A RPA-CRISPR-based Burkholderia gladioli (Pseudomonas cocovenenans subsp. fermentans)-specific target, primer, and detection system and method

Abstract

The present invention discloses a RPA-CRISPR-based Burkholderia gladioli (Pseudomonas cocovenenans subspecies fermented rice flour) specific virulence gene target, primers and detection system and method. The target sequence, RPA primers and crRNA of the present invention have good specificity, the constructed detection method has no specific recognition reaction to other subspecies, and the detection results are accurate and reliable. In addition, the detection method of the present invention is combined with the boiling method or the kit to extract sample DNA. Under the premise of not performing bacterial enrichment, the detection sensitivity of gladioli Burkholderia gladioli (Pseudomonas cocovenenans subspecies fermented rice flour) genomic DNA is 10 ‑4 ng / μL, and the sensitivity of bacterial solution was 1.52 CFU / mL. For coconut milk, rice flour and glutinous rice flour, the detection limit of samples reached 10 0 CFU / mL, simple sample pre-treatment, convenient operation, high sensitivity and high reliability, suitable for on-site rapid detection of Burkholderia gladiolus (Pseudomonas cocovenenans subspecies fermentum) by relevant regulatory authorities.

Description

Technical Field

[0001] The present invention belongs to the field of food detection technology. More specifically, it relates to a specific target for Burkholderia gladioli (Pseudomonas cocovenenans subsp. oryzae) based on RPA-CRISPR, RPA primers, and a detection system and method. Background Art

[0002] There are many species of Burkholderia gladioli, of which Burkholderia gladioli (Pseudomonas cocovenenans subsp. venom) is the only subspecies that can cause food poisoning in healthy people. It shares a high degree of homology with other non-toxigenic subspecies, making detection and differentiation challenging. Currently, my country's national inspection standard, GB 4789.29-2020, "National Food Safety Standard - Microbiological Examination of Foods - Test for Burkholderia gladioli (Pseudomonas cocovenenans subsp. venom)," uses traditional microbiological methods for the detection and identification of Burkholderia gladioli (Pseudomonas cocovenenans subsp. venom). This method, which employs microbial plate culture and physiological and biochemical identification, offers the advantages of high accuracy, good stability, and low cost. However, it is complex to prepare samples, time-consuming, and technically demanding, making it difficult to achieve rapid and efficient on-site testing. Other methods, including PCR, real-time fluorescence PCR, and droplet digital PCR, all target nucleic acids and Burkholderia gladioli. Despite their high sensitivity, these methods cannot distinguish Burkholderia gladioli (Pseudomonas cocovenenans subsp. fermentans) from other subspecies. Furthermore, they rely on expensive and bulky instruments, making them cumbersome to operate and hindering rapid on-site testing by regulatory authorities.

[0003] In recent years, numerous isothermal DNA amplification techniques, such as LAMP and RPA, have emerged to meet demand, providing the potential for rapid on-site nucleic acid testing. Currently, isothermal DNA amplification techniques have been widely reported for the detection of pathogenic bacteria. For example, Ma Xiaoyan et al. (2013) designed a LAMP assay based on specific target sequences within the 16S–23S rRNA of Burkholderia gladioli. The results showed that LAMP demonstrated higher specificity and sensitivity than PCR. However, LAMP requires complex primer design and is prone to nonspecific amplification. In contrast, RPA technology offers simple primer design principles, strong target selectivity, and high amplification efficiency. However, after RPA amplification, the amplified product must be purified and combined with nucleic acid electrophoresis to determine the test result. This cumbersome procedure results in poor signal output. Furthermore, Zheng et al. (2023) used CRISPR / Cas12a protein combined with RPA to detect gladiolus Burkholderia in food based on 16S-23SrRNA nucleic acid targets. The CRISPR / Cas12a protein quickly and specifically recognized the nucleic acid target in the amplified product and activated its own nuclease activity, thereby indiscriminately cutting the fluorescent probe and outputting a large amount of fluorescent signals. The detection efficiency is high, the sensitivity is high, and the time consumption is short, which is suitable for rapid on-site detection. However, the targets selected by the above methods only have interspecies specificity, and none of them can distinguish gladiolus Burkholderia (Pseudomonas cocovenenans subspecies) from other subspecies. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the defects and shortcomings of the existing above-mentioned technologies and provide a target, RPA primers and detection system and method that can quickly and specifically detect Burkholderia gladiolus (Pseudomonas cocovenenans subsp. oryzae).

