A distal enhancer of ADAMTS1 gene related to sheep tail type and its application in early screening of fat or thin tail in sheep

Abstract

The present invention belongs to the field of genetic engineering technology, and more particularly to a distal enhancer of the ADAMTS1 gene related to the tail type of sheep and its application in the early screening of fat or thin tails of sheep. The distal enhancer of the ADAMTS1 gene of the present invention is located at chromosome 1, 128464792-128465192 of the sheep reference genome ARS‑UI_Ramb_v2.0. By detecting the influence of the distal enhancer on the expression of the ADAMTS1 gene, different tail type traits of sheep can be detected, which can be used for the early selection of sheep with different tail types, improve the accuracy of seed selection, shorten the breeding cycle, speed up the breeding process, and provide a scientific basis for the molecular marker-assisted selection of sheep.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and particularly relates to an ADAMTS1 gene distal enhancer related to sheep tail type and application thereof in early screening of fat or thin sheep tails. Background Art

[0002] Fat-tailed sheep store energy in the form of fat deposits in the tail and abdomen, accounting for 20% of their carcass weight. The earliest record of fat-tailed sheep dates back about 5,000 years, and it is believed that fat-tailed sheep evolved from the domestication of thin-tailed sheep. The formation of fat tails is an adaptive response mechanism to drought and climate change. However, excessive fat deposition in the tail affects the reproductive and athletic ability of sheep, the distribution of fat in the animal body, increases feeding costs, and reduces consumer preference. At present, the advantages of large fat tails have been greatly reduced in intensive and semi-intensive production systems. For producers and consumers, reducing tail fat deposition is more in line with social needs, because fat deposition requires more energy than lean tissue deposition, and animal fat has lost most of its market demand. However, fat-tailed sheep account for about 25% of the world's total sheep population. In China, people are increasingly concerned about health and no longer want to raise fat-tailed sheep. Different sheep breeds have undergone adaptive evolution after initial domestication, resulting in different tail phenotypes. The phenotypic diversity of sheep tail types provides ideal material for comparative analysis of their genetic basis. Evolutionary biologists, animal geneticists, breeders and producers have always wanted to clearly understand the underlying genetic mechanisms behind the differences in sheep tail phenotypes. Understanding the causal genes and mutations behind these differences will help explore the mysteries of evolution, improve animal production performance, promote animal welfare, and provide information to help understand human diseases related to fat deposition (i.e. obesity). At the same time, early screening of sheep tail type will help reduce feeding costs and improve breeding efficiency.

[0003] Genomic studies provide an unprecedented opportunity to understand the mechanism of fat formation in the sheep tail, in order to identify potential causal variants between phenotypic differences. In the past decade, researchers have also conducted genomic and transcriptomic studies on the mechanism of fat deposition in the sheep tail. The study has identified several potential important candidate genes, including VEGFA, BMP2 and PDGFD genes associated with the fat tail phenotype, and TBXT genes associated with the number of coccygeal vertebrae and tail length. Among them, PDGFD has been studied in depth, with a SNP mutation site and an ASE (Allele-specific expression) found in the first exon, 1 ASE found in the third exon, a 6.8kb region found in the first intron that was positively selected, and 5 ASEs found in the 3'UTR. However, there are few studies on the ADAMTS1 gene in this field, based on which, the present invention is proposed. Summary of the invention

[0004] The purpose of the present invention is to provide a gene related to sheep tail type for early screening of fat or thin tail sheep, and specifically to a distal enhancer of the ADAMTS1 gene related to sheep tail type and its application in early screening of fat or thin tail sheep.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides an ADAMTS1 gene distal enhancer related to sheep tail type. The ADAMTS1 gene distal enhancer is located at chromosome 1, positions 128464792-128465192 of sheep reference genome ARS-UI_Ramb_v2.0.

[0007] The present invention also provides the application of the distal enhancer of the ADAMTS1 gene in the early screening of fat or thin tails in sheep.

[0008] The present invention also provides application of the ADAMTS1 gene distal enhancer in sheep assisted breeding.

