Preparation of Songguoling nanoliposome and its application in inhalation therapy of acute lung injury

By preparing Songguoling nanoliposomes, the problems of Songguoling's poor water solubility and instability were solved, enabling targeted lung treatment of acute lung injury, significantly reducing inflammatory factors, improving lung structure, and achieving good therapeutic effects.

CN118948771BActive Publication Date: 2025-11-11GUANGDONG HOSPITAL OF TRADITIONAL CHINESE MEDICINE +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411160761.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-22
Publication Date
2025-11-11
Estimated Expiration
2044-08-22

AI Technical Summary

Technical Problem

In the existing technology, Songguoling is poorly soluble in water and chemically unstable, which limits its application in the treatment of acute lung injury. Furthermore, existing treatment methods such as mechanical ventilation and anti-inflammatory drugs have side effects and high mortality rates.

Method used

Songguoling nanoliposomes were prepared by encapsulating Songguoling with phospholipids, cholesterol, and DSPE-mPEG2000 as membrane materials. The nanoliposomes were prepared by thin-film hydration-ultrasonic dispersion method, which achieved good water solubility and lung targeting, reduced the level of inflammatory factors, and improved lung structure.

Benefits of technology

Songguoling nanoliposomes significantly reduce the levels of inflammatory factors such as TNF-α, IL-6, and IL-1β in lung tissue, improve lung permeability, relieve inflammation, and enhance lung barrier function. The therapeutic effect is superior to that of free Songguoling monomers, and they have good biosafety and compatibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118948771B_ABST
    Figure CN118948771B_ABST
Patent Text Reader

Abstract

This invention relates to the field of pharmaceutical technology, specifically to the preparation of sine kinase nanoliposomes and their application in inhalation therapy for acute lung injury. The sine kinase nanoliposomes provided by this invention possess good water solubility, biocompatibility, and biocompatibility. After entering the body, they can target the lungs, reducing the expression levels of inflammatory factors such as IL-6, IL-1β, and TNF-α, thus alleviating inflammation; simultaneously, they can increase the expression levels of proteins such as ZO-1, VE-Cadherin, and Claudin5, alleviating damage to the lung barrier. Therefore, the sine kinase nanoliposomes provided by this invention can be used to prepare drugs for treating acute lung injury, and their therapeutic effect is significantly superior to that of free sine kinase monomers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical formulation technology, and relates to the preparation of Songguoling nanoliposomes and their application in inhalation therapy for acute lung injury. Background Technology

[0002] Acute lung injury (ALI) is the most severe manifestation of acute respiratory distress syndrome (ARDS), characterized by severe inflammation, extensive tissue damage, and high mortality. Current treatment strategies for ALI primarily involve mechanical ventilation and anti-inflammatory drugs. A 2021 epidemiological survey showed that among 1909 COVID-19 patients requiring invasive ventilation, 1672 (86.7%) developed ARDS, with a mortality rate as high as 57.7%. While mechanical ventilation can alleviate symptoms to some extent, the mortality rate remains high. Although the most commonly used anti-inflammatory drug, glucocorticoids, can effectively reduce inflammation, they often suppress the body's immune system, leading to a series of side effects. Therefore, exploring new drugs and developing more rational and effective treatment measures are of paramount importance for the treatment of ALI.

[0003] With the deepening research into the effective components and mechanisms of traditional Chinese medicine (TCM), many TCM compounds have been found to possess excellent pharmacological activities in recent years. However, most natural compounds are poorly soluble in water, which limits their application. To improve the water solubility and bioavailability of these compounds and better realize their clinical efficacy, there is an urgent need to develop a nano-encapsulation carrier that can enhance the therapeutic effect of these compounds while maintaining high stability. Terpenes are common lipid-soluble and poorly soluble components, poorly soluble in water but readily soluble in lipid-soluble solvents such as petroleum ether, benzene, chloroform, and ethanol.

[0004] Songorine (Son) is a diterpenoid alkaloid isolated from the traditional Chinese medicine Aconitum carmichaelii. Studies have shown that it is a GABAA receptor antagonist in the rat brain and has anticancer, antiarrhythmic, and anti-inflammatory activities. However, due to the presence of a suitable reaction substrate for phenolase catalysis in its molecular structure, Songorine is chemically unstable and easily oxidized by heat and light. Summary of the Invention

[0005] The purpose of this invention is to provide the preparation of Songguoling nanoliposomes and their application in inhalation therapy for acute lung injury, so as to solve the problems existing in the prior art.

[0006] According to one aspect of the present invention, a Songguoling nanoliposome is provided, comprising a core material and a membrane material, wherein the core material is Songguoling, and the membrane material is mainly prepared from phospholipids, cholesterol, and DSPE-mPEG2000 (polyethylene glycol monomethyl ether-2000-octadecylphosphatidylethanolamine, CAS147867-65-0); the molar ratio of Songguoling, phospholipids, cholesterol, and DSPE-mPEG2000 is (10-18):(75-80):(18-22):3, and the encapsulation efficiency of the Songguoling nanoliposome is 75.03% ± 0.5%.