[0005] The first object of the present invention is to provide a specific base sequence for detecting and distinguishing gladiolus Burkholderia (Pseudomonas cocovenenans subsp. fermentans).

[0006] The second object of the present invention is to provide an RPA primer for detecting and distinguishing gladiolus Burkholderia (Pseudomonas cocovenenans subsp. oryzae).

[0007] The third object of the present invention is to provide the use of the RPA primers in detecting and distinguishing products of gladiolus Burkholderia (Pseudomonas cocovenenans subsp.

[0008] The fourth object of the present invention is to provide a CRISPR / Cas12a detection system for detecting and distinguishing Burkholderia gladiolus (Pseudomonas cocovenenans subsp.

[0009] A fifth object of the present invention is to provide an application of the detection system in detecting and distinguishing products containing Burkholderia gladiolus (Pseudomonas cocovenenans subsp. cerevisiae).

[0010] The sixth object of the present invention is to provide a method for rapidly detecting Burkholderia gladiolus (Pseudomonas cocovenenans subsp.

[0011] The seventh object of the present invention is to provide a kit for detecting and distinguishing Burkholderia gladiolus (Pseudomonas cocovenenans subsp.

[0012] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0013] The invention is based on the fumonisin toxin encoding gene produced by gladiolus Burkholderia gladiolus (Pseudomonas cocovenenans subsp. fumonisin), downloads the fumonisin biosynthesis gene cluster from the NCBI website, inputs the virulence gene sequence into the BLAST module of the NCBI website, searches and downloads all its homologous sequences, uses Snapgene software to align all sequences to screen specific base sequences, and finally screens a base sequence with inter-subspecies specificity in the bonD region.

[0014] According to the RPA kit operating instructions RPA primers based on this specific target were designed using the Assay Design Manual. A set of primer pairs with the highest amplification efficiency and best specificity were selected by agarose gel electrophoresis. The RPA primers had good inter-subspecies specificity and were suitable for the detection and differentiation of Burkholderia gladiolus (Pseudomonas cocovenenans subsp. oryzae).

[0015] The present invention designs crRNA at the PAM site in the target sequence interval. The crRNA sequence can be divided into two parts. The part close to the 5' end is a fixed base sequence, and the 3' end part is complementary to the non-target chain of the target DNA. In this way, a highly specific crRNA for the target sequence is obtained, which is highly specific to the target DNA fragment.

[0016] On the basis of the above-mentioned RPA primers and crRNA, the present invention combines ssDNA-FQ fluorescent reporter probes labeled with FAM reporter groups to construct a CRISPR / Cas12a detection system for detecting and distinguishing gladiolus Burkholderia (Pseudomonas cocovenenans subspecies), and establishes a method for rapid detection and differentiation of gladiolus Burkholderia (Pseudomonas cocovenenans subspecies). Because the RPA primers and crRNA designed by the present invention have both high specificity and high sensitivity, the DNA template extracted by the boiling method or the kit can be directly subjected to RPA amplification, without the need for complicated sample pretreatment and microbial enrichment steps, ultimately achieving rapid fluorescent visual detection of gladiolus Burkholderia (Pseudomonas cocovenenans subspecies).

[0017] The present invention provides a specific target for detecting Burkholderia gladiolus (Pseudomonas cocovenenans subsp. fermentans), and the target sequence is shown in SEQ ID NO.1.

[0018] The present invention provides RPA primers D11-F / D11-R for detecting Burkholderia gladiolus (Pseudomonas cocovenenans subsp. fermentans), and the primer sequences are shown in SEQ ID NOs. 2-3.

