A protein and gene associated with resistance to a peach aphid nAChR competitive regulator insecticide and its application.

Abstract

This invention discloses a protein and gene related to resistance to neonicotinoid acetylcholine receptor competitive regulator insecticides in peach aphids, and their applications. It relates to the field of screening technology for neonicotinoid acetylcholine receptor competitive regulator insecticides in peach aphids. This invention obtains and clarifies an MpeABCC_4G protein and its encoding gene that is closely related to the resistance of peach aphids to neonicotinoid acetylcholine receptor competitive regulator insecticides. By knocking down the expression of MpeABCC_4G in resistant peach aphids using RNAi technology, the control efficacy of neonicotinoid acetylcholine receptor competitive regulator insecticides is significantly improved.

Description

Technical Field

[0001] This invention relates to the field of screening technology for nAChR competitive regulator insecticide resistance-related proteins and genes in peach aphids, and more specifically to a peach aphid nAChR competitive regulator insecticide resistance-related protein, gene, and its application. Background Technology

[0002] The peach aphid is a major pest distributed worldwide, causing significant damage. Besides sucking plant sap, leading to decreased crop yield and quality, it can also transmit various plant viruses, often resulting in large-scale crop failure. Because the peach aphid has a very wide host range, including over 400 species from 50 families, and can migrate and cause damage to various crops, its control has traditionally relied primarily on spraying chemical pesticides. Nicotinic acetylcholine receptor competitive modulators primarily act on nicotinic acetylcholine receptors (nAChR) and are classified as Group 4 by the International Resistant Pesticides Committee (IRAC). This class of insecticides mainly includes neonicotinoids (subclass 4A, such as imidacloprid, thiamethoxam, acetamiprid, nitenpyram, dinotefuran, and thiamethoxam), sulfoxide imides (subclass 4C, such as flonicamid), butenolates (subclass 4D, such as flupyrflufenoxuron), and metronidazoles (subclass 4E, such as trifluralin). These insecticides have good systemic properties and high activity, making them major control agents for pests such as aphids, whiteflies, thrips, scale insects, leafhoppers, planthoppers, and longhorn beetles. Their development has been rapid in recent years, and they are also the largest-selling class of insecticides globally. However, similar to other conventional insecticides, the application of neonicotinoid acetylcholine receptor competitive regulators in actual production is often unscientific and unreasonable, leading to the development of pesticide resistance in pests. As peach aphid resistance to these insecticides becomes increasingly severe, the field control efficacy of nAChR competitive regulators against peach aphids has significantly decreased, attracting the attention of pesticide manufacturers, researchers, and growers worldwide.

[0003] Identifying resistance mechanisms is fundamental to managing pesticide resistance in pests and is a crucial step in pest control, essential for extending pesticide lifespan and reducing dosage. Initially, subclasses 4C, 4D, and 4A did not exhibit cross-resistance, but with increased use, peach aphid field populations developed resistance to all of these pesticide classes. Enhanced metabolism is the main mechanism of resistance to nAChR-competitively regulated pesticides in peach aphids. Current research primarily focuses on the cytochrome P450 multifunctional oxidase, but studies indicate that the P450 genes involved in resistance to different subclasses differ. The P450 gene associated with neonicotinoid resistance in subclass 4A is CYP6CY3, while overexpression of CYP380C40 is associated with resistance in subclass 4C. Recognizing the role of metabolic genes associated with resistance to nAChR-competitively regulated pesticides in resistance is extremely important for elucidating the resistance mechanisms.

[0004] ATP-binding cassette proteins, also known as ABC transporters, and the ABC transporter C subfamily (ABCC) are multidrug resistance proteins (MRPs). They are one of the mechanisms of multidrug resistance formation in diseases such as human cancer. Recent studies have shown that ABC transporters are important participants in pesticide metabolism and are related to the resistance of many insects to pesticides. For example, some ABC genes are involved in the transport of pesticides and nicotine and are related to the resistance of insects to pesticides such as Bacillus thuringiensis (Bt), pyrethroids, and abamectin.