[0007] The sine-containing nanoliposomes provided by this invention exhibit excellent water solubility, overcoming the problem that sine-containing compounds are poorly soluble in water and chemically unstable, thus hindering their application in practical treatment. The phospholipid component in the liposomes endows them with excellent lung targeting properties, allowing them to be targeted and delivered to the lungs after entering the body. This reduces the levels of inflammatory factors such as TNF-α, IL-6, and IL-1β in lung tissue, improves the normal structure of the lungs and addresses damage to its barrier, and enhances lung permeability. Therefore, they can be used to treat acute lung injury, with significantly better efficacy than free sine-containing monomers. The sine-containing nanoliposomes provided by this invention also possess good biocompatibility and safety.

[0008] It should be noted that the molar ratio of DPPC (dipalmitoylphosphatidylcholine), cholesterol, DSPE-mPEG2000 and songguoling in liposomes is the molar ratio of the dosage added during the liposome preparation process.

[0009] In some embodiments, the phospholipid is any one or more of DPPC, soybean phospholipid, and egg yolk lecithin.

[0010] In some embodiments, the drug loading of the Songguoling nanoliposomes is 7.24% ± 2%.

[0011] In some embodiments, the Songguoling nanoliposomes are spherical with an average diameter of 102±5 nm.

[0012] In some embodiments, the zeta potential of the Songguoling nanoliposomes is -15±2mV.

[0013] According to another aspect of the present invention, a method for preparing Songguoling nanoliposomes is provided, comprising the following steps:

[0014] S1. Dissolve phospholipids, cholesterol, DSPE-mPEG2000 and succinate in a solvent, and remove the solvent by rotary evaporation to form a thin film;

[0015] S2. Add an aqueous medium to the film formed in step S1 to fully hydrate and detach the film to obtain a suspension. Disperse the suspension by ultrasound with a power of 10% to 30%. After ultrasounding, Songguoling nanoliposomes can be obtained.

[0016] The preparation method of Songguoling nanoliposomes in this invention is thin film hydration-ultrasonic dispersion method.

[0017] It should be noted that the general preparation process of liposomes involves adding an aqueous medium containing the core material after the membrane material has been formed, thereby hydrating the membrane. However, in this invention, sine oxaliplatin is a lipid-soluble drug that is poorly soluble in water. Therefore, it is dissolved together with the membrane material, achieving encapsulation of the core material while the membrane material is forming. Finally, the organic solvent is removed, resulting in a high encapsulation efficiency. If the original drug core material is added after the membrane material has been formed, the drug cannot be fully dissolved, and the drug loading and encapsulation efficiency will decrease.

[0018] In some embodiments, in step S1, phospholipids, cholesterol and DSPE-mPEG2000 are first dissolved in a solvent, and then songguoling is dissolved in the solvent and added to the reaction system.

[0019] In some embodiments, the Songguoling nanoliposomes of the present invention can also be prepared by secondary emulsification, ethanol injection, or reverse evaporation.

[0020] In some embodiments, the method for removing the solvent to form a thin film in step S1 is to perform rotary evaporation at 230 mbar until all the solvent is evaporated.

[0021] In some embodiments, step S1 is as follows: phospholipids, cholesterol and DSPE-mPEG2000 are added to a 500mL round-bottom flask, 4mL of chloroform is added and fully dissolved, then 1mL of chloroform is dissolved in the flask and added to the round-bottom flask. After mixing, the mixture is rotary evaporated at 230mbar until all the chloroform is evaporated, forming a thin film on the wall of the round-bottom flask.

[0022] In some implementations, the aqueous medium in step S2 is PBS buffer.

[0023] In some embodiments, the temperature at which the film is fully hydrated and detached in step S2 is 60°C.

[0024] In some embodiments, step S2 involves stirring to fully hydrate and detach the film, with the stirring speed being 300 rpm.

[0025] In some embodiments, the time for fully hydrating and detaching the film in step S2 is 30 minutes.

[0026] In some embodiments, the ultrasonic dispersion operation in step S2 is specifically as follows: the suspension obtained by the hydration and detachment of the film is placed on ice for ultrasonication, the ultrasonic power is 10% to 30% (i.e. 10% to 30% of the maximum power of the instrument), the ultrasonic mode is to ultrasonicate for 15 seconds, pause for 15 seconds, and cycle for 30 minutes before ending the ultrasonication.