[0019] The RPA primers D11-F / D11-R described in the present invention have the characteristics of high specificity and high sensitivity, and can be used for the detection and differentiation of Burkholderia gladiolus (Pseudomonas cocovenenans subsp.

[0020] Therefore, the present invention applies to protect the use of the RPA primers D11-F / D11-R in detecting gladiolus Burkholderia (Pseudomonas cocovenenans subsp. cocovenenans) or preparing a product for detecting gladiolus Burkholderia (Pseudomonas cocovenenans subsp. cocovenenans) as shown in SEQ ID NOs. 2 to 3.

[0021] The present invention also provides an RPA-CRISPR / Cas12a detection system for detecting Burkholderia gladiolus (Pseudomonas cocovenenans subsp. cerevisiae), which includes RPA primers D11-F / D11-R, crRNA, CRISPR / Cas12a protein and ssDNA-FQ fluorescent reporter probe; the sequence of the crRNA is shown in SEQ ID NO.4, and the sequence of the ssDNA-FQ fluorescent reporter probe is shown in SEQ ID NO.5.

[0022] The present invention also applies to protect the use of the above-mentioned detection system in detecting gladiolus Burkholderia (Pseudomonas cocovenenans subsp. cocovenenans) or preparing a product for detecting gladiolus Burkholderia (Pseudomonas cocovenenans subsp. cocovenenans).

[0023] Preferably, the ssDNA-FQ carries a FAM fluorescent group and a BHQ quenching group, as shown in Example 2. The present invention also provides a method for rapid detection of Burkholderia gladiolus (Pseudomonas cocovenenans subsp. cerevisiae), comprising the following steps:

[0024] 1. Extract DNA from the sample to be tested;

[0025] 2. Using the DNA obtained in step 1 as a DNA template, perform nucleic acid isothermal amplification using the RPA primers D11-F / D11-R;

[0026] 3. The detection system is prepared using the crRNA, ssDNA-FQ fluorescent reporter probe and CRISPR / Cas12a protein in the detection system, and the amplification product obtained in step 2 is added to react; if under blue light irradiation, the blank control has no fluorescence, and the positive control and the tested sample produce green fluorescence, then the tested sample contains gladiolus Burkholderia (Pseudomonas cocovenenans subspecies fermented rice flour).

[0027] When the positive control has no green fluorescence or the blank control has green fluorescence, it indicates that there is an operational error or the reagent is contaminated.

[0028] Preferably, in step 1, the boiling method is used to extract the DNA of the sample to be tested or the genomic DNA is obtained using a kit, see Example 4.

[0029] Preferably, in the reaction system of the nucleic acid isothermal amplification reaction in step 2, the final concentration of primers D11-F / D11-R is 0.448 μM, see Example 1.

[0030] Preferably, the final concentration of dNTPs is 1.6 mM, see Example 1.

[0031] Preferably, the final concentration of B buffer or MgOAc is 16 mM, see Example 1.

[0032] Specifically, the reaction system for the nucleic acid isothermal amplification reaction in step 2 is: 4 μL C buffer, 1 μL L buffer, 2.4 μL P-core, 0.4 μL dNTPs (10 mM each), primer D11-F / D11-R with a final concentration of 0.448 μM, 0.56 μL B buffer, 1 μL DNA template, and a total system of 10 μL.

[0033] Preferably, the reaction conditions of the nucleic acid isothermal amplification reaction in step 2 are 37 ° C, 25 min, see Example 1. Preferably, in the detection system described in step 3, the final concentration of Cas12a is 80 nM, the final concentration of crRNA is 80 nM, and the final concentration of the ssDNA-FQ fluorescent reporter probe is 200 nM, see Example 2.

[0034] Specifically, the CRISPR / Cas12a fluorescence detection system described in step 3 is: CRISPR / Cas12a detection system: 2.5 μL 10×NEBuffer 2.1, 2 μL Cas12a (1 μM), 2 μL crRNA (1 μM), 0.5 μL ssDNA-FQ (10 μM), 0.5 μL RNase inhibitor (0.4 U), 7.5 μL ddH2O, total system 15 μL.

