Transcription factor gene CmERF098 and its application in regulating pumpkin powdery mildew resistance

By overexpressing the transcription factor gene CmERF098 in pumpkin, negatively regulating genes related to the jasmonic acid signaling pathway, the problem of weak resistance to powdery mildew in pumpkin was solved, resulting in significant enhancement of pumpkin's resistance to powdery mildew and providing breeding guidance.

CN118931914BActive Publication Date: 2025-11-14QINGDAO UNIV OF SCI & TECH +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410641276.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-22
Publication Date
2025-11-14
Estimated Expiration
2044-05-22

AI Technical Summary

Technical Problem

The existing technology does not involve the application of the ERF gene in the resistance of pumpkin to powdery mildew, as pumpkin has relatively weak resistance to powdery mildew.

Method used

The transcription factor gene CmERF098 was cloned and overexpressed in pumpkin. It regulated the resistance of pumpkin to powdery mildew by negatively regulating the expression of genes CmOPR3, CmMYC2 and CmJAR1 in the jasmonic acid signaling pathway.

Benefits of technology

It significantly improves pumpkin's resistance to powdery mildew, enhances its antioxidant defense capabilities, promotes protein metabolism and photosynthesis, and provides important genetic resources and breeding guidance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004853358190000091
    Figure BDA0004853358190000091
  • Figure BDA0004853358190000092
    Figure BDA0004853358190000092
  • Figure HDA0004853358200000011
    Figure HDA0004853358200000011
Patent Text Reader

Abstract

This invention belongs to the fields of molecular biology and genetic engineering, specifically relating to a transcription factor gene CmERF098 and its application in regulating pumpkin resistance to powdery mildew. The nucleotide sequence of the transcription factor gene CmERF098 is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the transcription factor gene CmERF098 is shown in SEQ ID NO:2. This invention obtained the transcription factor gene CmERF098, and overexpressed it in pumpkin. It was found that CmERF098 positively regulates pumpkin resistance to powdery mildew, and that malondialdehyde, POD activity, SOD activity, protein content, and chlorophyll content all showed significant or highly significant differences compared to the wild type. Further investigation revealed that under powdery mildew stress, CmERF098 negatively regulates the expression of the jasmonic acid signaling pathway jasmonic acid synthase gene CmOPR3, the transcription factor gene CmMYC2, and the jasmonic acid amide synthase gene CmJAR1, thereby regulating pumpkin resistance to powdery mildew.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and genetic engineering technology, specifically relating to a transcription factor gene CmERF098 and its application in regulating pumpkin resistance to powdery mildew. Background Technology

[0002] Powdery mildew is one of the major diseases affecting pumpkin production, not only impacting plant growth but also potentially causing plant death in severe cases. Transcription factors have been shown to control the activation of various stress response genes. Among them, AP2 / ERF (APETALA2 / Ethylene Responsive Factor) is one of the largest transcription factor families in plants, involved in various plant growth, development, hormone regulation, and responses to various stresses. For example, the AaORA gene, an ERF transcription factor in Artemisia annua, enhances plant resistance to Botrytis cinerea, while the GmERF5 gene in soybean enhances resistance to Phytophthora soybeanis. MdERF100 in apple not only increases Arabidopsis thaliana resistance to powdery mildew but also increases the accumulation of reactive oxygen species (ROS) and cell death. Furthermore, MdERF100 mediates Arabidopsis thaliana resistance to powdery mildew through the jasmonic acid and salicylic acid signaling pathways. Although there are 212 AP2 / ERF genes in the pumpkin genome, the application of ERF genes in regulating pumpkin resistance to powdery mildew has not yet been explored. Summary of the Invention

[0003] The purpose of this invention is to solve the aforementioned problems in the prior art and to propose a transcription factor gene CmERF098 and its application in regulating pumpkin resistance to powdery mildew. This invention obtains the transcription factor gene CmERF098, overexpresses it in pumpkin, and finds that CmERF098 positively regulates pumpkin resistance to powdery mildew. Furthermore, it shows significant or highly significant differences in malondialdehyde (MDA) activity, POD activity, SOD activity, protein content, and chlorophyll content compared to the wild type. Further investigation reveals that under powdery mildew stress, CmERF098 negatively regulates the expression of jasmonic acid signaling pathway-related genes CmOPR3, CmMYC2, and CmJAR1, thereby regulating pumpkin resistance to powdery mildew.