[0027] The purpose of the aforementioned ultrasonic dispersion is to improve the uniformity of the resulting liposome particle size, thereby enhancing their stability. Inhomogeneous particle size during liposome preparation can affect the quality of the liposomes and subsequent experimental results. It should be noted that because the ultrasonic power and duration of this invention are relatively low, and the operation is strictly performed on ice, the damage to the liposome components caused by ultrasonication is greatly reduced.

[0028] In some embodiments, step S2, after ultrasonic dispersion, further includes steps of filtration, ultrafiltration, and volume adjustment.

[0029] In some embodiments, the above filtration is performed by collecting the ultrasonically dispersed suspension, filtering it through a 0.22 μm filter, and collecting the filtrate.

[0030] In some embodiments, the ultrafiltration process involves transferring the filtrate into an ultrafiltration tube and centrifuging it at 3000 rpm for 1 hour. The purpose of this ultrafiltration step is to remove unencapsulated sine kinase liposomes and free sine kinase monomers.

[0031] In some embodiments, the above volume adjustment is performed by using PBS buffer to adjust the volume of the Songguoling nanoliposomes in the ultrafiltration tube to 3 mL for later use.

[0032] In some embodiments, step S2 is as follows: 5 mL of PBS buffer is added to the round-bottom flask of step S1, a rotor is placed in the flask, and the mixture is stirred at 300 rpm and 60°C for 30 min. During this time, the flask can be manually rotated to ensure that the PBS buffer fully wets the film on the flask wall. After 30 min, a suspension formed by the hydration and detachment of the film is obtained. The suspension is placed on ice and sonicated at 20% power. The sonication mode is 15 s sonication followed by a 15 s pause, and the cycle is repeated for 30 min before ending the sonication. The sonicated suspension is collected, filtered through a 0.22 μm filter, and the filtrate is collected. The filtrate is transferred to an ultrafiltration tube and centrifuged at 3000 rpm for 1 h. The volume of the Songguoling nanoliposomes in the ultrafiltration tube is adjusted to 3 mL using PBS buffer and set aside for later use.

[0033] According to another aspect of the present invention, the use of Songguoling nanoliposomes in the preparation of a medicament for treating acute lung injury is provided.

[0034] In some embodiments, the above-mentioned drug for treating acute lung injury is administered via nebulized inhalation.

[0035] According to another aspect of the present invention, the use of Songguoling nanoliposomes in the preparation of pulmonary anti-inflammatory drugs is provided.

[0036] The Songguoling nanoliposomes provided by this invention can reduce the levels of inflammatory factors such as TNF-α, IL-6, and IL-1β in lung tissue and alleviate lung inflammation, thus showing good application prospects in the preparation of anti-inflammatory drugs for the lungs.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] The songguoling nanoliposomes provided by this invention have good biocompatibility and can target the lungs to reduce the expression levels of inflammatory factors such as IL-6, IL-1β and TNF-α in mice, thus alleviating inflammation. At the same time, they can increase the expression levels of proteins such as ZO-1, VE-Cadherin and Claudin5, alleviate lung barrier damage, and achieve treatment of acute lung injury in mice. Moreover, the therapeutic effect is significantly better than that of free songguoling monomer. Attached Figure Description

[0039] Figure 1 The diagram shows the particle size distribution of Son-Lipo obtained in Example 1 of this invention, and the Zeta potential data of Son-Lipo and Lipo obtained in Comparative Example 1.

[0040] Figure 2 This is a transmission electron microscope image of the Son-Lipo obtained in Example 1 of the present invention.

[0041] Figure 3 The image shows the hemolysis results of the Son-Lipo and Songorine monomers obtained in Example 1 of this invention.

[0042] Figure 4 The figure shows the effect of different concentrations of different groups of the present invention on the viability of RAW264.7 cells and HUVEC cells.

[0043] Figure 5 The figure shows the effects of different groups of the present invention on the mRNA of pro-inflammatory factors IL-6, IL-1β and TNF-α in RAW264.7 cells treated with LPS.

[0044] Figure 6 The figure shows the effect of different groups of the present invention on the fluorescence intensity of ZO-1, a lung barrier function index of HUVEC cells treated with LPS.

[0045] Figure 7 The figure shows the effect of different groups of the present invention on the protein expression of ZO-1, a lung barrier function indicator, in HUVEC cells treated with LPS.

[0046] Figure 8 The figure shows the effect of different groups of this invention on the total number of cells and the total protein concentration in the bronchoalveolar lavage fluid of LPS-treated mice.

[0047] Figure 9 The figure shows the effect of different groups of the present invention on the pathological damage of lung tissue in mice treated with LPS.

[0048] Figure 10 The figure shows the effects of different groups of this invention on the mRNA levels of pro-inflammatory factors IL-6, IL-1β, TNF-α, and iNOS in mice treated with LPS.

[0049] Figure 11 This figure shows the immunohistochemical changes of the mouse lung barrier marker ZO-1 in different groups according to the present invention.