[0035] Preferably, the reaction conditions of step 3 are 37° C., 20 min, as shown in Example 2.

[0036] Specifically, the samples of the present invention include but are not limited to coconut water, rice flour, glutinous rice flour, etc.

[0037] The present invention also provides a kit for detecting Burkholderia gladiolus (Pseudomonas cocovenenans subspecies fermented rice flour), the kit containing RPA primers D11-F / D11-R, CRISPR / Cas12a protein, crRNA and ssDNA-FQ fluorescent reporter probe

[0038] The present invention has the following beneficial effects:

[0039] (1) The target sequence, RPA primers and crRNA described in the present invention are all highly specific, and only the target DNA fragment of Burkholderia gladioli (Pseudomonas cocovenenans subspecies) is specifically amplified, and other subspecies are not non-specifically amplified and identified. The detection method for Burkholderia gladioli (Pseudomonas cocovenenans subspecies) constructed based on the target sequence, RPA primers and crRNA has the characteristics of high specificity and high sensitivity, is suitable for the detection of Burkholderia gladioli (Pseudomonas cocovenenans subspecies), and the results are accurate.

[0040] (2) The gladiolus Burkholderia (Pseudomonas cocovenenans subspecies) detection method constructed by the present invention realizes rapid detection of gladiolus Burkholderia (Pseudomonas cocovenenans subspecies) without relying on the laboratory environment. It is simple to operate, time-consuming, suitable for on-site rapid detection, and has strong practicality. The present invention optimizes the reaction conditions and reaction procedures of RPA constant temperature amplification and RPA-CRISPR / Cas12a reaction. Under constant temperature (37°C), amplification and detection can be completed. The RPA amplification process only takes 25 minutes, and the CRISPR / Cas12a detection process only takes 20 minutes. In addition, combined with the boiling method, sample pretreatment and DNA extraction can be achieved within 15 minutes. Under the premise of no microbial enrichment, the whole process can be shortened to 60 minutes, with high detection efficiency.

[0041] (3) The present invention detected coconut water, rice flour and glutinous rice flour samples spiked with artificial spikes and found that the detection limit of the three samples was 10 0 CFU / mL, with high sensitivity, meeting the needs of on-site detection.

[0042] (4) The RPA-CRISPR / Cas12a detection method for detecting Burkholderia gladiolus (Pseudomonas cocovenenans subspecies) established in the present invention is suitable for testing coconut water, rice flour, glutinous rice flour, etc., has a wide range of applications, and is completely consistent with the detection results of the real-time fluorescence PCR method established by Lin Jie et al. (2020). It has high reliability and is suitable for rapid detection by relevant regulatory departments. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is the result of a base sequence alignment specific to Burkholderia gladioli (Pseudomonas cocovenenans subsp. cocovenenans); among them, B. gladioli pv. cocovenenans DMSZ11318 and B. gladioli pv. cocovenenans Co14 are Burkholderia gladioli (Pseudomonas cocovenenans subsp. cocovenenans), and the rest are homologous sequences.

[0044] Figure 2 The results of RPA primer specificity detection are shown. Lane M is a 2000 bp DNA marker. Lanes 1 to 4 correspond to the species Burkholderia gladioli (Pseudomonas cocovenenans subsp. fermentans), Burkholderia gladioli pv. gladioli, Burkholderia gladioli pv. cepacia, and Burkholderia gladioli isolated from wild noni fruit. Lane 5 is a negative control (ddH2O).

[0045] Figure 3 It is the specific detection of the RPA-CRISPR / Cas12a detection system; among them, 1 is the standard type of gladiolus Burkholderia (Pseudomonas cocovenenans subsp. cocovenenans) ATCC33664, 2 is the wild type of gladiolus Burkholderia (Pseudomonas cocovenenans subsp. cocovenenans), 3 is the gladiolus Burkholderia gladiolus pv. gladiolus ATCC10248, 4 is the gladiolus Burkholderia gladiolus wild noni fruit isolate strain CICC10574, 5 is the gladiolus Burkholderia cepacia pv. cepacia ATCC10854, and 6 is the negative control (ddH2O).