[0004] The technical solution of this invention is:

[0005] The present invention provides a transcription factor gene CmERF098, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0006] The present invention also provides a protein encoded by the transcription factor gene CmERF098, the amino acid sequence of which is shown in SEQ ID NO:2.

[0007] This invention further provides the application of the aforementioned transcription factor gene CmERF098 in improving the resistance of pumpkin to powdery mildew.

[0008] This invention further provides the application of the aforementioned transcription factor gene CmERF098 in the positive regulation of pumpkin resistance to powdery mildew.

[0009] Furthermore, the transcription factor gene CmERF098 positively regulates the resistance of pumpkin to powdery mildew by negatively regulating the expression of jasmonic acid synthase gene CmOPR3, transcription factor gene CmMYC2 and jasmonic acid amide synthase gene CmJAR1 in the jasmonic acid signaling pathway.

[0010] The present invention also provides an overexpression vector constructed from the transcription factor gene CmERF098, wherein the CmERF098 gene is linked to the pSUPER1300 vector by homologous recombination technology.

[0011] The present invention also provides an engineered bacterium comprising the overexpression vector described above.

[0012] This invention provides the application of the overexpression vector or the engineered bacteria in improving the resistance of pumpkin to powdery mildew or positively regulating the resistance of pumpkin to powdery mildew.

[0013] The beneficial effects of this invention are:

[0014] (1) This invention cloned the transcription factor gene CmERF098, which is expressed in the cell nucleus and has transcriptional activation activity; powdery mildew stress and methyl jasmonate significantly induced the expression of the CmERF098 gene. This invention enriches the application of EFR family transcription factors in plant disease resistance and has important guiding significance for pumpkin breeding and the cultivation of disease-resistant germplasm resources.

[0015] (2) This invention obtains the transcription factor gene CmERF098 that regulates plant resistance to powdery mildew. Overexpression of the CmERF098 gene in pumpkin can positively regulate pumpkin resistance to powdery mildew, providing an important gene resource for the breeding of pumpkin resistant varieties and has broad application prospects. Attached Figure Description

[0016] Figure 1 The image shows the PCR product of the CmERF098 gene amplified by RT-PCR.

[0017] Figure 2 PCR screening for the pSUPER1300-CmERF098 recombinant plasmid; lanes 1, 2, 3, and 4 represent different positive clones;

[0018] Figure 3 Subcellular localization of CmERF098;

[0019] Figure 4 Verification of CmERF098 transcriptional activation activity;

[0020] Figure 5 The time-series expression of CmERF098 under powdery mildew stress; asterisks indicate significant differences between the treatment group and the control group (0h) (*p<0.05, **p<0.01);

[0021] Figure 6 The time-series expression of CmERF098 under methyl jasmonate (MeJA) treatment; asterisks indicate significant differences between the treatment group and the control group (0h) (*p<0.05, **p<0.01);

[0022] Figure 7 qRT-PCR analysis of CmERF098 in overexpressing pumpkin plants and wild-type pumpkin plants under powdery mildew stress; asterisks indicate significant differences between overexpressing pumpkins and the control group (*p<0.05); WT represents wild-type pumpkins, and OE represents overexpressing pumpkin plants;

[0023] Figure 8 Phenotypes of wild-type pumpkin and overexpressing pumpkin plants under powdery mildew stress. WT represents wild-type pumpkin and OE represents overexpressing pumpkin plants.

[0024] Figure 9 Physiological indicators of wild-type and overexpressing pumpkin plants under powdery mildew stress: A. CAT; B. MDA content; C. POD activity; D. SOD activity; E. Protein content; F. Chlorophyll content; Asterisks indicate significant differences between overexpressing and wild-type pumpkins (*p<0.05, **p<0.01), WT represents wild-type pumpkin plants, and OE represents overexpressing pumpkin plants;

[0025] Figure 10 The relative expression levels of JA signaling pathway genes in wild-type and overexpressing pumpkins under powdery mildew stress (*p<0.05, **p<0.01). WT represents wild-type pumpkins, and OE represents overexpressing pumpkin plants. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Unless otherwise specified, the technical means used in the embodiments of this invention are all conventional means known to those skilled in the art. The experimental methods in the following embodiments are all conventional methods unless otherwise specified. Unless otherwise specified, the materials, reagents, etc., used in the following embodiments are all commercially available.