[0009] The present invention also provides an application of knocking out the distal enhancer of the ADAMTS1 gene in early screening of fat or thin tails in sheep. After knocking out the distal enhancer of the ADAMTS1 gene, sheep with lower ADAMTS1 gene expression levels are fat-tailed sheep; after knocking out the distal enhancer of the ADAMTS1 gene, sheep with unchanged ADAMTS1 gene expression levels are thin-tailed sheep.

[0010] The present invention also provides the use of knocking out the distal enhancer of the ADAMTS1 gene in sheep assisted breeding.

[0011] The present invention also provides a primer pair for amplifying the distal enhancer of the ADAMTS1 gene, and the primer pair is shown as SEQ ID NO.1-2.

[0012] The present invention also provides the application of the primer pair in early screening of fat or thin tails of sheep and / or sheep assisted breeding.

[0013] The present invention also provides a method for early screening of fat and thin tails in sheep, comprising the following steps:

[0014] (1) Using CRISPR / cas9 method, a knockout plasmid of the distal enhancer gene sequence of ADAMTS1 gene was constructed;

[0015] (2) mixing the knockout plasmid described in step (1) with sheep tail fat cells and a transfection reagent, and culturing for 6 to 7 days to obtain a test object;

[0016] (3) extracting RNA from the object to be tested, reverse transcribing it into cDNA, amplifying the cDNA using the primer pair, detecting the expression level of the ADAMTS1 gene in the amplified product by real-time fluorescence quantitative PCR, and determining the tail type of the sheep based on the result of the ADAMTS1 gene expression;

[0017] The ADAMTS1 gene distal enhancer described in step (1) is the ADAMTS1 gene distal enhancer.

[0018] Preferably, the sequence of the short guide RNA in the CRISPR / cas9 method in step (1) is as shown in SEQ ID NO.5;

[0019] The transfection reagent described in step (2) is lipo3000;

[0020] The reverse transcription system in step (3) is divided into two steps: the first step is 5×gDNAEraser Buffer 2 μL, gDNAEraser 1 μL, RNA 1000ng, ddH 2 O to 10 μL; the system of the second step is the system of the first step 10 μL, PrimerScriptRT Enzyme MixⅠ1 μL, RT PrimerMix 1 μL, 5×Primer ScriptBufferⅠ4 μL, ddHO 2 O 4 μL;

[0021] The amplification system was as follows: 2 μL template cDNA, 0.8 μL upstream and downstream primers, 0.8 μL each, ddH 2 O 6.4μL, TBGreenPremix Ex TaqⅡ10μL;

[0022] The reaction procedure of the reverse transcription in step (3) is divided into two steps: the reaction procedure of the first step is 42°C for 2 min, 4°C infinity; the reaction procedure of the second step is 37°C for 15 min, 85°C for 5 s, 4°C infinity;

[0023] The amplification reaction program was: 95°C for 5 min; 95°C for 10 s, 60°C for 10 s, and 70°C for 15 s, for a total of 40 cycles.

[0024] The present invention also provides a kit for early screening of fat or thin tails of sheep and / or sheep assisted breeding, comprising a reagent for knocking out the distal enhancer of the ADAMTS1 gene and / or the primer pair.

[0025] The present invention provides a distal enhancer of the ADAMTS1 gene related to the sheep tail type and its application in the early screening of fat or thin tails of sheep. The enhancer of the present invention is the distal enhancer upstream of the ADAMTS1 gene, which is located in the 128464792-128465192 region of chromosome 1 of the sheep reference genome ARS-UI_Ramb_v2.0 version. By detecting the influence of the distal enhancer on the expression of the ADAMTS1 gene, different tail type traits of sheep can be detected, which can be used for the early selection of sheep with different tail types, improve the accuracy of seed selection, shorten the breeding cycle, speed up the breeding process, and provide a scientific basis for the molecular marker-assisted selection of sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the result of analyzing enhancers in fat and lean sheep using the CUT&Tag (H3K27ac) method;

[0027] Figure 2 The expression of ADAMTS1 gene in fat and lean sheep;

[0028] Figure 3 The expression level of ADAMTS1 gene in fat and lean sheep after knocking out the distal enhancer region of ADAMTS1 gene. DETAILED DESCRIPTION

[0029] The present invention provides a distal enhancer of the ADAMTS1 gene related to the sheep tail type, wherein the distal enhancer of the ADAMTS1 gene is located at chromosome 1 of the sheep reference genome ARS-UI_Ramb_v2.0 version (Genbank sequence number is NC_056054.1) at positions 128464792-128465192. In the present invention, the distal enhancer of the ADAMTS1 gene is located upstream of the ADAMTS1 gene.