[0046] Figure 4The sensitivity test results of genomic DNA of RPA-CRISPR / Cas12a detection system are as follows: 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , NTC.

[0047] Figure 5 The sensitivity test results of the bacterial solution of the RPA-CRISPR / Cas12a detection system are as follows: 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , NTC.

[0048] Figure 6 These are the results of the RPACRISPR / Cas12a detection method applied to spiked commercially available coconut water, rice flour, and glutinous rice flour; NTC is the blank control (unspecified sample).

[0049] Figure 7 The real-time fluorescence PCR method established by Lin Jie et al. (2020) was used to confirm the detection results. DETAILED DESCRIPTION

[0050] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0051] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0052] Example 1 is the design of RPA primers and the optimization of the reaction.

[0053] Design and Screening of Specific RPA Primers for Burkholderia gladioli (Pseudomonas cocovenenans subsp. fermentans)

[0054] The present invention downloaded the gladiolus Burkholderia (Pseudomonas cocovenenans subsp. fumonisin) fumonisin toxin encoding gene and all other non-toxigenic species homologous DNA sequences from the NCBI database. The species information involved is shown in Table 1. SnapGene software was used to perform homology comparison analysis on the gladiolus Burkholderia (Pseudomonas cocovenenans subsp. fumonisin) fumonisin toxin encoding gene and all other non-toxigenic species homologous DNA sequences. A specific DNA sequence was screened in the bonD region: 5'-CGACGAACACAGCACCAGCCAGTCGAGCGCGATATCCCGCG

[0055] TGGCTTCGTCCAGCGCCACCGTGCCCGCCACCTTCGGCGCCA

[0056] GCACGCGCGCGGTTTCCTCGCCTCGCGCCTTGAGCAGCAGGCCGTCGTGCAGCAA-3'.

[0057] Table 1: Species information involved in the homology comparison of Burkholderia gladioli (Pseudomonas cocovenenans subsp.

[0058]

[0059]

[0060]

[0061]

[0062]

[0063] Through homology comparison, we selected a region within the bonD region of the Burkholderia gladioli (Pseudomonas cocovenenans subsp. oryzae) gene encoding the fumonisin toxin, which is conserved within the subspecies and exhibits significant differences from the DNA sequences of all other non-toxigenic species, as a target for the design of specific isothermal amplification primers. The resulting primer sequences are shown in the table below, and 16 primer pairs were initially screened.

[0064]

[0065]

[0066] The designed primers were screened for specificity using the Primer-BLAST tool on an online website. RPA experiments were then performed using DNA sequences specific to the bonD region as amplification templates. The amplified products were purified and analyzed by nucleic acid electrophoresis. Primer pairs that produced single, bright bands were selected as candidate primers. Finally, RPA amplification was performed using DNA from highly homologous, non-toxigenic subspecies to verify primer specificity. Ultimately, primers that produced single, bright bands and no nonspecific amplification were selected as optimal primers. After a series of screening tests, the RPA primers selected were D11-F / D11-R, with the following sequences:

[0067] D11-F (SEQ ID NO.2) sequence 5'-CGACGAACACAGCACCAGCCAGTCGAGCGCGAT-3'

[0068] D11-R (SEQ ID NO.2) sequence: 5'-TTGCTGCACGACGGCCTGCTGCTCAAGGCGCGA-3'

[0069] The fragment amplified by the isothermal amplification specific primer pair D11-F / D11-R was 138 bp in size.

[0070] The specificity test results of RPA primers D11-F / D11-R are as follows Figure 2 As shown, lane M is a 2000bp DNA marker; lanes 1 to 4 correspond to species such as Burkholderia gladioli (Pseudomonas cocovenenans subsp. fermentans), Burkholderia gladioli pv. gladioli, Burkholderia gladioli pv. cepacia, and Burkholderia gladioli wild noni fruit isolate; lane 5 is a negative control (ddH2O). Figure 2 It can be seen that the RPA isothermal amplification primers D11-F / D11-R designed and screened in the present invention have high specificity and can be used to detect Burkholderia gladioli (Pseudomonas cocovenenans subsp. fermentans). To further improve detection results, the present invention optimized the reaction conditions for RPA isothermal amplification. The specific optimized parameters are shown in Table 2.