[0050] Figure 12 The figure shows the effect of different groups of the present invention on the mRNA expression of the lung barrier markers ZO-1, VE-Cadherin and Claudin5 in mice.

[0051] Figure 13 This invention provides a study on the cardiotoxicity, hepatic toxicity, splenic toxicity, and renal toxicity of different groups in a mouse model of LPS-induced acute lung injury. Detailed Implementation

[0052] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following examples are all purchased commercially, and the chemical structural formula of Songorine is as follows:

[0053]

[0054] In this invention, the compound was provided by Chengdu Purifa Technology Co., Ltd., and its purity, determined by HPLC-DAD peak area normalization, was above 98%. Songguoling was dissolved in dimethyl sulfoxide (DMSO), a certain amount was mixed, and diluted with PBS to the desired concentration. The final solution of Songguoling contained less than or equal to 1% DMSO.

[0055] Example 1

[0056] A method for preparing Songguoling nanoliposomes includes the following steps:

[0057] S1. DPPC, cholesterol, and DSPE-mPEG2000 were added to a 500mL round-bottom flask at doses of 40.18mg, 5.49mg, and 4.27mg, respectively. After dissolving the 4mg of sine phosphate in 1mL of chloroform, the sine phosphate was dissolved in the chloroform and added to the round-bottom flask. The mixture was stirred and then rotary evaporated at 230mbar until all the chloroform was evaporated and a thin film was formed on the wall of the round-bottom flask.

[0058] S2. Add 5 mL of PBS buffer to the round-bottom flask from step S1, place the rotor in the flask, and stir at 300 rpm and 60°C for 30 min. During this time, the flask can be manually rotated to ensure that the PBS buffer fully wets the film on the flask wall. After 30 min, a suspension formed by the hydration and detachment of the film is obtained. Place the suspension on ice and sonicate at 20% power. The sonication mode is 15 s sonication followed by a 15 s pause, and repeat for 30 min. Collect the sonicated suspension, filter it through a 0.22 μm filter, and collect the filtrate. Transfer the filtrate to an ultrafiltration tube and centrifuge at 3000 rpm for 1 h. Use PBS buffer to bring the volume of the Songguoling nanoliposomes in the ultrafiltration tube to 3 mL for later use.

[0059] The liposomes obtained in this embodiment, denoted as Son-Lipo, include a core material and a membrane material. The core material is liposome, and the membrane material is prepared from DPPC, cholesterol, and DSPE-mPEG2000. The molar ratio of each component in the liposome is liposome:DPPC:cholesterol:DSPE-mPEG2000 = 14:77:20:3.

[0060] The Songguoling nanoliposomes obtained in this embodiment were characterized, and the drug loading capacity was found to be 7.24%, with an encapsulation efficiency of 75.03% for Songguoling. The Songguoling nanoliposomes were spherical with an average diameter of 101.77 nm. Figures 1-2 As shown; the Zeta potential of Songguoling nanoliposomes is -14.64 mV, as... Figure 1 As shown.

[0061] The method for determining the drug loading capacity of Songguoling nanoliposomes in this embodiment includes the following steps:

[0062] The Songguoling nanoliposome solution obtained in step S2 was diluted in acetonitrile at a ratio of 1 / 10. After ultrasonic disruption for 1 hour, the solution was collected and centrifuged at 12,000 rpm for 10 minutes. The solution was then filtered through a 0.22 μm organic filter and collected. The highest absorption peak of the drug was detected using a UV spectrophotometer to determine the optimal absorption wavelength and the OD value of the drug. The drug loading of the liposomes was calculated based on the standard curve.

[0063] Comparative Example 1

[0064] A nanoliposome, denoted as Lipo, consists only of a membrane material prepared from DPPC, cholesterol, and DSPE-mPEG2000, wherein the molar ratio of each component is DPPC:cholesterol:DSPE-mPEG2000 = 77:20:3;

[0065] In this comparative example, the nanoliposomes are spherical with a diameter ranging from 80.43 to 83.18 nm and a Zeta potential of -11.85 mV.

[0066] The preparation method of the nanoliposomes in this comparative example was carried out according to Example 1, except that the only difference from Example 1 was:

[0067] Do not add Songguoling in step S1.

[0068] The liposomes obtained in Example 1 and Comparative Example 1 were characterized, and the experimental results are as follows: Figure 1 As shown, the Zeta potentials indicate that Son-lipo carries a negative charge with an average potential of -14.64 mV, while Lipo has an average Zeta potential of -11.85 mV. Transmission electron microscopy (TEM) observations show that Son-lipo has a uniform spherical morphology with a diameter ranging from 100 to 105 nm, while Lipo's diameter ranges from 80.43 to 83.18 nm, consistent with the results obtained using DLS.