[0030] The present invention also provides the application of the distal enhancer of the ADAMTS1 gene in the early screening of fat or thin tails in sheep.

[0031] The present invention also provides application of the ADAMTS1 gene distal enhancer in sheep assisted breeding.

[0032] The present invention also provides an application of knocking out the distal enhancer of the ADAMTS1 gene in early screening of fat or thin tails in sheep. After knocking out the distal enhancer of the ADAMTS1 gene, sheep with lower ADAMTS1 gene expression levels are fat-tailed sheep; after knocking out the distal enhancer of the ADAMTS1 gene, sheep with unchanged ADAMTS1 gene expression levels are thin-tailed sheep.

[0033] The present invention also provides the use of knocking out the distal enhancer of the ADAMTS1 gene in sheep assisted breeding.

[0034] The present invention also provides a primer pair for amplifying the distal enhancer of the ADAMTS1 gene (Chr1: 128464792-128465192), and the primer pair is shown in SEQ ID NO.1-2; SEQ ID NO.1 is an upstream primer, and the sequence is TCCTGCCAGTTCTAATTTCTGC; SEQ ID NO.2 is a downstream primer, and the sequence is ATGGAAGAGCTTCATCAGAAAC.

[0035] The present invention also provides the application of the primer pair in early screening of fat or thin tails of sheep and / or sheep assisted breeding.

[0036] The present invention also provides a method for early screening of fat and thin tails in sheep, comprising the following steps:

[0037] (1) Using CRISPR / cas9 method, a knockout plasmid of the distal enhancer gene sequence of ADAMTS1 gene was constructed;

[0038] (2) mixing the knockout plasmid described in step (1) with sheep tail fat cells and a transfection reagent, and culturing for 6 to 7 days to obtain a test object;

[0039] (3) extracting RNA from the object to be tested, reverse transcribing it into cDNA, amplifying the cDNA using the primer pair, detecting the expression level of the ADAMTS1 gene in the amplified product by real-time fluorescence quantitative PCR, and determining the tail type of the sheep based on the result of the ADAMTS1 gene expression;

[0040] The ADAMTS1 gene distal enhancer described in step (1) is the ADAMTS1 gene distal enhancer.

[0041] In the present invention, the sequence of the short guide RNA in the CRISPR / cas9 method in step (1) is shown in SEQ ID NO.5; the specific sequence is: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT;

[0042] The transfection reagent described in step (2) is lipo3000;

[0043] The reverse transcription system in step (3) is divided into two steps: the first step is 5×gDNAEraser Buffer 2 μL, gDNA Eraser 1 μL, RNA 1000ng, ddH 2O to 10 μL; the system of the second step is the system of the first step 10 μL, PrimerScript RT Enzyme MixⅠ1 μL, RT Primer Mix 1 μL, 5× Primer Script BufferⅠ4 μL, ddHO 2 O 4 μL;

[0044] The amplification system was as follows: 2 μL template cDNA, 0.8 μL upstream and downstream primers, 0.8 μL each, ddH 2 O 6.4μL, TB GreenPremix Ex TaqⅡ10μL;

[0045] The reaction procedure of the reverse transcription in step (3) is divided into two steps: the reaction procedure of the first step is 42°C for 2 min, 4°C infinity; the reaction procedure of the second step is 37°C for 15 min, 85°C for 5 s, 4°C infinity;

[0046] The amplification reaction program was: 95°C for 5 min; 95°C for 10 s, 60°C for 10 s, and 70°C for 15 s, for a total of 40 cycles.