[0005] RNA interference (RNAi) is a form of gene silencing triggered by highly conserved double-stranded RNA (dsRNA) in all eukaryotic cells. RNAi functionality has been demonstrated in many insects, including aphids, and it has been successfully used for pest control. RNAi targeting major metabolic enzymes is an important pathway to enhance the toxicity of some insecticides; for example, knocking down the ABCG transporter gene can increase the sensitivity of fall armyworm and cotton bollworm to insecticides such as lambda-cyhalothrin, chlorantraniliprole, and abamectin. Nanoparticles provide a guarantee for the application of this technology in production.

[0006] Therefore, reducing the resistance of peach aphids to competitive regulators of acetylcholine receptors is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0007] In view of this, the present invention is hereby proposed.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] One aspect of this invention is to provide a resistance-related protein to a peach aphid nAChR competitive regulator insecticide, said protein comprising any of the following sequences:

[0010] 1) The amino acid sequence as shown in SEQ ID NO.2;

[0011] 2) Proteins related to resistance to pesticides that compete with nAChR in peach aphids, obtained by substituting and / or deleting and / or adding one or more amino acid residues in 1).

[0012] 3) A protein derived from the peach aphid and sharing more than 98% identity with 1) and competing with the peach aphid nAChR for resistance to insecticides.

[0013] A second aspect of the present invention is to provide a nucleotide sequence comprising any one of the following 1)-4):

[0014] 1) The sequence shown in SEQ ID NO.1;

[0015] 2) The coding region encodes the nucleotide sequence of the protein;

[0016] 3) A nucleotide sequence that has more than 75% identity with 2) and encodes the protein;

[0017] 4) A nucleotide sequence that hybridizes with 2) or 3) under stringent conditions and encodes the protein.

[0018] A third aspect of the present invention is to provide the application of a substance that inhibits the gene encoding the protein in the control of peach aphids.

[0019] In a preferred embodiment, the substance that inhibits the coding gene encoding the protein is dsRNA, and the nucleotide sequence is shown in SEQ ID NO.7 to SEQ ID NO.8.

[0020] A fourth aspect of this invention is to provide an agent for controlling peach aphids, comprising MpeABCC_4G dsRNA nanoparticles and nAChR competitive regulatory insecticides;

[0021] In a preferred embodiment, the nAChR competitive regulator insecticide includes any one of imidacloprid, thiamethoxam, flonicamid, flupyradifurone, and thiamethoxam.

[0022] In a preferred embodiment, the ratio of MpeABCC_4G dsRNA nanoparticles to nAChR competitive regulatory insecticide is 1:1 to 1:128.

[0023] In a more preferred embodiment, the ratio of MpeABCC_4G dsRNA nanoparticles to nAChR competitive regulatory insecticide is 1:32 or 1:16.

[0024] The fifth aspect of this invention provides a method for preparing an agent to control peach aphids, the process comprising:

[0025] MSNs-insecticide was mixed with MpeABCC_4G dsRNA PBS dispersion, mixed at room temperature for 30 min, and the product was collected by centrifugation at 8000 rpm. After lyophilization, nAChR competitive regulatory insecticide + MpeABCC_4G dsRNA nanoparticles were prepared.

[0026] A sixth aspect of this invention relates to the application of biomaterials associated with the protein, wherein the application is to construct a model of peach aphid resistant to nAChR competitive regulator insecticides; the biomaterials include any of the following:

[0027] 1) The nucleic acid molecule encoding the protein described;

[0028] 2) An expression cassette containing the nucleic acid molecule described in 1);

[0029] 3) A recombinant vector containing the nucleic acid molecules described in 1).

[0030] The seventh aspect of this invention is to provide a method for controlling peach aphids by spraying pesticides onto plants.

[0031] In a preferred embodiment of the present invention, the spraying dosage is 50-200 mg / kg;

[0032] In a more preferred embodiment, the dosage of imidacloprid and MpeABCC_4G dsRNA sprayed is 150 mg / kg;

[0033] In a more preferred embodiment, the dosage of thiamethoxam and MpeABCC_4G dsRNA sprayed is 50 mg / kg.