[0028] The pumpkin germplasm inbred line “nd4” used in this invention belongs to the Chinese pumpkin (Cucurbita moschata) type. It is a pumpkin inbred line obtained by the Qingdao Academy of Agricultural Sciences (Qingdao Branch of Shandong Academy of Agricultural Sciences) in 2011 from intermediate breeding materials introduced from Shandong Agricultural University and obtained through multiple generations of self-pollination.

[0029] This invention utilizes transcriptome sequencing analysis of pumpkin "nd4" leaves under powdery mildew stress to screen for the powdery mildew resistance-related gene CmERF098. The CmERF098 gene was cloned from "nd4" pumpkin leaves, and its cDNA is shown in SEQ ID NO: 1, while the encoded amino acid sequence is shown in SEQ ID NO: 2. Subcellular localization studies indicate that this gene is located in the cell nucleus and possesses transcriptional activation activity. Powdery mildew stress and methyl jasmonate treatment significantly induced the expression of the CmERF098 gene. Overexpression of this gene in pumpkin revealed that CmERF098 positively regulates pumpkin resistance to powdery mildew, with significant or highly significant differences in malondialdehyde, POD activity, SOD activity, protein content, and chlorophyll content compared to the wild type. Further investigation showed that under powdery mildew stress, CmERF098 downregulates the expression of JA signaling pathway-related genes CmOPR3, CmMYC2, and CmJAR1, thereby regulating pumpkin resistance to powdery mildew. Therefore, this invention not only provides important gene resources for the breeding of resistant pumpkin varieties, but also has important guiding significance and application prospects for pumpkin breeding.

[0030] To further understand the present invention, the invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0031] Example 1: Cloning of the pumpkin transcription factor CmERF098 gene

[0032] Based on the transcriptome sequencing results of pumpkin leaves under powdery mildew stress, the gene CmERF098, which is associated with powdery mildew resistance, was screened out. The gene sequence of CmERF098 was obtained from the pumpkin germplasm “nd4” transcriptome sequencing information and expression level (FPKM). A pair of primers was designed based on this sequence, and the primer sequences are as follows:

[0033] Forward primer F1: 5'-ATGGAAGGAAAAAGATCCACAAAC-3' (SEQ ID NO: 3),

[0034] Reverse primer R1: 5'-TCGGTTCTTCCGATTGAATCC-3' (SEQ ID NO: 4).

[0035] Total RNA was extracted from leaves of pumpkin germplasm "nd4" treated with powdery mildew using the SteadyPure Plant RNA Extraction Kit (Aikerui Biotechnology (Qingdao) Co., Ltd.). Concentration and purity were measured using a micro spectrophotometer. RNA integrity was assessed using 1% agarose gel electrophoresis. The extracted RNA was converted to cDNA using a reverse transcription premix kit, and PCR amplification was performed using the cDNA as a template. The PCR reaction mixture consisted of 12.5 μL of 2×HieffPCR Master Mix, 0.5 μL of forward primer F1, 0.5 μL of reverse primer R1, 10.5 μL of RNase-free water, and 1 μL of cDNA template. The PCR program was 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 40 cycles, followed by 72℃ for 10 min. The PCR product of the CmERF098 gene amplification is shown below. Figure 1 As shown in the figure. The PCR products were sequenced by Sangon Biotech (Shanghai) Co., Ltd. The sequencing results showed that the nucleotide sequence of the pumpkin CmERF098 gene is shown in SEQ ID NO: 1. The amino acid sequence of the protein encoded by the pumpkin CmERF098 gene is shown in SEQ ID NO: 2.