[0047] In the present invention, the primer pair of the internal reference gene (β-actin) during real-time fluorescence quantitative PCR (qPCR) detection is shown in SEQ ID NO. 3 to 4. SEQ ID NO. 3 is an upstream primer, and the sequence is CCAACCGTGAGAAGATGACC; SEQ ID NO. 4 is a downstream primer, and the sequence is CCCGAGGCGTACAGGGACAG.

[0048] The primer pairs for detecting the expression of ADAMTS1 gene in the amplified product by real-time fluorescence quantitative PCR are shown in SEQ ID NO. 6-7;

[0049] SEQ ID NO.6 is an upstream primer, the sequence is CACCTCTGGCGGATTGCTGATG;

[0050] SEQ ID NO.7 is a downstream primer, and the sequence is CGTTGACACACCATTTCCCCTCTC.

[0051] The present invention also provides a kit for early screening of fat or thin tails of sheep and / or sheep assisted breeding, comprising a reagent for knocking out the distal enhancer of the ADAMTS1 gene and / or the primer pair.

[0052] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0053] Example 1

[0054] 1. CUT&Tag analysis of enhancers

[0055] For two fat-tailed sheep (Hu sheep) and two thin-tailed sheep (Tibetan sheep), concanavalin A-coated magnetic beads were used to bind cells; the non-ionic detergent digitonin was used to permeabilize the cell membrane, and the primary antibody of the H3K27ac target protein was added for incubation (the antibody can enter the cell nucleus through the cell membrane and nuclear pores and bind to the target protein), and the secondary antibody was added to enhance the targeted binding ability; Protein A-Tn5 (pA-Tn5) was added for incubation (Protein A comes from the surface protein of Staphylococcus aureus and can specifically bind to the Fc region (constant region) of the antibody); Tn5 was brought to the vicinity of the target protein through the binding of Protein A and the antibody, and Mg was added 2+ Tn5 was activated to cut the sequence near the target protein, so that the target protein and the DNA sequence bound to it were separated from the chromatin and released outside the cell; DNA was extracted, and the fragments below 700 bp were sorted by magnetic beads, and PCR amplification was performed to construct a library, which can be used for high-throughput sequencing. The enhancer was studied by sequencing on the Illumina PE150 platform, using the gene sequence of the ARS-UI_Ramb_v2.0 version as the reference genome for comparison. The research results are as follows Figure 1 shown.

[0056] Compared with thin-tailed sheep, the region 128464792-128465192 on chromosome 1 (Genbank sequence number NC_056054.1, reference version ARS-UI_Ramb_v2.0) upstream of the ADAMTS1 gene can form a differential enhancer region in fat-tailed sheep.

[0057] from Figure 1 It can be seen that a differential enhancer region (Genbank sequence number NC_056054.1, 128464792-128465192) was found on chromosome 1. Gene annotation was performed and it was found that this region was located upstream of the ADAMTS1 gene.

[0058] 2. Transcriptome sequencing

[0059] Tail adipose tissue was collected from three fat-tailed sheep (Hu sheep) and three thin-tailed sheep (Tibetan sheep), washed with 0.9% NaCl, and frozen in liquid nitrogen to extract RNA. Dual sequencing was performed on the BGISEQ-500 sequencing platform, and the raw data were quality controlled using the SOAPnuke v1.4.0 program. The raw reads were trimmed using Trimmomatic to remove adapter sequences, poly-N, and low-quality sequence reads to obtain Clean reads. Clean reads were processed using HISAT v2.1.0, and ARS-UI_Ramb_v2.0 was used as the reference genome for comparison. A reference genome index was constructed using Bowtie2 (v2.2.5), and expression levels were calculated using RSEM. The results are shown in the figure. Figure 2 shown.

[0060] Figure 2 H1, H2 and H3 represent Hu sheep, and T1, T2 and T3 represent Zang sheep. Figure 2 It can be seen that the expression level of ADAMTS1 gene is high in thin-tailed sheep, and low in fat-tailed sheep.

