Endoglucanase mutants with improved pH tolerance and methods for making same

By performing site-directed amino acid mutations on Bacillus geosporus endoglucanase, its pH tolerance was improved, solving the problem of unstable enzyme activity of endoglucanase over a wide pH range. This resulted in highly efficient catalytic performance within the pH range of 3.0–11.0, making it suitable for textile and detergent applications.

CN118910016BActive Publication Date: 2025-11-04NANJING UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411305408.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-19
Publication Date
2025-11-04
Estimated Expiration
2044-09-19

AI Technical Summary

Technical Problem

Existing endoglucanases exhibit poor enzyme activity over a wide pH range, limiting their application in complex pH environments such as textiles and washing processes.

Method used

By artificially performing site-directed mutagenesis on endoglucanase derived from Bacillus geostriatus, specifically by replacing amino acid sequences at specific sites, mutants V217L, A123S/I165V, or A123G/I165L/V185S/V217C were obtained, thereby improving their pH tolerance.

Benefits of technology

The mutant maintains stable and efficient catalytic performance in the pH range of 3.0 to 11.0, and its enzyme activity is increased by 66% compared with the original enzyme at pH 9.0, making it suitable for a wider range of industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118910016B_ABST
    Figure CN118910016B_ABST
Patent Text Reader

Abstract

The application discloses an endoglucanase from Geobacillus sp. Geobacillus sp. 70PC53)as a raw enzyme, and discloses three endoglucanase mutants with improved pH tolerance, namely V217L, A123S / I165V and A123G / I165L / V185S / V217C. The endoglucanase mutant provided by the application is superior to the raw enzyme in pH tolerance, and the residual enzyme activity of the mutant can be increased by 66% compared with the raw enzyme under the condition of pH 9.0; the relative enzyme activity of the endoglucanase mutant provided by the application is higher than that of the raw enzyme within pH 3.0-11.0, and the endoglucanase mutant can maintain stable and efficient catalytic performance under the condition, and has a good industrial application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to an endoglucanase mutant, in particular to an endoglucanase mutant with improved pH tolerance, and belongs to the technical field of genetic engineering. BACKGROUND

[0002] Cellulose is the most widely distributed and largest polysaccharide in nature, and is an environmentally friendly and biodegradable natural organic polymer material. Cellulose and its derivatives are widely used in biological medicine, food, electronic components, new energy and many other fields. Its hydrolysis products are important raw materials for wine engineering, production of paper and textiles, biofuels and chemicals. As the main structural component of plant cell walls, cellulose is usually combined with hemicellulose, pectin and lignin, which greatly affects the texture of plant-derived products. For example, in the food processing industry, the presence of cellulose can reduce the extraction rate and quality of fruit juice, and has a negative impact on production efficiency and product quality. Among various methods of degrading cellulose, the biological degradation method using cellulase has become the focus of attention in the production of cellulose-related industries due to its mild reaction conditions and environmental friendliness.

[0003] Endoglucanase is an important cellulase that can randomly cut the amorphous region inside the cellulose polysaccharide chain, hydrolyze glycosidic bonds, break cellulose chains, and produce oligosaccharides of different lengths and new chain ends, playing an important role in degrading cellulose molecules. According to the optimal pH, endoglucanase can be divided into acid endoglucanase, neutral endoglucanase and alkaline endoglucanase, which are suitable for different application scenarios. In the field of textiles, washing and other complex reaction conditions, endoglucanase with higher pH tolerance can adapt to a wider pH environment and provide more stable and efficient catalytic effect. Chinese invention patent CN 104673713 A discloses an alkaliphilic Streptomyces and the neutral endoglucanase and application thereof produced by the Streptomyces. The enzyme activity can be maintained at 70% or more in the pH range of 3-9. However, there are very limited endoglucanases known to maintain high activity in a wide pH range, so related research is of great significance to the production of cellulose-related industries. SUMMARY

[0004] The purpose of the present application is to provide an endoglucanase mutant with improved pH tolerance, and to provide a nucleic acid molecule encoding the mutant, a vector or a recombinant cell or product containing the mutant, and a preparation method and application of the mutant.

[0005] Technical solution: The first aspect of the present application provides three endoglucanase mutants, the amino acid sequence of the endoglucanase mutants is obtained by mutating the sequence shown in SEQ ID NO. 1, the mutation is V217L or A123S / I165V or A123G / I165L / V185S / V217C.

[0006] The endoglucanase from Geobacillus sp. 70PC53 is used as the original enzyme, the amino acid sequence is shown in SEQ ID No. 1, and the nucleotide sequence is shown in SEQ ID No. 2. The endoglucanase mutants are obtained by artificial site-directed mutation of the original enzyme.

