Application of ApABCG4 in regulating drought tolerance and biological control of Acyrthosiphon pisum

Abstract

The present invention relates to the application of ApABCG4 in regulating the drought tolerance of aphids and biological control, including determining the expression profiles of ApABCG4 in different developmental stages and tissues of pea aphids, as well as the effect of drought stress on its expression. RNAi was used to inhibit the expression of ApABCG4, and the effects of its silencing on the abdominal cuticle of aphids and the drought tolerance of aphids were determined. The results showed that after the silencing of ApABCG4, the drought tolerance of pea aphids could be significantly reduced. It can be used as a biological control target to effectively regulate the drought tolerance of pea aphids, and substances such as dsRNA that can inhibit the expression level of the ApABCG4 gene were designed and used as pea aphid inhibitors, providing new ideas and methods for the green control of pea aphids.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the application of ApABCG4 in regulating the drought tolerance of pea aphids and biological control. Background Art

[0002] ATP-binding cassette transporters, also known as ABC transporters, are a type of protein widely present in cell membranes and show a high degree of conservation in both eukaryotes and prokaryotes. These proteins obtain energy by binding and hydrolyzing ATP, thereby driving the transmembrane transport of substances against the concentration gradient. ABC transporters consist of two main domains: the nucleotide-binding domain (NBD) and the transmembrane domain (TMD). According to the sequence similarity of NBD and the structural comparison between NBD and TMD, these proteins are divided into eight different subfamilies, namely ABCA to ABCH. ABC transporters can transport various types of substrates, including lipids, polysaccharides, hormones, amino acids, metal ions, toxic metabolites, and drugs. Therefore, they play important roles in biochemical processes such as the growth, development, and detoxification metabolism of insects.

[0003] The pea aphid, scientifically named Acyrthosiphon pisum, belongs to the genus Acyrthosiphon in the Aphididae family and is a pest that causes significant damage to leguminous crops and forages. The pea aphid has a wide host range and is widely distributed globally, especially common on leguminous crops and forages. It uses its stylet to suck the phloem sap of plants, thereby causing color changes, morphological distortions, growth retardation, and even death of plants. At the same time, the pea aphid can also transmit plant viruses, exacerbating the damage to plants and reducing the economic value of crops, thus causing significant economic losses. As an insect with the characteristic of alternation of generations, the pea aphid has a complex life history and can switch between parthenogenesis and sexual reproduction, as well as between wingless and winged forms, demonstrating its excellent reproductive ability and environmental adaptability.

[0004] Currently, the pea aphid has developed strong resistance to commercially available pesticides such as imidacloprid and acetamiprid. Moreover, the problem of pesticide residues is serious, polluting the environment and threatening food safety. In addition, the low specificity of pesticides may also harm the natural enemies of beneficial organisms, increasing the risk of outbreaks of agricultural pests. In view of this, developing green methods for controlling aphids is of great significance for achieving environmentally friendly pest control. Summary of the Invention

[0005] The present invention studied the expression profiles of ApABCG4 in different developmental stages and tissues of the pea aphid, as well as the effect of drought stress on its expression. It included using RNAi to inhibit the expression of ApABCG4 and detecting the duration of gene silencing. The total cuticular hydrocarbons (CHCs) and internal hydrocarbons (IHCs) content of aphids after ApABCG4 silencing were detected by GC-MS, as well as the content of individual CHC components, and the abdominal cuticle of aphids after ApABCG4 silencing was observed by scanning electron microscopy. The drought tolerance of aphids after ApABCG4 silencing was evaluated, as well as the binding affinity of ApABCG4 for nine n-alkane components of CHCs. It provided new ideas and methods for the green control of pea aphids.

[0006] The present invention provides the application of ApABCG4 in regulating the drought tolerance of pests or in the biological control of pests, and the amino acid sequence of ApABCG4 is shown in SEQ ID NO:1.