[0061] Example 2

[0062] Verification of the relationship between the distal enhancer of Example 1 and the fat or thin tail of sheep by real-time fluorescence quantitative PCR (qPCR)

[0063] The knockout plasmid of the distal enhancer region of Example 1 was constructed using CRISPR / cas9; preadipocytes were isolated from the adipose tissue of the sheep tail and plated into 6-well plates. The knockout plasmid (experimental group) and blank plasmid (control group) were transfected using lipo3000 in the 6-well plates. After 6 hours, the complete medium (DMEM F12 medium + 5% fetal bovine serum + 1% double antibody) was changed to culture for 2 days; puromycin medium was used for screening for 2 days, followed by induction differentiation medium (complete medium + 1μM dexamethasone + 10mg / L insulin + 0.5mM IBMX) for 2 days; finally, RNA was extracted and reverse transcribed into cDNA for quantitative verification of the expression of the ADAMTS1 gene. ADAMTS1 and the internal reference gene were quantitatively verified by qPCR, and 3 technical replicates were set for each group. According to 2 -ΔΔCtThe results were analyzed by the method, and the internal reference gene was β-actin. Among them, the short guide RNA in CRISPR / cas9 is shown in SEQ ID NO.5, SEQ ID NO.5: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT. The primer pair for amplifying the distal enhancer of the ADAMTS1 gene is shown in SEQ ID NO.1-2, upstream primer: TCCTGCCAGTTCTAATTTCTGC (SEQ ID NO.1), downstream primer: ATGGAAGAGCTTCATCAGAAAC (SEQ ID NO.2); the primers for the internal reference gene (β-actin) during qPCR detection are β-actin-F: CCAACCGTGAGAAGATGACC (SEQ ID NO.3), β-actin-R: CCCGAGGCGTACAGGGACAG (SEQID NO.4). The primer pair for qPCR detection of ADAMTS1 gene in the amplified product is shown in SEQ ID NO. 6 to 7. The upstream primer: CACCTCTGGCGGATTGCTGATG is shown in SEQ ID NO. 6; the downstream primer: CGTTGACACACCATTTCCCCTCTC is shown in SEQ ID NO. 7.

[0064] The reverse transcription system is as follows: the first step is 5×gDNAEraserBuffer 2μL, gDNA Eraser 1μL, RNA 1000ng, ddH 2 O to 10 μL; the system of the second step is 10 μL of the system of the first step, PrimerScript RT Enzyme MixⅠ1 μL, RT Primer Mix 1 μL, 5× Primer Script BufferⅠ4 μL, ddHO 2 O 4 μL;

[0065] The reaction program of reverse transcription was as follows: the reaction program of the first step was 42°C for 2 min, 4°C infinity; the reaction program of the second step was 37°C for 15 min, 85°C for 5 s, 4°C infinity;

[0066] According to TB Green premixed Ex Taq TM qPCR was performed according to the instructions of II (Takara, China). The amplification conditions were as follows:

[0067] qPCR experiments were performed using the LightCycler / LightCycler 480 system (Roche Diagnostics).

[0068] The qPCR reaction system was: 2 μL template cDNA (50 ng / μL), 0.8 μL upstream and downstream primers (10 μM), 6.4 μL ddHO 2 O, 10μLTB Green Premix Ex TaqⅡ.

[0069] The reaction program for qPCR amplification was: 95°C for 5 min; 95°C for 10 s, 60°C for 10 s, 70°C for 15 s, and 40 cycles.