[0036] Example 2: Subcellular localization of CmERF098 protein

[0037] 1. Constructing overexpression vectors

[0038] Primers were designed based on the cDNA sequence of the CmERF098 gene and the pSUPER1300 vector sequence using the single-fragment cloning website provided on the Novizan website (https: / / crm.vazyme.com / cetool / singlefragment.html / ) for amplification of the CmERF098 insert. The designed forward primer was F2: 5'- GGTCGACATTTAAATACTAGT ATGGAAGGAAAAAGATCCACAAAC-3' (SEQ ID NO: 5), designed reverse primer R2: 5'- GCCCTTGCTCACCATGGTACCTCGGTTCTTCCGATTGAATCC-3' (SEQ ID NO: 6), the underlined sequence is the pSUPER1300 vector sequence. Using pumpkin cDNA as a template, the CmERF098 gene was amplified. The PCR products were separated by 1% agarose gel electrophoresis and recovered using a gel extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). The pSUPER1300 plasmid was digested with SpeI and KpnI, and the large fragment was recovered. The CmERF098 fragment was ligated to the pSUPER1300 vector using a clonexpressII one-step cloning kit (Nanjing Novizan Biotechnology Co., Ltd.).

[0039] The ligation product was transformed into *E. coli* DH5α competent cells using a heat shock method. Cells were screened on kanamycin-resistant LB agar, and single colonies were picked and cultured. After PCR identification, positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results showed that the overexpression vector was successfully constructed. The recombinant plasmid pSUPER1300-CmERF098 was extracted using a plasmid extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). PCR identification results are as follows: Figure 2 As shown.

[0040] 2. Constructing engineered bacteria

[0041] Agrobacterium GV3101 competent cells were placed on ice and allowed to thaw. Then, 2 μl of the pSUPER1300-CmERF098 recombinant plasmid was added. The mixture was incubated on ice for 5 min, then frozen in liquid nitrogen for 5 min, incubated in a 37°C water bath for 5 min, and then incubated on ice for 5 min. 700 μl of antibiotic-free LB broth was added, mixed well, and incubated at 28°C and 200 rpm for 2-3 h. The mixture was then plated on LB agar plates and incubated for 2-3 days. Single colonies were picked and identified by PCR using the pSUPER1300 vector forward primer F3: 5'-ACACCAAATCGACTCTAGAAAGC-3' (SEQ ID NO: 7) and the CmERF098 gene reverse primer R1: 5'-TCGGTTCTTCCGATTGAATCC-3' (SEQ ID NO: 4). Engineered bacteria containing the overexpression vector pSUPER1300-CmERF098 were obtained.

[0042] 3. Engineered bacteria infect pumpkin seeds

[0043] Select plump, uniformly sized pumpkin seeds and soak them in sterile warm water for 20 minutes, then peel off the seed coat. Disinfect with 1% sodium hypochlorite for 10 minutes, rinse five times with sterile water, and place in sterile petri dishes. Add three sheets of sterile filter paper moistened with MS medium to each petri dish and incubate at 28°C in the dark for two days to promote germination. Inoculate Agrobacterium containing the pSUPER1300-CmERF098 vector into LB liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampin, and incubate until the OD600 reaches approximately 0.8. Collect the cells by centrifugation. Resuspend the cells in MS liquid medium (basic components: 30% sucrose, 200 μmol / L ethanol eugenol, pH = 5.2), adjust the OD600 to 0.3, and incubate at 28°C for 2–3 hours before use. Transfer the germinated seeds to a sterile beaker containing 20 ml of MS liquid culture medium and sonicate for 2 min in a 60W ultrasonic cleaner (Shenzhen Derui Ultrasonic Equipment Co., Ltd.). Discard the culture medium, pour the engineered bacteria into the beaker, and vacuum impregnate it using a vacuum pump (SHZ-D, Shanghai, China) (-0.06 MPa, 5 min).

[0044] 4. Cotyledon injection

[0045] The engineered bacteria were inoculated into 50 ml of LB liquid medium containing 50 mg / L kanamycin for expansion culture. The medium was shaken until the OD600 reached approximately 0.8, and the cells were collected by centrifugation. The engineered bacteria were resuspended in transformation solution (containing 1 mol / L MgCl2, 1 mol / L morpholine ethanesulfonic acid, and 20 mg / mL acetylsylphenone). The OD600 was adjusted to 0.5, and the culture was incubated at 28°C for 2–4 hours before use.