[0069] Pharmacological effects of Songguoling nanoliposomes investigated

[0070] Below, cell and animal experiments were conducted using the Songorine nanoliposomes Son-Lipo prepared in Example 1, the nanoliposomes Lipo in Comparative Example 1, and the free Songorine monomer to explore their pharmacological effects.

[0071] I. Cell experiments and related indicator measurements

[0072] 1. Biosafety assessment

[0073] 1) Hemolysis test

[0074] The compatibility of Songorine and Son-lipo with erythrocytes was determined by a hemolysis test. First, 2 mL of fresh blood was collected from the rat orbital cavity and 10 mL of solution containing 1×10⁻⁶ erythrocytes was added. 4Heparin sodium was dissolved in PBS buffer. Diluted blood was centrifuged at 3000 rpm for 10 min to separate red blood cells. The cells were washed three times until the supernatant was bloodless, and finally diluted with PBS buffer to a 2% cell suspension. 500 μL of diluted red blood cells and 500 μL of different concentrations of Songorine or Son-lipo were added to 1.5 mL centrifuge tubes and incubated at 37°C for 3 h. Ultrapure water and PBS buffer were used as positive and negative controls, respectively, to directly contact the diluted red blood cells. Finally, all tubes were centrifuged (1000 rpm, 15 min) to separate the supernatant, and the absorbance was measured at 540 nm using a microplate reader. The hemolysis rate was calculated as (Ap-Ab) / (At-Ab) × 100%, where Ap is the drug absorbance value, At is the positive control group, and Ab is the negative control group.

[0075] Hemolysis test results as follows Figure 3 As shown, the Son-Lipo provided in Embodiment 1 of the present invention is immiscible with blood and has good biocompatibility.

[0076] 2) Cell Counting Kit-8 (CCK-8) toxicity test

[0077] CCK8 cytotoxicity assays were performed using RAW264.7 macrophages and human umbilical vein endothelial cells (HUVECs). RAW264.7 and HUVECs were cultured in high-glucose DMEM medium containing 10% sheep / bovine serum and 1% penicillin-streptomycin solution, with 5% CO2 added, at 37°C. Cytotoxicity was assessed using a CCK-8 assay kit (GLPBIO, GK10001-5). RAW264.7 cells and HUVECs were cultured at 1 × 10⁶ cells per well. 4 and 5×10 3 Cells were seeded at a density in 96-well plates. After 24 hours, the control group was treated with only fresh DMEM medium, while the other groups were treated with 100 μL of fresh DMEM medium containing different concentrations of Lipo, Songorine, or Son-lipo. After 24 hours of treatment, 10 μL of CCK-8 solution was diluted in 100 μL of fresh intact medium; the cells were then incubated with the diluted CCK-8 solution for 2 hours. Finally, the absorbance of each well was measured at 450 nm using a microplate reader.

[0078] The results of the CCK8 toxicity test are as follows: Figure 4 As shown, the Son-lipo provided in Example 1 of this invention has minimal impact on cell viability and exhibits good biocompatibility.

[0079] 2. Anti-inflammatory effects study

[0080] Cell culture techniques were the same as in the CCK8 toxicity assay. RAW264.7 cells were seeded in 6-well plates and grown to 60%-70% confluence. They were then incubated for 10-12 hours with 2 mL of fresh serum-free medium containing 250 μmol / L Lipo, Songorine, or Son-lipo. The Control and Model groups were incubated with only 2 mL of fresh serum-free medium for 10-12 hours. Subsequently, except for the Control group, all other groups were stimulated for 4 hours with 500 ng / mL LPS in 2 mL of serum-free medium. The drug-treated groups were then co-incubated again with equal amounts of Lipo, Songorine, or Son-lipo for 6 hours, while the Model group was co-incubated with 2 mL of fresh serum-free medium for 6 hours. Finally, cells were collected, and the levels of TNF-α, IL-6, and IL-1β inflammatory factors were measured using qRT-PCR. The primer sequences were as follows:

[0081] TNF-aF:TTGTCTACTCCCAGGTTCTCT;

[0082] TNF-aR:GAGGTTGACTTTCTCCTGGTATG;

[0083] IL-6-F:CTTCCATCCAGTTGCCTTCT;

[0084] IL-6-R:CTCCGACTTGTGAAGTGGTATAG;

[0085] IL-1β-F:GGTGTGGTGACGTTCCCATTA;

[0086] IL-1β-R:ATTGAGGTGGAGAGCTTTCAG;

[0087] Tubulin-F:AGCAGCTACTTTGTGGAGTG;

[0088] Tubulin-R:TCGGAGATGCGCTTGAATAG.