[0070] The target fragment of the amplified ADAMTS1 gene is shown in SEQ ID NO.8. SEQ ID NO.8: The sequence is as follows: CGATTGATGTCTCCCTGCAGTGCCTCCACGATTACAACATTTCTGGATAATGGTCATGGTGAATGTTTGATGGACGAGCCCCAGCGCCTCATACAGCTCCCCTCTGATCTCCCCGGGGCCTTGTACAGTGCCAGCCGACAGTGCGAGCTCACATTTGGACAGGGGTCCAGACACTGCCCGGACGCGGCCAGCACTTGCACGACCCTCTGGTGCACGGGCACCTCTGGCGGATTGCTGATGTGCCAGACCAAACACTTCCCCTGGGCCGATGGCACCAGCTGTGGAGAGGGGAAATGGTGTGTCAACGGCCAGTGCCTGAACCAGACCAACAGGGAACACTTTGATACCCCTGTTCACGGAAGCTGGGGGCCGTGGGGGCCCTGGGGAGACTGCTCGAGAACGTGTGGTGGTGGAGTTCAGTATACGATGAGGAAGTGTGACAACCCCGTGCCGAAGAACGGAGGAAGATACTGCGAGGGCAAGCGCGTGCGCTACAGATCCTGCAACATCGAGGACTGCCCGAAGAATAGCGGAAAAACCTTTAGGCTGGAACAGTGTGAGGCACACAATGAATTCTCCAAAGCTTCCTTTGGCAGCAGGCCCGCAGTGGAGTGGATACCCAAATATGCAGGAGTCTCGCCCAAGGACAGGTGCAAGCTTATCTGTCAAGCCAAAGGCACTGGCTATTTCTTCGTTTTGCAGCCCAAGGTGGTGGATGGCACCCCATGTAGCCCAGATTCCACTTCCGTCTGTGTGCAAGGACAGTGCGTAAAAGCTGGCTGTGATCGCATCATAGACTCCAAAAAGAAGTTCGACAAATGTGGCGTCTGTGGAGGAAATGGATCTACATGCAAGAAAATATCAGGATCAGTTACCAGTGCAAGACCCGGCTACCATGATATCGTCACAATTCCAACCGGAGCCACAAACGTTAAAGTGAAGCAACGGACTCAGAGAGGATCCAGGAATAACGGGAGCTTCCTGGCCATCAAAGCTGCCGATGGCACATATATCCTGAATGGCAACTTCACTCTGTCCACTTTAGAGCAAGACATCACACACAAAGGTACTGCCCTGAGGTACAGCGGCTCCTCGGCGGCGCTGGAAAGAACTCGAAGCTTCAGCCCTCTCATGGAGCCCTTAACCATCCAAGTTCTGATGGTGGGCAGTGCCCTCCGACCCAAAATTAAACACACCTATTTCGTGAAGAAGAAGAAGGAATCTTTCAACGCCATTCCTACTTTCTCGGAGTGGGTCATTGAAGAATGGGGTGAGTGTTCCAAGTCTTGTGGGCTGGGTGTACAGAGAAGGCTCGTGGAGTGTCGGGACATCAACGGACAGCCCGCTTCAGAGTGCGCCAAGGAAGTGAAGCCGGCCAGCACCAGACCTTGTGTGAACCTGCCTTGCCCCCGCTGGCAGCTGGGGGACTGGTCGCCGTGTTCCAAGACTTGCGGGAAGGGTTACAAAAAGAGAACCTTGCAGTGTCTGTCCCATGATGGGGGGGTGTTGTCTCATGAGAGCTGTGATCCTTTAAAGAAACCTAAACACTACATAGACTTCTGCACAACGGCAGAGTGCAGTTAA。

[0071] Analyze according to the 2×2 -ΔΔCt method. Among them, ΔΔCt = (CT 目的基因 - CT 内参基因 ) 实验组 -(CT 目的基因 - CT 内参基因 )对照组 . 2 -ΔΔCt It represents the multiple of the expression of the target gene in the experimental group relative to the control group. SPSS was used for statistical analysis. The Ct values ​​obtained from 3 biological replicates and 3 technical replicates were calculated according to the formula, and the average value was taken for plotting. Figure 3 As shown, (Enh1~Enh9 represent Hu sheep; NC1~NC9 represent Tibetan sheep).

[0072] from Figure 3 It can be seen that the expression of ADAMTS1 gene has been significantly reduced and is related to the sheep tail type. After knocking out this region, the expression of ADAMTS1 gene becomes low, and this region is an enhancer region, which is a fat-tailed sheep. If the expression of ADAMTS1 gene does not change, this region is not an enhancer region, and the sheep is thin-tailed. The detection of this distal enhancer is used to carry out early selection of sheep tail type, shorten the breeding cycle, speed up the breeding process, and reduce breeding costs, which has a high application value.