[0046] The transformation solution was injected into the pumpkin cotyledons using a needle-free syringe until the cotyledons were filled with liquid. Excess liquid on the surface of the cotyledons was blotted dry with filter paper. As a negative control, Agrobacterium containing the empty vector pSUPER1300 was injected into the pumpkin cotyledons. The seedlings were placed in a climate incubator at 25°C (16h light / 8h dark cycle) and cultured for 48–72h.

[0047] 5. GFP fluorescence detection

[0048] Peel the lower epidermis of pumpkin seed leaves to prepare temporary slides. Observe GFP fluorescence in cells using a confocal microscope (TCS SP8). Detect fluorescence signals by observing DAPI fluorescence (excitation wavelength 340–380 nm, emission wavelength 400–435 nm) and GFP excitation light (excitation wavelength 465–495 nm, emission wavelength 505–555 nm) under a microscope. Drop a small amount of DAPI staining solution (5 mg / L) onto the slide. Spread the lower epidermis evenly on the solution for 5–10 min, rinse the epidermis 3–5 times with water, and observe DAPI fluorescence.

[0049] The subcellular localization of CmERF098 protein was studied using a transient expression system, and the results are as follows: Figure 3 As shown, Agrobacterium containing the vector pSUPER1300 transiently transformed pumpkin cotyledons, and green fluorescent protein (GFP) was widely dispersed in the cells. The GFP fluorescent signal fused to the N-terminus of CmERF098 protein was localized to the cell nucleus, indicating that CmERF098 is localized to the cell nucleus.

[0050] Example 3: Analysis of CmERF098 gene transcriptional activation activity

[0051] 1. Constructing the pGBKT7-CmERF098 recombinant vector

[0052] Primers for amplifying the CmERF098 gene were designed based on the pGBKT7 vector sequence. The forward primer F4: 5'- AGGCCGAA TTCCCGGGGATCCAT ATGGAAGGAAAAAGATCCACAAAC-3' (SEQ ID NO: 8), reverse primer R3: 5'- CTAGTT ATGCGGCCGCTGCAGT TCGGTTCTTCCGATTGAATCC-3' (SEQ ID NO: 9), the underlined part is the vector sequence. The CmERF098 gene fragment was amplified using pSUPER1300-CmERF098 plasmid as a template. The pGBKT7 plasmid was double-digested with BamHI and PstI restriction endonucleases in the following composition: BamHI 2.5 μL, PstI 2.5 μL, 10×K Buffer 5 μL, pGBKT 7.5 μL, ddH2O 35 μL. The large fragment of the pGBKT7 vector was recovered using a gel extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). Then, the previously recovered CmERF098 gene fragment was ligated to the double-digested pGBKT7 vector using the ClonExpress II One Step Cloning Kit. Subsequently, the recombinant product was transferred into E. coli DH5α competent cells (Nanjing Novizan Biotechnology Co., Ltd.) according to the manufacturer's instructions.

[0053] 2. Transformation of yeast cells in their accepted state

[0054] The constructed pGBKT7-CmERF098, negative control pGBKT7, and positive control pGBKT7-53 were transformed into AH109 yeast competent cells (Qingdao Bokang Biotechnology Co., Ltd.), following the yeast competent cell transformation instructions. The cells were cultured in SD-Trp medium at 28°C for 2-4 days. Positive colonies were then picked and transferred to SD-Trp liquid medium and cultured with shaking at 28°C. The bacterial culture was subsequently verified by PCR.

[0055] 3. Verification of transcriptional activation activity

[0056] Take 1 μL of bacterial culture and inoculate it into different concentrations of deficient culture medium (SD / -Trp 10). 0 SD / -Trp-His 10 0 10 -1 10 -2 ).

[0057] β-Galactosidase Activity Assay: ① Stock Solution Preparation: Dissolve 24 mg X-α-gal in 6 mL dimethylformamide (DMF) to a final concentration of 4 mg / mL. ② Spread 100 μL of the X-α-gal stock solution onto a pre-prepared agar plate and incubate at 37°C until the liquid is absorbed. ③ Spread the transformed yeast onto the agar plate and incubate at 28°C until blue colonies appear.