[0089] Figure 5 The results showed that Son-lipo significantly downregulated the mRNA levels of pro-inflammatory cytokines TNF-α, IL-6, and IL-1β in RAW264.7 cells. The Songorine monomer also had a certain downregulating effect on the mRNA levels of these pro-inflammatory cytokines, even though the mRNA levels of these cytokines normally increased after LPS stimulation. This indicates that both Songorine and Son-lipo have good anti-inflammatory effects on the LPS-induced RAW264.7 inflammatory cell model, and the Songorine nanoliposome Son-lipo is significantly more effective than the monomer.

[0090] 3. Effects of Son-lipo on ZO-1, a lung barrier function marker, in LPS-treated HUVEC cells.

[0091] 1) Effect of Son-lipo on the fluorescence intensity of ZO-1, a lung barrier function indicator, in LPS-treated HUVEC cells.

[0092] HUVEC cells were seeded in 0.17 mm glass-bottom culture dishes until 100% confluence, and then treated with 1 μg / mL LPS. The control group received no LPS treatment. In the treatment groups, Songorine, Son-lipo, and an equal volume of Lipo were added to the culture dishes to a concentration of 250 μmol / L. The control and model groups received no treatment. After 24 hours, fluorescent staining was performed. The tight junction factor ZO-1 antibody was diluted 1:1000 (21773-1-AP), and the donkey anti-rabbit Cy3 antibody was diluted 1:200 (205302, Biolend). Finally, images were taken using a confocal microscope.

[0093] Figure 6 The results showed that, compared with the Control group, the expression of the tight junction protein ZO-1 was significantly reduced in the Model group, and the tight junction structure between cells was severely disrupted. In contrast, the expression of ZO-1 was significantly increased in the Son-lipo group compared with the Model group. This indicates that the Son-lipo of the present invention can significantly improve LPS-induced lung barrier damage in HUVEC cells.

[0094] 2) Effect of Son-lipo on the protein expression of ZO-1, a lung barrier function indicator, in LPS-treated HUVEC cells.

[0095] HUVECs were seeded in 6-well plates to 100% confluence. Except for the Control group, all other groups were stimulated with 1 μg / mL LPS. The treatment groups were further treated with 250 μmol / L Songorine, Son-lipo, and Lipo, respectively. The Control and Model groups received no drugs, only solvent. Cells were collected after 12 hours. RIPA lysis buffer, PMSF, and phosphatase inhibitor were mixed at a volume ratio of 100:1:1 and added to the cells. The cells were lysed on ice for 2 hours, centrifuged at 12000 rpm for 10 minutes at 4°C, and the supernatant was collected. Protein concentration was measured using a BCA kit (Beyotime, P0010S). Cell protein samples with measured concentrations were added to 5×SDS-PAGE protein loading buffer, boiled at 95°C for 7 minutes, and then loaded onto a pre-prepared gel for SDS-PAGE electrophoresis at 80V for 30 minutes, followed by 120V for 1.5 hours. After electrophoresis, the cells were transferred to a membrane at 300 mA. After transfer, the membrane was transferred to a culture dish containing 5% skim milk powder and incubated on a shaker for 1–2 hours, followed by overnight incubation with ZO-1 antibody at 4°C. Subsequently, the membrane was incubated for 1 hour at room temperature with a secondary antibody conjugated to horseradish peroxidase (HRP). Finally, protein bands on the membrane were imaged using a chemiluminescence imaging system.

[0096] Figure 7 The results showed that the expression of protein bands in LPS-stimulated HUVEC cells was reduced compared to the Control group, while the intensity of protein bands increased significantly after Son-lipo treatment. This indicates at the protein level that Son-lipo of the present invention can improve the damage to the barrier function of HUVEC cells caused by LPS.

[0097] II. Animal experiments and related indicator measurements

[0098] 1. Animal Experiment Grouping, Model Establishment, and Drug Administration: Mice in the Control group were anesthetized and then injected intratracheally with 5 mg / kg PBS. Mice in the Treatment group were anesthetized and then injected intratracheally with 5 mg / kg LPS. An acute lung injury model was induced on day 0. Two hours after model establishment, mice were administered the drug via inhalation once, followed by a second inhalation 12 hours later. Lung function was assessed and tissue samples were collected 24 hours later. From the start of model establishment, the drug was administered twice daily (every 12 hours) for three consecutive days. Three days after infection, blood was collected from the eyeballs, and the mice were euthanized by cervical dislocation. The dosage for each group of mice was as follows:

[0099] Songorine group: Mice were given Songorine twice a day at a concentration of 250 μmol / L, with a dose of 6 mL per administration.

[0100] Son-Lipo group: Mice inhaled Son-Lipo twice daily at a concentration of 250 μmol / L, with a dose of 6 mL per administration.

[0101] Lipo group: Mice inhaled Lipo twice daily at a concentration of 250 μmol / L, with a dose of 6 mL per administration.

[0102] Control group: Mice inhaled PBS twice a day, with a dosage of 6 mL each time.