[0007] Furthermore, the nucleotide sequence encoding ApABCG4 is shown in SEQ ID NO:2.

[0008] Furthermore, the pests include pea aphids.

[0009] The present invention also provides a method for reducing the drought tolerance of pests or controlling pests, including introducing a substance that inhibits the expression level of the ApABCG4 gene into the pests, so as to achieve the purpose of reducing the drought tolerance of pests or controlling pests.

[0010] Furthermore, the pests include pea aphids, the substance that inhibits the expression level of the ApABCG4 gene is dsRNA or a DNA molecule encoding the dsRNA or an expression cassette, recombinant vector, recombinant bacterium or transgenic cell line containing the DNA molecule, and the dsRNA is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO:3 and the nucleotides shown in its reverse complementary sequence.

[0011] The present invention also provides a dsRNA or a DNA molecule encoding the dsRNA or an expression cassette, recombinant vector, recombinant bacterium or transgenic cell line containing the DNA molecule, and the dsRNA is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO:3 and the nucleotides shown in its reverse complementary sequence.

[0012] The present invention also provides the application of the above dsRNA or a DNA molecule encoding the dsRNA or an expression cassette, recombinant vector, recombinant bacterium or transgenic cell line containing the DNA molecule in any one of the following a1)-a7):

[0013] a1) Controlling pests;

[0014] a2) Preparing a product for controlling pests;

[0015] a3) Reducing the drought tolerance of pests;

[0016] a4) Preparing a product for reducing the drought tolerance of pests;

[0017] a5) Inhibiting the expression of the ApABCG4 gene;

[0018] a6) Preparing a product for inhibiting the expression of the ApABCG4 gene;

[0019] a7) Acting as an inhibitor of the ApABCG4 gene;

[0020] Wherein, the pests include pea aphids.

[0021] Beneficial effects:

[0022] The present invention studied the expression profiles of ApABCG4 in different developmental stages and tissues of pea aphids, as well as the effect of drought stress on its expression. It includes using RNAi to inhibit the expression of ApABCG4 and detecting the duration of gene silencing. The total CHC and internal hydrocarbon (IHC) contents of aphids after ApABCG4 silencing were detected by GC-MS, as well as the contents of individual CHC components. The abdominal cuticle of aphids after ApABCG4 silencing was observed by scanning electron microscopy, and the drought tolerance of aphids after ApABCG4 silencing was evaluated. The results showed that the drought tolerance of pea aphids could be significantly reduced after ApABCG4 silencing. Therefore, it can be used as a biological control target to effectively regulate the drought tolerance of pea aphids, and substances such as dsRNA that can inhibit the expression level of the ApABCG4 gene can be specifically designed and used as pea aphid inhibitors, providing new ideas and methods for the green control of pea aphids, and having broad application value and potential. Brief description of the drawings

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required to be used in the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can also be obtained based on these drawings without creative efforts.

[0024] Figure 1 It is the spatio-temporal expression profile of ApABCG4. Figure A shows the relative mRNA expression levels of ApABCG4 at different developmental stages. EO, AD, L1, L2, L3, and L4 respectively represent embryos, adults, 1st instar, 2nd instar, 3rd instar, and 4th instar aphids. Figure B shows the relative mRNA expression levels of ApABCG4 in different tissues of aphids. HD, TX, AN, GT, and AC respectively represent the head, thorax, abdomen, abdominal cuticle, and internal organs.

[0025] Figure 2 Response of ApABCG4 expression level to drought stress. The mRNA levels of ApABCG4 in the 3rd instar aphids treated with drying for 24 and 48 hours were determined by qPCR. RH represents relative humidity; 70% RH was used as the control.

[0026] Figure 3 For the RNAi silencing efficiency (A) and silencing duration (B) of ApABCG4.

[0027] Figure 4 For the effects of ApABCG4 RNAi silencing on the cuticular wax coating of pea aphids (A) and on the drought tolerance of aphids (B).