[0058] This invention found that the positive control pGBKT7-53 and the yeast containing pGBKT7-CmERF098 grew strongly on media without tryptophan and histidine, and turned into blue colonies within 8 hours in the X-α-Gal experiment, while the negative control plasmid did not turn blue in the transformed yeast and showed poor growth. Figure 4 This indicates that the CmERF098 gene has transcriptional activation activity.

[0059] Example 4: Temporal expression of the CmERF098 gene under powdery mildew stress

[0060] 1. Pumpkin planting and cultivation

[0061] Pre-soak the seeds in warm water for about 20 minutes to promote germination, then place them in a large petri dish lined with damp filter paper. Transfer the petri dish to a climate incubator (28°C, 60-80% relative humidity in darkness). When 80% of the seeds have germinated, place them in a 9cm deep plastic container containing a 1:1 mixture of soil and peat moss, and incubate in a climate incubator with a 14-hour light period at 26°C and 75% relative humidity, and a 10-hour dark period at 16°C and 70% relative humidity.

[0062] 2. Inoculation with powdery mildew

[0063] When pumpkin seedlings reach the two-leaf-one-heart stage, they are inoculated with powdery mildew. Powdery mildew conidia are collected from naturally infected pumpkin leaves. The day before inoculation, highly infected leaves are shaken to remove old conidia and encourage the production of new conidia for inoculation. A spore suspension of powdery mildew containing 0.01% Tween-20 is prepared (10... 6 (1 spore / ml), then spray evenly for inoculation.

[0064] Second true leaves of pumpkin were collected at 0h, 6h, 12h, 24h, and 48h after powdery mildew infection and rapidly immersed in liquid nitrogen for RNA extraction. Three biological replicates were set up for each time point. Total RNA was extracted from the powdery mildew-treated pumpkin leaves using the SteadyPure Plant RNA Extraction Kit (Aikerui Biotechnology (Qingdao) Co., Ltd.), and the concentration and purity were measured using a micro spectrophotometer. RNA integrity was assessed using 1% agarose gel electrophoresis; clear and undegraded 28S and 18S bands were observed. The OD260 / OD280 ratio was between 1.9 and 2.0, and the RNA concentration was sufficient for cDNA synthesis. The extracted RNA was then used to synthesize cDNA using a reverse transcription premix kit (Aikerui Biotechnology (Qingdao) Co., Ltd.), and real-time quantitative PCR was performed using the cDNA as a template. Actin-7, a Chinese pumpkin, is used as an internal reference gene. The forward primer for the Actin-7 gene is F5: 5'-CGGCCATTGAGAAAAGCTACGAACT-3' (SEQ ID NO: 10), and the reverse primer for the Actin-7 gene is R4: 5'-CCCACCACTGAGGACGATGTTACCG-3' (SEQ ID NO: 11).

[0065] CmERF098 gene-specific primers were designed on the Primer3Plus website (https: / / www.primer3plus.com / ): forward primer F6: 5'-CATGGGGGAAATTTGCGGC-3' (SEQ ID NO: 12), and reverse primer R5: 5'-AACGCCGCCTCAGAATTAGG-3' (SEQ ID NO: 13). This primer pair was used for quantification of the CmERF098 gene. Following the instructions of SYBR Green Pro Taq HS premix (Aikerui Biotechnology (Qingdao) Co., Ltd.), the following were used: 10 μL of premix, 0.4 μL of forward primer F6, 0.4 μL of reverse primer R5, 8.2 μL of RNase-free water, and 1 μL of cDNA template. The qRT-PCR program was: 95℃, 30 s; 95℃, 5 s, 60℃, 30 s, for 40 cycles. Relative quantification was performed using 2... -ΔΔCt Law.

[0066] like Figure 5 As shown, the expression level of the CmERF098 gene was significantly higher than that of the control group at 24–144 h, indicating that powdery mildew stress induced the upregulation of the CmERF098 gene expression.