[0103] Model group: Mice inhaled PBS twice a day, with a dosage of 6 mL each time.

[0104] 2. Measurement of relevant indicators

[0105] 1) Effects of Son-lipo on total cell number and total protein concentration in bronchoalveolar lavage fluid of LPS-treated mice

[0106] After the mice were euthanized, their limbs were fixed, and a catheter was inserted into the trachea of ​​the mice through a small incision in the neck and fixed. The mice were then irrigated with pre-cooled sterile saline or PBS, with 0.7 mL collected each time and repeated three times. The collected irrigating fluid was centrifuged at 4°C and 3000 rpm for 10 min and used to detect the total protein concentration and total cell count.

[0107] Figure 8 The results showed that the present invention, Son-lipo, enhanced lung permeability in mice and significantly reduced the total cell count and total protein concentration in the bronchoalveolar lavage fluid of mice with acute lung injury.

[0108] 2) Effects of Son-lipo on pathological damage in lung tissue of LPS-treated mice

[0109] Fresh lung tissue was fixed in 4% paraformaldehyde solution for 24 hours, then embedded in paraffin and sectioned to a thickness of 4 μm. The sections were retrieved onto glass slides and dried. Hematoxylin and eosin were then stained according to a prescribed procedure. The stained slides were dried, mounted, and finally photographed under an optical microscope.

[0110] Figure 9 The results showed that in the LPS-intervention mouse experiment, the lung tissue of the model group showed significant neutrophil infiltration, alveolar wall thickening, and significant destruction of normal lung structure. Son-lipo treatment could effectively improve the above-mentioned damage.

[0111] 3) Effects of Son-lipo on pro-inflammatory factors IL-6, IL-1β, TNF-α, and iNOS mRNA in lung tissue of LPS model mice

[0112] Total RNA was extracted from lung tissue, and the housekeeping gene α-Tubulin was selected as an internal control gene. (Following step 2...) -ΔΔCTThe method calculates the relative normalized mRNA expression level of genes and measures the expression of inflammatory factors (TNF-α, IL-6, IL-1β, iNOS). The primer sequences are as follows:

[0113] TNF-aF:TTGTCTACTCCCAGGTTCTCT;

[0114] TNF-aR:GAGGTTGACTTTCTCCTGGTATG;

[0115] IL-6-F:CTTCCATCCAGTTGCCTTCT;

[0116] IL-6-R:CTCCGACTTGTGAAGTGGTATAG;

[0117] IL-1β-F:GGTGTGGTGACGTTCCCATTA;

[0118] IL-1β-R:ATTGAGGTGGAGAGCTTTCAG;

[0119] iNOS-F:GGAATCTTGGAGCGAGTTGT;

[0120] iNOS-R:CCTCTTGTCTTTGACCCAGTAG;

[0121] Tubulin-F:AGCAGCTACTTTGTGGAGTG;

[0122] Tubulin-R:TCGGAGATGCGCTTGAATAG.

[0123] Figure 10 The results showed that Son-lipo of the present invention can effectively inhibit the levels of inflammatory factors TNF-α, IL-6, IL-1β and iNOS in a mouse model of LPS-induced acute lung injury, and Son-lipo is more effective than Songorine.

[0124] 4) Immunohistochemical changes of the lung barrier marker ZO-1 by Son-lipo

[0125] After paraffin sectioning of lung tissue, routine dewaxing and dehydration were performed, followed by PBS washing (5 min x 3 times). Sections were then heated in citrate buffer (pH 6.0) on high for 15 min, followed by low heat for 10 min, and then allowed to cool naturally for approximately 120 min. PBS washing was repeated (5 min x 3 times). Sections were incubated with 3% H₂O₂ at room temperature for 15 min to eliminate endogenous peroxidase activity, followed by PBS washing (5 min x 3 times). Blocking with 5% normal goat serum was performed, followed by incubation at room temperature for 30 min. Primary antibody (1:2000 dilution) was added, and incubation was carried out overnight at 4°C. After PBS washing, secondary antibody was added, and the sections were incubated at room temperature for 2 h. PBS washing was repeated 3 times, followed by DAB staining at room temperature. The reaction rate was controlled under a microscope, and staining was performed for 4-5 min. Staining with distilled water was used to stop the staining. Hematoxylin was lightly counterstained for 5 min, followed by rinsing with tap water for 5 min. After dehydration with a gradient of alcohols, sections were mounted with neutral resin and observed under a microscope.

[0126] Figure 11 The results showed that ZO-1 was highly expressed in the cytoplasm of alveolar cells in the normal Control group of mice. However, the expression level of ZO-1 in the LPS-induced acute lung injury model group was significantly lower than that in the normal Control group and the Son-lipo group. This suggests that the content of this important protein that makes up the alveolar permeability barrier is reduced during lung injury, directly damaging its integrity. In contrast, Son-lipo can repair alveolar barrier function and maintain its integrity.