[0071] Table 2

[0072]

[0073]

[0074] While keeping other conditions unchanged, the assay was tested under different primer concentrations, dNTP concentrations, MgOAc concentrations, and amplification times. The fluorescence brightness of the reaction tubes under blue light and the fluorescence values ​​measured in a QPCR instrument were compared. Taking fluorescence intensity and reagent costs into consideration, the optimal RPA reaction parameters were determined. The optimal reaction system included a final primer concentration of 0.448 μM, a final dNTP concentration of 1.6 mM, a final MgOAc concentration of 16 mM, and an optimal amplification time of 25 minutes.

[0075] Example 2 is the construction and optimization of the RPA-RISPR / Cas12a detection system.

[0076] The present invention designs and screens the amplification target interval of the RPA primers described in Example 1, and obtains a specific crRNA for the amplified target DNA, whose sequence is 5'-UAAUUUCUACUAAGUGUAGAUCUCGCCUCGCGCCUUGAGCA-3' (SEQ ID NO.3); At the same time, a ssDNA-FQ fluorescent probe is designed, whose sequence is 5'FAM-TTTTTT-3'BHQ (SEQ ID NO.4), thereby establishing an RPA-CRISPR / Cas12a detection system. The ssDNA-FQ fluorescent probe carries a FAM reporter group and a BHQ quencher group.

[0077] Based on the optimized RPA amplification system, the Cas12a enzyme concentration, Cas12a / crRNA ratio, and Cas12a / ssDNA-FQ ratio in the CRISPR / Cas12a reaction system were optimized. The specific optimization conditions are shown in Table 3:

[0078] Table 3

[0079]

[0080] While keeping other conditions unchanged, the detection effects under different Cas12a enzyme concentrations, Cas12a / crRNA ratios, and Cas12a / ssDNA-FQ ratios were tested. The fluorescence brightness of the reaction tube under blue light and the fluorescence value measured in the QPCR instrument were compared. Taking into account the fluorescence intensity and reagent cost, the optimal CRISPR / Cas12a reaction condition parameters for the reaction system were obtained. Among them, the final concentration of Cas12a in the optimal reaction system should be 80nM, the crRNA / Cas12a ratio is 1:1, and the optimal ssDNA-FQ concentration is 120nM.

[0081] The present invention utilizes the constructed RPA-CRISPR / Cas12a detection system and the optimized optimal reaction system, combined with DNA extraction, to detect Burkholderia gladioli (Pseudomonas cocovenenans subsp. cerevisiae). (1) DNA was extracted from the sample using the boiling method, a bacterial genomic DNA extraction kit, or other recognized DNA extraction methods with equivalent efficacy, and stored at -20°C for later use.

[0082] In this embodiment, sample DNA was obtained by boiling method and kit. Among them, the specific steps of the boiling method are: transfer 10μL bacterial suspension stored in glycerol to 4mL liquid culture medium and culture at 37℃ and 250rpm for 24 hours. Take 1mL bacterial solution and centrifuge at 12000rpm for 3 minutes, discard the supernatant, and heat the retained 20μL culture solution in a 100℃ water bath for 10 minutes. Then centrifuge the heated test tube at 12000rpm for 2 minutes and place it on ice for 2 minutes. Transfer the supernatant containing DNA to a new centrifuge tube and store it at -20℃ for later use. The obtained supernatant is used as a DNA template. The steps of the kit method are carried out according to the kit operating instructions. (2) After multiple optimizations of the RPA constant temperature amplification system and the CRISPR / Cas12a detection system in the RPA-CRISPR / Cas12a detection system, the final RPA constant temperature amplification system and CRISPR / Cas12a detection system are as follows:

[0083] ①RPA constant temperature amplification system: 4μL C buffer, 1μL L buffer, 2.4μL P-core, 0.4μL dNTPs (10mM each), primer D11-F / D11-R final concentration of 0.448μM, 0.56μL B buffer, DNA template 1μL, total system 10μL.