[0067] Example 5: Temporal expression of the CmERF098 gene under methyl jasmonate (MeJA) treatment

[0068] When the pumpkin seedlings reached the two-leaf-one-heart stage, we evenly sprayed the leaves with a 100 μM methyl jasmonate (MeJA) solution and water, respectively. They were then cultured in a climate incubator with 14 h of light at 26℃ and 75% relative humidity, followed by 10 h of darkness at 16℃ and 70% relative humidity. At 0 h, 6 h, 12 h, 24 h, and 48 h after hormone treatment, the second true leaf of the pumpkin was harvested and rapidly placed in liquid nitrogen for RNA extraction. Three biological replicates were set up for each time point. The RNA extraction, detection, and cDNA synthesis methods are detailed in Example 4. Real-time quantitative PCR amplification was performed using the cDNA from each time point as a template. The primers, reaction system, and qRT-PCR program for the internal control Actin-7 and CmERF098 genes are detailed in Example 4. Relative quantification was performed using a 2... -ΔΔCt Method. The temporal expression of the CmERF098 gene in pumpkin leaves under MeJA treatment is as follows: Figure 6 As shown, compared with 0h, the expression of the CmERF098 gene was significantly upregulated after MeJA treatment. These results indicate that the CmERF098 gene is induced and regulated by JA.

[0069] Example 6: Application of transcription factor gene CmERF098 in regulating pumpkin powdery mildew resistance

[0070] 1. Seed germination

[0071] Peeled pumpkin seeds were disinfected with 1% sodium hypochlorite for 10 minutes, rinsed 5 times with sterile water, placed in sterile petri dishes, and placed on 3 sheets of sterile filter paper moistened with MS medium. The petri dishes were then incubated in the dark at 28°C for 2 days.

[0072] 2. Engineered bacteria infect pumpkin seeds

[0073] As described in Example 2.

[0074] 3. Screening of overexpression-treated pumpkin plants

[0075] Agrobacterium-infected pumpkin seeds were sown in plastic containers containing a 1:1 mixture of soil and peat moss, and then placed in a climate incubator with a 14-hour light period at 26°C and 75% relative humidity, and a 10-hour dark period at 16°C and 70% relative humidity. Genomic DNA was extracted from the first true leaf of the pumpkin, and positive plants were identified by PCR screening using the pSUPER1300 vector forward primer F3: 5'-ACACCAAATCGACTCTAGAAAGC-3' (SEQ ID NO: 7) and the CmERF098 gene reverse primer R1: 5'-TCGGTTCTTCCGATTGAATCC-3' (SEQ ID NO: 4).

[0076] 4. Relative expression levels of the CmERF098 gene overexpressed in pumpkin and wild-type pumpkin under powdery mildew stress.

[0077] Powdery mildew was prepared into a spore suspension containing 0.01% Tween-20 (10 6 Spores / ml) were sprayed evenly onto overexpressing pumpkin and wild-type pumpkin seedlings (one-leaf-one-heart stage). Simultaneously, 0.01% Tween-20 was added to the water as a control group. Three days after treatment, the first true leaf of the pumpkin was harvested for RNA extraction. RNA extraction, detection, and cDNA synthesis are detailed in Example 4. Real-time quantitative PCR was performed using cDNA as a template. The internal control primers Actin-7 and CmERF098, reaction system, and qRT-PCR program are detailed in Example 4. Relative quantification was performed using 2... -ΔΔCt Law.

[0078] The transcriptional level of the CmERF098 gene in overexpressing pumpkin plants and wild-type pumpkin seedlings was detected by qRT-PCR three days after powdery mildew treatment. Figure 7 Under powdery mildew stress, the expression levels of the CmERF098 gene in both wild-type and overexpressing pumpkins were significantly higher than those in the control group. Furthermore, after powdery mildew stress, the expression level in overexpressing pumpkins increased approximately 6-fold compared to the control group, while in wild-type pumpkins it only increased 3-fold. After powdery mildew treatment, the CmERF098 expression level in overexpressing pumpkin plants was twice that in wild-type plants. Figure 7 ).

[0079] Both overexpressing and wild-type plants were inoculated with powdery mildew at the one-leaf-one-heart stage. Wild-type pumpkin seedlings showed powdery mildew symptoms after 10 days, while overexpressing pumpkin seedlings showed no powdery mildew symptoms after 10 days. Figure 8 ).