[0007] The standard single letter and standard substitution notation of amino acids are used in the present application: V217L means that the valine (V) at the N-terminal 217th position is mutated to leucine (L); A123S / I165V means that the alanine (A) at the N-terminal 123rd position is mutated to serine (S), and the isoleucine (I) at the N-terminal 165th position is mutated to valine (V).

[0008] The second aspect of the present application provides a nucleic acid molecule encoding the endoglucanase mutant of the first aspect. The nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO. 2.

[0009] The third aspect of the present application provides a vector comprising the nucleotide sequence of the second aspect. The vector can be a cloning vector or an expression vector.

[0010] The fourth aspect of the present application provides a recombinant cell comprising the vector of the third aspect.

[0011] The fifth aspect of the present application provides a preparation method of the endoglucanase mutant of the first aspect, comprising the following steps: (1) designing a point mutation primer, using a plasmid comprising the nucleotide sequence of SEQ ID NO. 2 as a template, performing PCR reaction, digesting the template with an endonuclease, and then recombining the digestion product to obtain an expression vector with a mutant gene; (2) transforming the expression vector into a host cell for fermentation expression; (3) collecting the host cell, breaking the cells, centrifuging to obtain the supernatant, and then obtaining the endoglucanase mutant.

[0012] The sixth aspect of the present application provides a product comprising the endoglucanase mutant of the first aspect, the nucleic acid molecule of the second aspect, the vector of the third aspect, or the recombinant cell of the fourth aspect.

[0013] In a seventh aspect, the present application provides the use of the product of the sixth aspect in catalyzing the hydrolysis of cellulose. The catalysis is under a pH condition of 3.0-11.0.

[0014] Advantages: Compared with the prior art, the present application has the following remarkable advantages: 1. The endoglucanase mutant provided by the present application has better pH tolerance than the original enzyme. The residual enzyme activity of the mutant can be increased by 66% compared with the original enzyme under the condition of pH 9.0; 2. The relative enzyme activity of the endoglucanase mutant provided by the present application is higher than that of the original enzyme under the condition of pH 3.0-11.0, and the mutant can maintain stable and efficient catalytic performance under the condition, and has a good industrial application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 is a schematic diagram of the protein structure of the original enzyme of the present application (containing the 217th and 185th amino acid sites);

[0016] Figure 2 is a schematic diagram of the protein structure of the original enzyme of the present application (containing the 123rd and 165th amino acid sites);

[0017] Figure 3 is a schematic diagram of the relative enzyme activity of the original enzyme and the mutant under different pH conditions. DETAILED DESCRIPTION

[0018] The technical solutions of the present application will be further described below in combination with the drawings.

[0019] The materials and reagents used in the examples, unless otherwise specified, can be obtained from commercial channels.

[0020] Example 1 Endoglucanase mutant V217L

[0021] In this example, the endoglucanase of Geobacillus sp. 70PC53 is used as the original enzyme, and the valine (V) at the 217th amino acid site at the N-terminal of the amino acid sequence shown in SEQ ID No. 1 is mutated to leucine (L). The structure of the original enzyme is shown in Figure 1 , and the nucleic acid sequence is shown in SEQ ID No. 2.

[0022] The preparation method of the mutant V217L is as follows: 1. constructing a recombinant plasmid; 2. expressing the enzyme mutant and preparing a crude enzyme solution.

[0023] The specific steps are as follows:

[0024] 1. Constructing a recombinant plasmid

[0025] Plasmid pET-22b(+) and E. coli DH5a were obtained from commercial channels and preserved by the applicant. The original enzyme was synthesized by GenScript (Suzhou) Co., Ltd. and inserted between the Ndel and Xhol enzyme digestion sites of plasmid pET-22b(+). 3D modeling was performed using PyMOL to determine that amino acid No. 217 was the mutation site, and the position of this amino acid in the protein is shown in Figure 1 The plasmid with the original enzyme was used as a template to perform site-directed mutagenesis by PCR, the mutation primers are shown in Table 1, the PCR system is prepared as shown in Table 2, and the PCR program is set as shown in Table 3.

[0026] Table 1 Mutant V217L primer

[0027] Mutant primer name Sequence (5'-3') V217L-F CGATCGCCTGGATGCGGCGCTGCAAGCGGGC V217L-R CGCATCCAGGCGATCGCGCAGCCACTGCGTATG

[0028] Note: The underlined mutation site in the primer, "F" represents the upstream primer, and "R" represents the downstream primer.

