take 150ml of the above filtrate, add 50ml of olive oil, and process with a high-speed homogenizer for 10 minutes (divided into 4 processes, 5 minutes apart, each process lasting 2-3 minutes) to obtain a milky white PVA emulsion. Prepare fresh before use.
[0078] Take two 100ml Erlenmeyer flasks, add 4ml of substrate solution and 5ml of pH7.5 phosphate buffer to the blank flask (A) and the sample flask (B) respectively, and add 15ml of 95% ethanol to the blank flask (A). Preheat in a 40℃ water bath for 5min.
[0079] Add 1 ml of the enzyme solution to be tested to both the blank bottle (A) and the sample bottle (B), mix well immediately and start timing. After reacting for 15 minutes, use a pipette to immediately add 15 ml of 95% ethanol to the sample bottle (B) to stop the reaction and remove it.
[0080] Pour the above reaction solution into a 50ml beaker, add 5ml of pure water to the Erlenmeyer flask, shake well and then pour it into the 50ml beaker, add 2 drops of phenolphthalein indicator;
[0081] Using a pH meter calibrated for alkaline conditions, add 0.05 mol / L sodium hydroxide solution to a beaker with stirring, and titrate until the pH value is 9.92; titrate until the pH value no longer changes in 20 seconds as the endpoint, and record the volume of sodium hydroxide standard solution consumed.
[0082] Formula for calculating enzyme activity:
[0083] X – Lipase activity, U / ml;
[0084] V1—Volume of sodium hydroxide standard solution consumed during sample titration, in ml;
[0085] V2—Volume of sodium hydroxide standard solution consumed during blank titration, in ml;
[0086] C – Concentration of sodium hydroxide standard solution, mol / L;
[0087] 1 ml of 50-0.05 mol / L sodium hydroxide solution is equivalent to 50 μmol of fatty acid;
[0088] n—Enzyme solution dilution factor;
[0089] 0.05 — Conversion factor for sodium hydroxide standard solution concentration;
[0090] 15 — Time conversion factor.
[0091] (3) Enzyme activity assay results
[0092] The enzyme activity of the fermentation supernatant was determined according to the above method. The results showed that the enzyme activity of the fermentation supernatant of Pichia pastoris expressing wild-type lipase was 405 U / mL, while the enzyme activity of the fermentation supernatant of Pichia pastoris expressing lipase mutant reached 421-580 U / mL.
[0093] 1.5 Fermentation Verification
[0094] The recombinant expression of wild-type lipase RCL and its mutant Pichia pastoris was fermented in a 10-liter fermenter. The culture medium used for fermentation was formulated as follows: calcium sulfate 1.1 g / L, potassium dihydrogen phosphate 5.5 g / L, ammonium dihydrogen phosphate 55 g / L, potassium sulfate 20.3 g / L, magnesium sulfate 16.4 g / L, potassium hydroxide 1.65 g / L, and defoamer 0.05%.
[0095] Fermentation process: pH 5.0, temperature 30℃, stirring speed 300rpm, ventilation 1.0-1.5 (v / v), dissolved oxygen controlled above 20%.
[0096] The entire fermentation process is divided into three stages: The first stage is the cell culture stage, where seed culture is introduced at a ratio of 7% and cultured at 30℃ for 24-26 hours, marked by glucose depletion; the second stage is the starvation stage, where no carbon source is added after glucose depletion, and the stage ends when dissolved oxygen rises above 80%, lasting approximately 30-60 minutes; the third stage is the induction expression stage, where methanol is added for induction, and dissolved oxygen is maintained above 20%, with a culture time between 150-180 hours. After fermentation, the fermentation broth is processed through a plate and frame filter press to obtain crude enzyme solution.
[0097] The enzyme activity of the crude enzyme solution was detected using the lipase activity assay method described in 1.4 of Example 1. The results showed that the final fermentation enzyme activity of Pichia pastoris expressing wild-type lipase was 15373 U / ml, while the final fermentation enzyme activity of Pichia pastoris expressing single-point mutant lipase reached 18534-23939 U / ml.
[0098] 1.6 Determination of the enzymatic properties of lipase
[0099] (1) Optimal pH
[0100] Lipase activity was measured in the crude fermentation enzyme solution described in 1.4 of Example 1 using disodium hydrogen phosphate-citric acid buffer solutions with pH values of 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, and 12.0 at 30°C. The relative enzyme activity was calculated with the highest enzyme activity as 100%.
[0101] The results showed that the optimal pH for both wild-type lipase RCL and the mutant was 8.0, and the relative enzyme activity levels under different pH conditions were not significantly different.