[0084] ②CRISPR / Cas12a detection system: 2.5μL 10×NEB Buffer r2.1, 2μL Cas12a (1μM), 2μL crRNA (1μM), 0.5μL ssDNA-FQ (10μM), 0.5μL 0.8U RNase Inhibitor, 7.5μL ddH2O total system 15μL.

[0085] The reaction conditions of the RPA-CRISPR / Cas12a detection system are as follows: the RPA isothermal amplification system is reacted at 37°C for 25 minutes; the prepared CRISPR / Cas12a detection system is added and reacted at 37°C. CRISPR / Cas12a recognizes the target, the ssDNA-FQ fluorescent probe is cleaved and releases fluorescence, and the fluorescence intensity increases over time. After 20 minutes of reaction, no sample with a lower concentration in the same group produces green fluorescence. Preferably, the optimal reaction time should be 20 minutes.

[0086] The RPA-CRISPR / Cas12a test results were observed using a micro blue light gel cutting instrument, and a mobile phone was used to take photos and save the results for result judgment: when both the sample to be tested and the positive control produced green fluorescence, and the blank control had no green fluorescence, the sample to be tested was judged to be positive; when the positive control produced green fluorescence, the sample to be tested did not produce green fluorescence, and the blank control had no green fluorescence, it was judged that no gladiolus Burkholderia (Pseudomonas cocovenenans subspecies fermentum) was detected in the sample; if the positive control did not produce green fluorescence or the blank control produced green fluorescence, it indicated that the operation failed or there was reagent contamination, and the experiment needed to be repeated.

[0087] Example 3 is the specificity verification of the RPA-CRISPR / Cas12a detection system.

[0088] In order to verify the specificity of the RPA-CRISPR / Cas12a detection system constructed by the present invention, the present invention extracted DNA of gladiolus Burkholderia (Pseudomonas cocovenenans subspecies), gladiolus Burkholderia gladiolus pv. gladiolus, gladiolus Burkholderia onion pv. gladiolus, and gladiolus Burkholderia wild noni fruit isolated strain as detection objects, and performed specificity verification on the constructed RPA-CRISPR / Cas12a detection system. DNA extraction, RPA-CRISPR / Cas12a detection system and reaction conditions are the same as those in Example 1, and the fluorescence value is determined by real-time fluorescence PCR instrument for endpoint measurement. The specificity verification results of the RPA-CRISPR / Cas12a detection system are as follows: Figure 2 As shown, it can be seen that the detection system of the present invention only produces obvious green fluorescence visible to the naked eye for the DNA sample of Burkholderia gladioli (Pseudomonas cocovenenans subsp. cepa), and has no fluorescent reaction to the other three species, including Burkholderia gladioli pv. gladioli, Burkholderia gladioli pv. cepa, and Burkholderia gladioli wild noni fruit isolate, indicating that the RPA-CRISPR / Cas12a detection system of the present invention has high specificity.

[0089] Example 4 shows the sensitivity of the RPA-CRISPR / Cas12a detection method.

[0090] In order to verify the sensitivity of the constructed RPA-CRISPR / Cas12a detection method, the present invention used the genomic DNA of Burkholderia gladioli (Pseudomonas cocovenenans subsp. fermentans) as a template and set up a system with different DNA contents for detection. The amount of genomic DNA in the system was 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 、0(NTC). The test results are as follows Figure 4 As shown in the figure, the detection limit of the RPA-CRISPR / Cas12a detection method constructed by the present invention for the genomic DNA of Burkholderia gladiolus (Pseudomonas cocovenenans subspecies fermented rice flour) is 10 -4 ng / μL.

[0091] Example 5 is the detection limit of the RPA-CRISPR / Cas12a detection method.

[0092] To verify the detection limit of the constructed RPA-CRISPR / Cas12a detection method, the present invention used artificial spiked samples to prepare samples to simulate the situation where coconut water, rice flour, and glutinous rice flour on the market were contaminated with Burkholderia gladiolus (Pseudomonas cocovenenans subsp. glutinosa), and evaluated and verified them using the RPA-CRISPR / Cas12a detection system described in the present invention.