[0127] 5) Effects of Son-lipo on the mRNA expression of pulmonary endothelial barrier markers ZO-1, VE-Cadherin, and Claudin5.

[0128] Following the instructions of the RNA extraction kit (Tiangen Biotech, DP419), lung tissue was collected and total RNA was extracted using Trizol reagent. The RNA content was measured using Nanodrop. The mRNA was then reverse transcribed into cDNA using the PrimeScript RT kit and gDNA Eraser Perfect Real Time (Takara Bio). Using the cDNA from each sample as a template, qRT-PCR amplification was performed to detect and analyze the mRNA expression of the target genes (ZO-1, VE-Cadherin, and Claudin5). The procedure was repeated according to a 2-step process. -ΔΔCT The method calculates the relative normalized mRNA expression level of the gene. The primer sequences are as follows:

[0129] ZO-1-F:ACTCCCACTTCCCCAAAAAC;

[0130] ZO-1-R:CCACAGCTGAAGGACTCACA;

[0131] VE-Cadherin-F:ACTCCCACTTCCCCAAAAAC;

[0132] VE-Cadherin-R:CCACAGCTGAAGGACTCACA;

[0133] Claudin5-F:ACTGCCTTCCTGGACCACAAC;

[0134] Claudin5-R:CGCCAGCACAGATTCATACACCT;

[0135] Actin-F:CCTGGCACCCAGCACAAT;

[0136] Actin-R:GGGCCGGACTCGTCATAC.

[0137] Figure 12 The results showed that, compared with the model group, the present invention Son-lipo significantly improved lung barrier function in mice.

[0138] 6) Study on the cardiotoxicity, hepatosplenomegaly, and nephrotoxicity of Songorine and Son-lipo in a mouse model of LPS-induced acute lung injury.

[0139] Histopathology of mice was evaluated using heme-eosin (HE) staining. Fresh heart, liver, kidney, and spleen were fixed in 4% paraformaldehyde for at least 24 hours, then embedded in paraffin and cut into continuous sections 4 μm thick. The sections were flattened on glass slides, then stained with HE, dehydrated, and mounted. The slides were imaged using a 100x magnifying glass.

[0140] Figure 13 The results showed that Songorine and Son-lipo of the present invention had no significant toxicity to the heart, liver, spleen and kidneys in a mouse model of acute lung injury.

[0141] In other embodiments, the preparation parameters or raw material ratios can be changed based on Example 1. For example, the molar ratio of sine phosphate, phospholipids, cholesterol and DSPE-mPEG2000 can be 10:80:18:3, 10:75:18:3, 18:75:22:3, 18:80:22:3, 18:75:18:3, 10:75:22:3, etc.

[0142] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. A Songguoling nanoliposome, made of a core material and a membrane material, characterized in that, The core material is Songguoling, and the membrane material is prepared from a system composed of DPPC, cholesterol and DSPE-mPEG2000. The molar ratio of Songguoling, DPPC, cholesterol and DSPE-mPEG2000 is (10~18):(75~80):(18~22):3, and the encapsulation efficiency of the Songguoling nanoliposomes is 75.03%±0.5%.

2. The Songguoling nanoliposomes according to claim 1, characterized in that, The drug loading of the Songguoling nanoliposomes was 7.24% ± 2%.

3. The Songguoling nanoliposomes according to claim 1, characterized in that, The Songguoling nanoliposomes are spherical with an average diameter of 102±5 nm.

4. The Songguoling nanoliposomes according to claim 1, characterized in that, The zeta potential of the Songguoling nanoliposomes is -15±2 mV.

5. The method for preparing Songguoling nanoliposomes according to any one of claims 1 to 4, characterized in that, Includes the following steps: S1. Dissolve DPPC, cholesterol, DSPE-mPEG2000 and succinate in a solvent, and remove the solvent by rotary evaporation to form a thin film; S2. Add an aqueous medium to the film formed in step S1 to fully hydrate and detach the film to obtain a suspension. Disperse the suspension by ultrasound with a power of 10% to 30%. After ultrasounding, Songguoling nanoliposomes can be obtained.

6. The use of the Songguoling nanoliposomes according to any one of claims 1 to 4 in the preparation of a medicament for treating acute lung injury.

7. The application according to claim 6, characterized in that, The medication for treating acute lung injury is administered via nebulized inhalation.

Citation Information

Patent Citations

  • Application of tripterine liposome in preparation of medicine for preventing and treating acute respiratory distress syndrome

    CN116196278A

  • Aerosol inhalation nano-liposome composition for treating pulmonary fibrosis as well as preparation method and application of aerosol inhalation nano-liposome composition

    CN118236357A