[0102] (2) Optimal operating temperature
[0103] The crude enzyme solution described in section 1.3 of Example 1 was subjected to lipase activity determination at 20℃, 25℃, 30℃, 35℃, 40℃, 50℃, 60℃, 70℃, and 80℃, and pH 8.0. The highest enzyme activity was taken as 100%, and the relative enzyme activity was calculated.
[0104] The results showed that the optimal operating temperature for both wild-type lipase RCL and the mutant was 35℃, and the relative enzyme activity levels under different temperature conditions were not significantly different.
[0105] (3) Lipase specific activity
[0106] The protein content of the fermentation supernatant of the above-mentioned recombinant wild-type lipase RCL and its single-point mutant Pichia pastoris strains was determined by the Coomassie brilliant blue method. The specific activity of the enzyme was obtained by dividing the enzyme activity by the protein content. The results are shown in Table 1.
[0107] Table 1. Specific activity analysis of lipase mutants
[0108]
[0109]
[0110] As shown in Table 1, compared with wild-type lipase RCL, the mutants provided by this invention, which contain single mutation sites E287S, V306T, E335A, and D359L respectively, have significantly increased specific activity by 17.1%-64.9%.
[0111] Example 2: Screening of Lipase Mutant Combinations
[0112] To further improve the specific activity of lipase, the four mutation sites screened in Example 1 were combined for screening, and the specific activities of the recombinant expression mutants were measured. The results showed that the E287S / V306T two-point mutation combination, the E287S / V306T / E335A three-point mutation combination, and the E287S / V306T / E335A / D359L four-point mutation combination significantly improved the specific activity of lipase. Specific results are shown in Table 2.
[0113] Table 2. Specific activity analysis of lipase mutants
[0114] Lipase Specific activity (u / mg) Wild-type RCL 4590 E287S / V306T two-point mutant 7790 E287S / V306T / E335A three-point mutant 10191 E287S / V306T / E335A / D359L four-point mutant 10229
[0115] As shown in Table 2, compared with wild-type lipase RCL, the mutants provided by this invention, which contain two-point mutations of E287S / V306T, three-point mutations of E287S / V306T / E335A, and four-point mutations of E287S / V306T / E335A / D359L, respectively, have significantly increased specific activity by 69.7%-122.9%, demonstrating remarkable effects.
[0116] Lipase mutants containing two-point mutations of E287S / V306T, three-point mutations of E287S / V306T / E335A, and four-point mutations of E287S / V306T / E335A / D359L have amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, respectively.
[0117] The above results indicate that the single mutation sites E287S, V306T, E335A, and D359L and their combinations provided by this invention can significantly improve the specific activity of wild-type lipase RCL, thereby significantly reducing the production cost of lipase and promoting its widespread application.
[0118] Example 3: Preparation of immobilized lipase and its application in OPL synthesis
[0119] 3.1 Preparation of immobilized lipase
[0120] Take 500 ml of the above-mentioned concentrated lipase mutant enzyme solution, add 100 g of macroporous resin, and stir at 30℃ and 200 rpm for 12 h. After stirring, filter the solution and dry the resin in a fluidized bed to obtain immobilized lipase.
[0121] 3.2 Preparation of OPL structured lipids
[0122] Take 100g of palmitic stearin, add 300g of oleic acid, 400g of linoleic acid, and 15g of immobilized lipase. Stir at 60℃ and 300rpm for 12h. After stirring, filter the solution, separate the immobilized lipase, and use high performance liquid chromatography-evaporative light scattering detector (HPLC-ELSD) to detect the contents of OPO, OPL, and LPL in the reaction solution.
[0123] The results showed that the immobilized lipase mutant provided by the present invention catalyzes the transesterification of palmitic stearate with oleic acid and linoleic acid, and the resulting reaction solution has an OPL content as high as 2.74-4.14%, and OPO and LPL contents of 0.96-1.50% and 1.85-2.65%, respectively.
[0124] The lipase mutant provided by this invention can be widely used in the synthesis of functional lipids OPL, and has broad application prospects.
[0125] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A lipase mutant, characterized in that, The amino acid sequence of the mutant is SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8 or SEQ ID NO:
9.
2. A DNA molecule encoding the lipase mutant of claim 1.
3. A recombinant expression vector comprising the DNA molecule of claim 2.
4. A host cell comprising the recombinant expression vector of claim 3.
5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris ( Pichia pastoris ) or Aspergillus niger ( Aspergillus niger ) or Trichoderma reesei ( Trichoderma reesei ).
6. The application of the lipase mutant of claim 1 in the synthesis of functional lipid OPL.
Citation Information
Patent Citations
Lipase mutant with improved thermal stability and application thereof
CN111944783A
Lipase mutant and application thereof in white spirit yellow water treatment
CN115786302A