[0093] The detection limit evaluation results are as follows Figure 6 As shown, when the sample contains 10 0 When the number of CFU / mL gladiolus Burkholderia (Pseudomonas cocovenenans subspecies fermented rice flour) is less than 10, it can be detected by the RPA-CRISPR / Cas12a system described in the present invention, and the test tube emits obvious green fluorescence visible to the naked eye, showing a positive test result. When the sample is not labeled, the system cannot recognize the target, the test tube does not produce green fluorescence, and the test result is negative. Therefore, the detection limit of the RPA-CRISPR / Cas12a system constructed by the present invention for gladiolus Burkholderia (Pseudomonas cocovenenans subspecies fermented rice flour) can reach 10 0 CFU / mL.

[0094] Example 6 is the accuracy of the RPA-CRISPR / Cas12a detection method.

[0095] In order to prove the accuracy of the RPA-CRISPR / Cas12a detection method of the present invention, the real-time fluorescence PCR method established by Lin Jie et al. (2020) was used to verify the accuracy of the constructed RPA-CRISPR / Cas12a detection system. The real-time fluorescence PCR method was used to detect Burkholderia gladioli (Pseudomonas cocovenenans subspecies fermented rice flour) in the sample, and the results were as follows: Figure 7 The results showed that the results of the real-time fluorescence PCR detection method used in the reference were completely consistent with those of the present invention ( Figure 6 ), which proves that the RPA-CRISPR / Cas12a detection method of the present invention has high accuracy and can be applied to the rapid detection of Burkholderia gladiolus (Pseudomonas cocovenenans subspecies) in food.

[0096] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. An RPA-CRISPR / Cas12a composition for detecting B. gladiolipv. cocovenenans, characterized in that: It includes a virulence gene-based Burkholderia gladiolus and Pseudomonas cocovenenans subspecies-specific base sequence, RPA primers D11-F and D11-R, crRNA, CRISPR / Cas12a protein and ssDNA-FQ probe; the base sequence is shown in SEQ ID NO.1, the sequences of the RPA primers D11-F and D11-R are shown in SEQ ID NO.2~3, the sequence of the crRNA is shown in SEQ ID NO.4, and the sequence of the ssDNA-FQ is shown in SEQ ID NO.

5.

2. Use of the composition according to claim 1 in preparing a product for detecting Burkholderia gladioli pv. cocovenenans.

3. The use according to claim 2, characterized in that The method for detecting gladiolus Burkholderia cerebroventris subspecies comprises the following steps: step 1: extracting DNA of a sample to be tested; step 2: using the DNA obtained in step 1 as a template, and performing a nucleic acid isothermal amplification reaction using the RPA primers D11-F and D11-R described in claim 1; step 3: preparing a detection system using the crRNA, ssDNA-FQ, and CRISPR / Cas12a protein in the composition described in claim 1, and adding the amplification product obtained in step 2 to react; the 5' end of the ssDNA-FQ is labeled with a FAM group, and the 3' end is labeled with a BHQ group; and using a portable blue light gel cutting instrument to directly visually judge the gladiolus Burkholderia cerebroventris subspecies in the tested sample.

4. The use according to claim 3, characterized in that In step 1, the DNA of the sample to be tested is extracted by the boiling method or a kit.

5. The use according to claim 3 or 4, characterized in that In the reaction system of the nucleic acid isothermal amplification reaction in step 2, the final concentration of the primers D11-F and D11-R is 0.448 μM.

6. The use according to claim 5, characterized in that In the detection system described in step 3, the final concentration of Cas12a is 80nM, the final concentration of crRNA is 80nM, and the final concentration of ssDNA-FQ is 200nM.

7. A kit for detecting Burkholderia gladioli and Pseudomonas cocovenenans subspecies (B. gladiolipv. cocovenenans), characterized in that: Contains the RPA-CRISPR / Cas12a composition of claim 1.

Images