[0028] Figure 5 For the effects of ApABCG4 RNAi silencing on the levels of cuticular hydrocarbons (CHCs) and internal hydrocarbons (IHCs) in pea aphids. Panel A shows the total CHC content; Panel B shows the total IHC content; Panel C shows the quantitative analysis of CHC components; Panel D shows the gas chromatograms of CHCs and IHCs, with n-alkanes as the standards.

[0029] Figure 6 For the molecular docking analysis of the binding of ApABCG4 to 9 n-alkane components of pea aphid CHCs. A-I and A'-I' are respectively the 3D models and 2D views of the binding of ApABCG4 to 9 C25–C33 n-alkanes. Detailed implementation manners

[0030] The following examples are only used to more clearly illustrate the technical solutions of the present invention, so they are only examples and cannot be used to limit the protection scope of the present invention. It should be noted that unless otherwise specified, the technical terms or scientific terms used in this application should be the common meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0031] Example 1 Determination of the spatio-temporal expression of ApABCG4

[0032] Experimental materials

[0033] Pea aphids were reared on broad bean (Vicia faba L.) seedlings for a long time under laboratory conditions (temperature 18°C, photoperiod L16:D8, relative humidity (RH) about 70%).

[0034] The ApABCG4 protein sequence is shown in SEQ ID NO:1, referenced from GenPept, XP_001950956.1.

[0035] The nucleotide sequence of ApABCG4 is shown in SEQ ID NO:2, referenced from GenBank, XM_001950921.3,

[0036] Embryos, 1st instar, 2nd instar, 3rd instar, 4th instar, and adult samples were collected, and tissues such as the head, thorax, abdomen, intestine, and abdominal cuticle were dissected. Total RNA was extracted using RNAiso-Plus reagent (TaKaRa Bio, Kusatsu, Japan), and then cDNA was synthesized using PrimeScript TM RT reagent kit (TaKaRa-Bio), and qRT-PCR was performed using Premix Ex Taq TM II (TaKaRa-Bio). Ribosomal protein S20 (Rps20; NM_001162819.2) was used as a reference gene to calculate the relative expression of ApABCG4. The primer sequences and their amplification efficiencies for qRT-PCR are shown in Table 1.

[0037] Table 1

[0038]

[0039] E represents the amplification efficiency.

[0040] The results are as Figure 1 shown. ApABCG4 was expressed in different growth stages of aphids (P<0.0001), with the highest expression in the embryonic stage, approximately four times that of other stages, and relatively small changes from the 1st instar to the adult stage. In addition, the expression of ApABCG4 was significantly different among the body segments and tissues of adult aphids (P<0.0001), with the highest expression in the abdominal cuticle, followed by the abdomen, head, and thorax, and the lowest expression in the intestine.

[0041] Example 2 Response of ApABCG4 to Drought Stress

[0042] Approximately 50 3rd instar aphids were placed in a drying tube with 5% relative humidity. 70% RH was used as a control. Both tubes were placed in an artificial climate chamber at 18°C, and after 24 and 48 hours, qRT-PCR was used to detect the response level of ApABCG4 to drought stress.

[0043] The results are as Figure 2 shown. The expression of ApABCG4 in 3rd instar aphids was significantly upregulated after 24 and 48 hours of drought treatment, approximately 1.99-fold (P<0.03) and 4.05-fold (P>0.003) respectively, that is, the expression level of ApABCG4 increased with the increase of drought treatment time.