[0080] 5. Physiological responses of overexpressed squash and wild-type squash to powdery mildew stress

[0081] To investigate the physiological response of plants overexpressing the CmERF098 gene to powdery mildew stress, we collected leaves from overexpressing pumpkins and control pumpkins infected for 3 days and measured their CAT, POD, SOD activities, MDA, protein, and chlorophyll content.

[0082] Determination of chlorophyll content: (1) Weigh 0.1g of clean fresh pumpkin leaves, cut them into pieces and put them into a mortar. (2) Add 2mL of anhydrous ethanol, a little CaCO3 and quartz sand, and then grind the sample into a white homogenate. Let it stand in the dark for 5min, then filter the homogenate with dry filter paper, wash the pigment in the mortar and filter paper with anhydrous ethanol, and filter the washing liquid into a volumetric flask. Finally, adjust the volume of the extracts of different samples to the same volume. Take 2mL of the extract and centrifuge it at 5000g for 4min until it is completely transparent. (3) Take a cuvette, wash it 3 times with anhydrous ethanol, take 2mL of the extract into the cuvette, use anhydrous ethanol as a blank control, and measure the absorbance at 662nm and 645nm. (4) Substitute into the formula:

[0083] Ca=13.95A665-6.8A649 Cb=24.96A649-7.32A665

[0084]

[0085] The assay kits for protein content, malondialdehyde (MDA) content, superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activities were all purchased from Nanjing Jiancheng Technology Co., Ltd.

[0086] Compared with the control group, under powdery mildew stress, the POD activity, protein content, and chlorophyll content of overexpressing pumpkin significantly increased, while SOD activity and MDA content significantly decreased, and CAT showed no significant change. Figure 9 The significantly higher SOD activity and MDA content in the control group compared to the overexpressing pumpkin indicated that the wild type was severely damaged by powdery mildew. The increased POD activity in the overexpressing plants suggests that the CmERF098 gene enhances the pumpkin's antioxidant defense against powdery mildew stress. The increased protein and chlorophyll content indicates that the CmERF098 gene regulates protein metabolism and photosynthesis in pumpkin.

[0087] 6. Regulation of target genes by the CmERF098 gene

[0088] In addition, this invention performed qRT-PCR analysis on key genes CmAOS1, CmOPR3, CmMYC2, and CmJAR1 in the JA signaling pathway in overexpressed and wild-type pumpkins. The primer sequences for the internal reference genes CmActin7 and CmAOS1, CmOPR3, CmMYC2, and CmJAR1 are shown in Table 1.

[0089] Table 1 qPCR primer sequences

[0090]

[0091] Analysis revealed that the expression of four genes in wild-type and overexpression-treated pumpkins did not change significantly in the control group. However, under powdery mildew stress, the relative expression levels of all four genes in wild-type pumpkins were significantly downregulated, while in overexpression-treated pumpkins, the downregulation of CmOPR3, CmMYC2, and CmJAR1 was more significant. Figure 10 These findings suggest that the CmERF098 gene promotes pumpkin resistance to powdery mildew by downregulating the expression of key genes in the JA signaling pathway.

[0092] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, alterations, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of transcription factor gene CmERF098 in improving pumpkin resistance to powdery mildew, characterized in that, The nucleotide sequence of the transcription factor gene CmERF098 is shown in SEQ ID NO:

1.

2. The application of the transcription factor gene CmERF098 in the positive regulation of pumpkin resistance to powdery mildew, characterized in that, The nucleotide sequence of the transcription factor gene CmERF098 is shown in SEQ ID NO:

1.

3. The application according to claim 2, characterized in that, The transcription factor gene CmERF098 positively regulates the resistance of pumpkin to powdery mildew by negatively regulating the expression of jasmonic acid synthase gene CmOPR3, transcription factor gene CmMYC2 and jasmonic acid amide synthase gene CmJAR1 in the jasmonic acid signaling pathway.

4. The application of an overexpression vector containing the transcription factor gene CmERF098 or engineered bacteria containing such an overexpression vector in improving pumpkin resistance to powdery mildew or positively regulating pumpkin resistance to powdery mildew, characterized in that... The nucleotide sequence of the transcription factor gene CmERF098 is shown in SEQ ID NO:

1. The CmERF098 gene was ligated into the pSUPER1300 vector using homologous recombination technology.