[0029] Table 2 PCR reaction system

[0030] Components Volume 10 x Buffer for KOD-Plus- 2.5 μL 2 mM dNTP 2.5 μL 25 mM MgSO4 1.5 μL DMSO 1 μL 10 pmol / μL Forward Primer 0.75 μL 10 pmol / μL Reverse Primer 0.75 μL DNA template <100 ng KOD-Plus- 1 μL ddH2O up to 25 μL

[0031] Table 3 PCR reaction program

[0032]

[0033] The PCR product was added with 1 μL DpnI restriction endonuclease and digested at 37°C for 1 h.

[0034] 2. Construction of recombinant mutant enzyme-expressing strain and preparation of crude enzyme solution

[0035] The above digestion product was transformed into E. coli DH5a competent cells by heat shock method, and cultured at 37°C for 1 h, then plated on LB solid medium containing 100 μg / mL ampicillin and cultured overnight at 37°C. A single colony was selected and inoculated into LB liquid medium containing 100 μg / mL ampicillin and cultured overnight. The plasmid was extracted using a GenScript plasmid extraction kit and sent to GenScript (Suzhou) for sequencing. The plasmid with the correct mutant enzyme was heat-shocked into E. coli BL21 competent cells, plated on LB solid medium containing 100 μg / mL ampicillin and cultured overnight at 37°C. A single colony was selected and inoculated into LB liquid medium containing 100 μg / mL ampicillin and cultured overnight. The recombinant strain culture solution was added with 50% glycerol and stored at -80°C.

[0036] The bacteria liquid was streaked on LB solid medium containing 100 μg / mL ampicillin and incubated at 37°C overnight. A single colony was inoculated into 3 mL LB liquid medium containing 100 μg / mL ampicillin and incubated at 37°C for 8 h. The inoculation was performed at a 5% inoculation amount into a 250 mL conical flask containing 50 mL TB medium (yeast powder 12 g / L, tryptone 12 g / L, glycerol 4 ml / L, potassium phosphate dibasic 12.5 g / L, potassium phosphate monobasic 2.3 g / L) and incubated at 37°C, 180 rpm. After 8 h of incubation, 50 μL of 400 mM IPTG solution was added and the incubation was continued at 22°C for 22 h. The fermentation liquid was collected and centrifuged at 8000 g for 20 min to collect the bacteria. The cells were washed twice with 200 mM PBS buffer at pH 7.0 and finally resuspended in 10 mL of the corresponding pH buffer. The cells were broken by ultrasonication for 5 min, with 5 s on and 5 s off. The supernatant was collected by centrifugation at 8000 g for 20 min and used as the crude enzyme solution of the endoglucanase mutant V217L.

[0037] Example 2 Endoglucanase mutant A123S / I165V

[0038] In this example, the alanine (A) at position 123 of the N-terminal end of the original enzyme sequence of the endoglucanase shown in SEQ ID No. 1 was mutated to serine (S), and the isoleucine (I) at position 165 was mutated to valine (V). The positions of the amino acids in the protein are shown in Figure 2 The mutation primers are shown in Table 4. The preparation method is referred to Example 1.

[0039] Table 4 Mutant A123S / I165V primers

[0040] Mutant primer name Sequence (5'-3') A123S-F CTTTTTTAGCGAAATGGCGCGCGAATATGGC A123S-R CCATTTCGCTAAAAAAGCGTTTCGCTTGTTC I165V-F CGCACCGTGCGCAGCATTGATCGCGATAAC I165V-R GCTGCGCACGGTGCGAATCACTTCATCCGC

[0041] Example 3 Endoglucanase mutant A123G / I165L / V185S / V217C

[0042] In this example, the alanine (A) at position 123 of the N-terminal end of the original enzyme sequence of the endoglucanase shown in SEQ ID No. 1 was mutated to glycine (G), and the isoleucine (I) at position 165 was mutated to leucine (L), the valine (V) at position 185 was mutated to serine (S), and the valine (V) at position 217 was mutated to cysteine (C). The positions of the amino acids in the protein are shown in Figure 1 and Figure 2 The primers are shown in Table 5. The preparation method is referred to Example 1.

[0043] Table 5 Mutant A123G / I165L / V185S / V217C primers

[0044] Mutant primer name Sequence (5'-3') A123G-F CTTTTTTGGCGAAATGGCGCGCGAATATGGC A123G-R CCATTTCGCCAAAAAAGCGTTTCGCTTGTTC I165L-F CGCACCCTGCGCAGCATTGATCGCGATAAC I165L-R GCTGCGCAGGGTGCGAATCACTTCATCCGC V185S-F CCAAGATAGCGATGATGTGGCGAGCGATCCG V185S-R CATCATCGCTATCTTGGCTCCAGGTGCCGGT V217C-F CGATCGCTGCGATGCGGCGCTGCAAGCGGGC V217C-R CGCATCGCAGCGATCGCGCAGCCACTGCGTATG

[0045] Enzymatic activity of endoglucanase wild-type enzyme and its mutants under different pH conditions

[0046] Prepare sodium phosphate-citric acid buffer with pH value of 3.0 and 5.0, and Tris buffer with pH value of 7.0, 9.0 and 11.0, respectively, and resuspend the cells in Examples 1-3. Ultrasonically break the cells and collect the crude enzyme solution according to Example 1.