[0044] Example 3: Determination of the efficiency of RNAi-mediated silencing of ApABCG4

[0045] Design the RNAi target region (319 bp) of ApABCG4, and use the T7 RiboMAX TM Express RNAi system (Promega, Madison, WI, USA) to synthesize dsRNA, specifically the double-stranded RNA composed of the following sequences and their reverse complementary sequences:

[0046] dsApABCG4:

[0047] AGAAGAAGCTATGCAAGTGGCTACTTCACTAAAGTTAGGGTCAGACATATCGAAGGACAGCAAATATCAAGTGATTCAAGAAATATTAGAAACATTAGGTTTACAAGAACACCGAAGGACAATGACAAGCAATTTGTCAGGTGGACAAAAAAAACGTTTGTCTATTGCTCTTGAACTTGTGAACAATCCTCCCATTATGTTTTTCGACGAGCCAACTAGTGGCTTAGACAGTAGTTCTTGTTTCCAATGTATTTCCCTGCTGAAATCGCTGAGTCGTGGCGGCCGTACAATCATCTGTACGATTCATCAACCCAGTGCT(SEQ ID NO:3)

[0048] Use the 193 bp coding fragment of Mus musculus lymphotoxin A (Muslta; XM_006536550.2) to synthesize dsMuslta as a negative control. dsMuslta is specifically the double-stranded RNA composed of the following sequences and their reverse complementary sequences:

[0049] dsMuslta:

[0050] CACCCTCTCCACGAATTGCTCGGCCGTTCACTGGAACTCCTGGGCCTGACCCAGCTCCCTGCTAGTCCCTGCGGCCCACAGTTCCCCGGACCCGACTCCCTTTCCCAGAACGCAGTAGTCTAAGCCCTTAGCCTGCGGTTCTCTCCTAGGCCCCAGCCTTTCCTGCCTTCGACTGAAACAGCAGCATCTTCTA(SEQ ID NO:4)

[0051] Fix the 3rd instar aphids on the sticky end of a Post-it note, and microinject them through the pleats of the mesothorax and metathorax segments to deliver 202.4 nL of dsRNA with a concentration of 6000 ng / μL into the aphids. After injecting the dsRNA, transfer the aphids to broad bean seedlings and place them in an artificial climate chamber with parameters set to the same conditions as those for pea cultivation. Use qRT-PCR to detect the RNAi silencing efficiency 48 hours later.

[0052] Collect the aphids 1, 2, 3, 4, 5, and 6 days after injecting dsRNA1, 2, 3, 4, 5, and 6, and use qRT-PCR to determine the duration of ApABCG4 silencing. The primers for amplifying the coding fragments of ApABCG4 and Muslta and for dsRNA synthesis are shown in Table 2.

[0053] Table 2

[0054]

[0055] T7 RNA polymerase promoter sequence: TAATACGACTCACTATAGGG.

[0056] The results are as Figure 3 shown. After injecting dsRNA into the 3rd instar aphids, the highest RNAi silencing efficiency can reach 72.56% (on the 2nd day). To determine the duration of the ApABCG4 silencing effect, the silencing efficiency of ApABCG4 was tested continuously for six days after dsRNA injection. It was found that the silencing efficiency of ApABCG4 showed a trend of first increasing and then decreasing, that is, from 32.33% (P < 0.02) on the first day to 70.11% (P < 0.0006) on the second day. It decreased to 46.60% (P < 0.002) on the 3rd day, to 43.31% (P < 0.05) on the 4th day, and there was no significant difference between the 5th and 6th days and the control group.

[0057] Example 4 Effects of ApABCG4 Silencing on the Cuticle and Drought Tolerance of Aphids

[0058] 1. Transfer the 3rd instar aphids injected with dsRNA (dsMuslta, dsApABCG4) to new seedlings for 3 days. Collect the aphids and fix them with 2.5% glutaraldehyde solution at 4°C for 24 hours. Then rinse them three times with 1×PBS, and dry them in a CO2 critical point dryer for 3 hours after dehydrating them with a gradient of ethanol solutions. Spray the gold side up onto the abdomen of the aphids and observe the level of the lipid mixture on the surface of the abdominal cuticle with a scanning electron microscope. It was found that ApABCG4 silencing caused almost no wax coating on the left, middle, and right parts of the abdominal cuticle of the aphids. While the abdominal cuticle of the control aphids was surrounded by a hydrophobic layer ( Figure 4 A).