[0073] The invention provides a distal enhancer of an ADAMTS1 gene related to a sheep tail type and application thereof in early screening of fat or thin tails of sheep. The enhancer of the invention is an upstream distal enhancer of the ADAMTS1 gene and is located in the 128464792-128465192 region of chromosome 1 of the sheep reference genome ARS-UI_Ramb_v2.0 version. By detecting the influence of the distal enhancer on the expression of the ADAMTS1 gene, different tail type traits of sheep can be detected, which is used for early selection of sheep with different tail types, improves selection accuracy, shortens the breeding cycle, accelerates the breeding process, and provides a scientific basis for molecular marker-assisted selection of sheep.

[0074] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A distal enhancer of the ADAMTS1 gene associated with sheep tail type, characterized in that: The sequence of the distal enhancer of the ADAMTS1 gene corresponds to the sequence 128464792-128465192 of chromosome 1 of the sheep reference genome ARS-UI_Ramb_v2.0 version.

2. Use of the distal enhancer of the ADAMTS1 gene according to claim 1 in early screening of fat or thin tails in sheep.

3. Use of the distal enhancer of the ADAMTS1 gene according to claim 1 in sheep assisted breeding.

4. Use of knocking out the distal enhancer of the ADAMTS1 gene according to claim 1 in early screening of fat or thin tails in sheep, characterized in that: After knocking out the distal enhancer of the ADAMTS1 gene, the expression level of the ADAMTS1 gene decreased in the fat-tailed sheep; after knocking out the distal enhancer of the ADAMTS1 gene, the expression level of the ADAMTS1 gene remained unchanged in the thin-tailed sheep.

5. Use of knocking out the distal enhancer of the ADAMTS1 gene according to claim 1 in sheep assisted breeding.

6. A method for early screening of fat and thin tails in sheep, characterized in that: The steps include: (1) Using CRISPR / cas9 method, a knockout plasmid of the distal enhancer gene sequence of ADAMTS1 gene was constructed; (2) mixing the knockout plasmid described in step (1) with sheep tail fat cells and a transfection reagent, and culturing for 6 to 7 days to obtain a test object; (3) extracting RNA from the sample, reverse transcribing it into cDNA, amplifying the cDNA using a primer pair for amplifying the ADAMTS1 gene, detecting the expression level of the ADAMTS1 gene in the amplified product by real-time fluorescence quantitative PCR, and determining the tail type of the sheep based on the result of the ADAMTS1 gene expression; After knocking out the distal enhancer of ADAMTS1 gene, the expression level of ADAMTS1 gene decreased in fat-tailed sheep; after knocking out the distal enhancer of ADAMTS1 gene, the expression level of ADAMTS1 gene remained unchanged in thin-tailed sheep; The ADAMTS1 gene distal enhancer described in step (1) is the ADAMTS1 gene distal enhancer described in claim 1; The primer pair for amplifying the ADAMTS1 gene is shown in SEQ ID NO: 6-7.

7. The early screening method for fat or thin tails of sheep according to claim 6, characterized in that: The sequence of the short guide RNA in the CRISPR / cas9 method in step (1) is shown in SEQ ID NO.5; The transfection reagent described in step (2) is lipo3000; The reverse transcription system of step (3) is as follows: the system of the first step is 5×gDNA Eraser Buffer 2 μL, gDNAEraser 1 μL, RNA 1000 ng, ddH2O fixed to 10 μL; the system of the second step is 10 μL of the system of the first step, PrimerScript RT Enzyme MixⅠ1 μL, RT Primer Mix 1 μL, 5×Primer ScriptBufferⅠ4 μL, ddH2O 4 μL; The amplification system was as follows: template cDNA 2 μL, upstream and downstream primers 0.8 μL each, ddH2O 6.4 μL, TB Green PremixEx TaqⅡ10 μL; The reaction procedure of the reverse transcription in step (3) is as follows: the reaction procedure of the first step is 42°C for 2 min, 4°C ∞; the reaction procedure of the second step is 37°C for 15 min, 85°C for 5 s, 4°C ∞; The amplification reaction program was: 95°C for 5 min; 95°C for 10 s, 60°C for 10 s, and 70°C for 15 s, for a total of 40 cycles.

Images