[0047] Use 1% sodium carboxymethyl cellulose solution as the substrate for enzymatic reaction, and determine the enzyme activity by the method of dinitrosalicylic acid. Specifically, add 30 μL of the crude enzyme solution and 120 μL of 1% sodium carboxymethyl cellulose solution to a clean enzyme plate, and react at 60°C for 30 min. Then, add 150 μL of DNS solution to stop the reaction, and boil in a water bath for 10 min. Rapidly cool to room temperature, and determine the absorbance at 540 nm. Add a sample of inactivated enzyme solution under the same conditions as a blank control. The enzyme activity (U) of endoglucanase is defined as follows: under the above reaction and analysis conditions, the amount of enzyme that catalyzes the production of 1 μmol of glucose reducing power per minute is defined as one enzyme activity unit. The enzyme activity of the wild-type enzyme under pH 7.0 conditions is defined as 100%, and the relative enzyme activity is calculated based on this value to determine the optimal pH of the enzyme.

[0048] The results are shown in Table 1. Figure 3 The results show that the enzyme activity of the wild-type endoglucanase is affected under acidic and alkaline conditions. The residual enzyme activity under pH 3.0 and pH 11.0 conditions is only 46.7% and 49.0% of that under pH 7.0 conditions, indicating low pH tolerance. The pH tolerance of the enzyme mutants V217L, A123S / I165V and A123G / I165L / V185S / V217C is improved. The residual enzyme activity of the enzyme mutant A123S / I165V under pH 5.0 conditions is increased by 50.3% compared to the wild-type enzyme. The residual enzyme activity of the enzyme mutants A123S / I165V and V217L under pH 9.0 conditions is increased by 57.8% and 66.0%, respectively, compared to the wild-type enzyme.

Claims

1. An endoglucanase mutant, characterized in that, The amino acid sequence of the endoglucanase mutant is obtained by mutation of the sequence shown in SEQ ID NO.1, wherein the mutation is A123S / I165V or A123G / I165L / V185S / V217C; A123S / I165V is obtained by mutating alanine (A) at position 123 of the N-terminus of the sequence shown in SEQ ID NO.1 to serine (S) and isoleucine (I) at position 165 to valine (V); A123G / I165L / V185S / V217C is obtained by mutating alanine (A) at position 123 of the N-terminus of the sequence shown in SEQ ID NO.1 to glycine (G), isoleucine (I) at position 165 to leucine (L), valine (V) at position 185 to serine (S), and valine (V) at position 217 to cysteine ​​(C).

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the endoglucanase mutant of claim 1.

3. A carrier, characterized in that, It includes the nucleic acid molecule as described in claim 2.

4. The carrier according to claim 3, characterized in that, The vector is a cloning vector or an expression vector.

5. A recombinant cell, characterized in that, The recombinant cells comprise the vector as described in claim 3.

6. A method for preparing the endoglucanase mutant according to claim 1, characterized in that, Includes the following steps: (1) Design point mutation primers, use a plasmid containing the nucleotide sequence encoding SEQ ID NO.1 as a template, perform PCR reaction, digest the template with an endonuclease, and then recombinate the digestion product to obtain an expression vector with the mutant gene; (2) Transform the expression vector into the host bacteria for fermentation expression; (3) Collect the host bacteria, break the cells, centrifuge and take the supernatant to obtain the endonuclease mutant.

7. The use of a product comprising the endoglucanase mutant of claim 1, the nucleic acid molecule of claim 2, the vector of claim 3, or the recombinant cell of claim 5 in the catalytic hydrolysis of cellulose.

8. The application according to claim 7, characterized in that, The catalytic conditions are at pH 9.0.

Citation Information

Patent Citations

  • Basophilic streptomyce, neutral endoglucanase produced by basophilic streptomyce and application of basophilic streptomyce

    CN104673713A

  • Low-temperature beta-1, 4-endoglucanase and alkali-resistant enzyme mutant

    CN116497006A

  • Endo-beta-1, 4-glucanase mutant as well as gene, carrier and preparation method thereof

    CN118165960A