[0059] 2. Starting from the second day after dsApABCG4 injection, two experimental groups were established, with at least 30 aphids in each group. One group was placed in a drying tube at 5% RH and then at 18°C, and the other group was placed at 5% RH for 12 h and then at 70% RH. The number of surviving aphids was counted every 6 h. At least 30 aphids injected with dsMuslta were used as a control.

[0060] The aphids on the second day after dsRNA injection were placed in a drying tube (5% RH) at 18°C, and the survival rate of the aphids was counted every 6 hours ( Figure 4 B). Starting from the exposure to drying for 12 h, the survival rate of ApABCG4-silenced aphids was significantly lower than that of the control group (P < 0.0001), and decreased by 22.58%, 29.03%, and 45.16% compared with the control group at 12, 18, and 24 h, respectively. The difference in the survival rate tended to increase with the prolongation of the drying time. All ApABCG4-silenced aphids died after 30 h of drying treatment. At the same time, 19.35% of the control aphids still had a survival rate at 36 h and did not die until 48 h later. In addition, compared with the aphids that were always at 5% RH, the aphids injected with dsApABCG4 showed a trend of increased survival rate and extended total mortality by 6 h in the treatment group placed at 5% RH for 12 h, that is, ApABCG4 was significantly correlated with the drought tolerance of pea aphids, and the drought tolerance of pea aphids could be significantly reduced by silencing ApABCG4.

[0061] Example 5 Effect of ApABCG4 silencing on HC (hydrocarbon) content

[0062] Based on the results of the determination of the duration of ApABCG4 silencing, the CHC (cuticular hydrocarbon) and IHC (internal hydrocarbon) contents of aphids collected on the third day after dsRNA injection were analyzed by GC-MS.

[0063] The 3rd instar aphids injected with dsRNA were transferred to new seedlings for 3 d to determine their CHC and IHC contents. First, CHC was extracted. Approximately 10 mg of fresh weight aphids were placed in a 2 mL chromatographic vial, and 200 ng of n-eicosanoic acid was added as an internal standard. Then 200 μL of hexane was added, and it was gently shaken for 2 minutes. The eluate was transferred to a new chromatographic vial using a Pasteur glass pipette. This step was repeated twice, and approximately 600 μL of the eluate was concentrated to approximately 300 μL using N2. The concentrated eluate was transferred to a silica gel column using glass wool and 300 mg of column chromatographic silica gel with a mesh size of 70–230, eluted with 2 mL of hexane, dried under N2, and dissolved in 50 μL of hexane for GC-MS detection.

[0064] To extract IHC, after CHC extraction, the same aphids were transferred to a glass tissue homogenizer, 200 ng of n - eicosanoic acid was added as an internal standard, and then 300 μL of ddH2O was added and homogenized until no visible tissue remained. The homogenate was transferred to a glass vial and 2 mL of hexane:methanol:water (2:1:1) extraction solution, vortexed for 1 minute, and left overnight at room temperature. After centrifugation, approximately 500 μL of the top hexane phase was transferred to a new chromatography vial and concentrated to approximately 300 μL using N2. The subsequent steps were the same as those used in CHC extraction.

[0065] CHC and IHC were detected using GC - MS with an HP - 5MS UI column (Agilent Technologies, Santa Clara, CA, USA). The determination program was: 60 °C for 2 min, heated to 320 °C at 5 °C / min, and held for 10 min.

[0066] The results showed that silencing of ApABCG4 led to a 26.20% decrease in CHC (P < 0.0001), while the IHC content did not change ( Figure 5 A, B). To clarify whether ApABCG4 has a preference for nine CHC components, the changes in the content of each component were further analyzed, and the CHCs in Acyrthosiphon pisum were identified by GC - MS to consist of 9 C25–C33 n - alkanes as shown in Table 2.

[0067] The results showed that silencing of ApABCG4 led to significant decreases in the contents of C25, C26, C27, C28, C29, C30, C31, C32, and C33 by 30.63, 34.45, 27.72, 27.64, 22.15, 30.41, 23.94, 31.07, and 28.76% respectively ( Figure 5 C). It was shown that silencing of ApABCG4 led to a decrease in the content of each CHC component, while the IHC content did not change ( Figure 5 B, C).

[0068] Example 6 Molecular docking simulation of ApABCG4 with CHC molecules

[0069] The 3D model of ApABCG4 constructed using AlphaFold2 was docked with nine n - alkane molecules from A. pisum CHC ( Figure 6 ). The predicted local distance difference test (pLDDT) score was 80.5, indicating that a high - quality three - dimensional structure of ApABCG4 was constructed. The binding sites of the ApABCG4 protein were similar to those of the nine n - alkane molecules ( Figure 6 A - I). The binding energies between the ApABCG4 protein and the nine n - alkane molecules are listed in Table 3. The ApABCG4 protein binds tightly to the nine n - alkane molecules through hydrophobic forces (Figure 6 A'-I'). Amino acid residues 15 - 21 play a key role in the hydrophobic interaction between ApABCG4 and nine n-alkanes. The 21 most commonly recorded residues are Ile502, Asp536, Phe339, Phe445, Asn152, Glu510, His150, Leu509, Gln148, Asn147, Thr197, Lys205, Ala151, Ser198, Leu149, Val513, Arg456, Ser446, Phe543, Asp449, and Met453 between the ApABCG4 protein and n-C33. The 15 least commonly recorded residues are Val513, Leu149, Glu510, Phe445, Met453, Phe443, Phe539, Arg456, Asp336, Ile502, Ser446, Leu452, Asp449, and Leu509, and Gln148 between the ApABCG4 protein and n-C28.

[0070] Table 3

[0071]

[0072] The above results show that ApABCG4 can effectively regulate the drought tolerance of pea aphids as a biological control target. Furthermore, substances such as dsRNA that can inhibit the expression level of the ApABCG4 gene can be used as pea aphid inhibitors and have broad application value and potential in practical scenarios.

[0073] The above specific embodiments have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple variations all belong to the protection scope of the present invention.

Claims

1. Application of ApABCG4 in regulating drought tolerance of pests, characterized in that: The drought tolerance of pests is reduced by inhibiting the expression of the ApABCG4 gene, wherein the amino acid sequence of the ApABCG4 is shown in SEQ ID NO: 1, and the pest is pea aphid.

2. The use according to claim 1, characterized in that: The nucleotide sequence encoding ApABCG4 is shown in SEQ ID NO:

2.

3. A method for reducing drought tolerance of pests, comprising introducing a substance that inhibits the expression level of the ApABCG4 gene into the pest, thereby achieving the purpose of reducing the drought tolerance of the pest, wherein the pest is pea aphid, and the nucleotide sequence of the ApABCG4 gene is shown in SEQ ID NO:

2.

4. The method according to claim 3, characterized in that The substance that inhibits the expression level of the ApABCG4 gene is dsRNA or a DNA molecule encoding the dsRNA or an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the DNA molecule, and the dsRNA is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO: 3 and the nucleotides shown in its reverse complementary sequence.

5. Use of a dsRNA targeting ApABCG4 gene, or a DNA molecule encoding the dsRNA, or an expression cassette, a recombinant vector, a recombinant bacterium, or a transgenic cell line containing the DNA molecule in any of the following a1)-a2): a1) Reduce pests’ drought tolerance; a2) preparing products that reduce the drought tolerance of pests; in, The nucleotide sequence of ApABCG4 is shown in SEQ ID NO: 2, the pest is pea aphid, and the dsRNA is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO: 3 and the nucleotides shown in its reverse complementary sequence.

Images