[0034] In a more preferred embodiment, the dosage of flonicamid and MpeABCC_4G dsRNA sprayed is 50 mg / kg.

[0035] In a more preferred embodiment, the dosage of flupyrfuranone and MpeABCC_4G dsRNA sprayed is 80 mg / kg;

[0036] In a more preferred embodiment, the dosage of thiamethoxam and MpeABCC_4G dsRNA sprayed is 200 mg / kg.

[0037] As can be seen from the above technical solutions, compared with the prior art, this invention is the first to identify and obtain the ABC transporter gene MpeABCC_4G related to the resistance of peach aphids to nAChR competitive regulator insecticides; and synthesizes dsRNA-MpeABCC_4G in vitro, which shows a significant interference effect; in the laboratory, it was verified that after treatment with dsRNA-MpeABCC_4G, the sensitivity of resistant peach aphids to nAChR competitive regulator insecticides increased significantly; in order to better apply in the field, an nAChR competitive regulator insecticide and dsRNA-MpeABCC_4G nano-formulation were prepared. Field trials showed that the control effect of the nAChR competitive regulator insecticide and the dsRNA-MpeABCC_4G nano-formulation on resistant peach aphids in the field was significantly higher than that of using the nAChR competitive regulator insecticide alone. This invention can improve the effect of insecticides on resistant peach aphids, reduce the amount of pesticides used, and extend the service life of pesticides, and has broad prospects for market promotion and application. Attached Figure Description

[0038] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0039] Figure 1 The attached image shows the electrophoresis detection of the PCR amplification fragment of the MpeABCC_4G gene;

[0040] Figure 2 The attached figure shows the overexpression of the MpeABCC_4G gene in peach aphids screened indoors and in the field compared with susceptible populations.

[0041] Figure 3 The attached figure shows the expression of MpeABCC_4G in resistant peach aphids screened indoors and the overexpression induced by different insecticides;

[0042] Figure 4 The attached figure shows the expression of MpeABCC_4G in resistant peach aphids in the field and the overexpression induced by different insecticides;

[0043] Figure 5 The attached figure shows the expression level of MpeABCC_4G after injection of MpeABCC_4G dsRNA into peach aphids.

[0044] Figure 6 The attached figure shows the mortality rate of indoor resistant peach aphids under different LC50 dosages of insecticides after interference with the MpeABCC_4G gene;

[0045] Figure 7 The attached figure shows the field mortality rate of resistant peach aphids under different LC50 dosages of insecticides after interference with the MpeABCC_4G gene. Detailed Implementation

[0046] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0047] This invention, through comparison of resistant and susceptible peach aphid populations, found that the MpeABCC_4GMpeABCC_4G gene of the ABC transporter C subfamily in resistant peach aphids to nAChR competitive regulatory insecticides was overexpressed. Furthermore, subclasses 4A, 4C, and 4D insecticides could induce overexpression of the MpeABCC_4G gene in resistant peach aphid populations. These studies indicate that this gene is related to the resistance of peach aphids to these insecticides.

[0048] Test insects: The susceptible strain SS was raised by our institute since 2008 without pesticide exposure. The neonicotinoid insecticide-resistant population (THG-R) was a resistant population screened in the laboratory using thiamethoxam. The field-resistant population (SEF-R) was collected from Putang, Fuzhou. Compared with the susceptible population, both resistant populations were resistant to acetylcholine-containing neonicotinoids such as imidacloprid, thiamethoxam, thiamethoxam, dinotefuran, flupyrflufenoxam, and flonicamid. All competing regulators produced resistance, with resistance multiples exceeding 20-fold. The flupyrrolidone-resistant population (FBI-R) was a resistant population screened in the laboratory using flupyrrolidone, exhibiting a resistance multiple exceeding 1000-fold. The flonicamid-resistant population (FDC-R) was a resistant strain screened in the laboratory using flonicamid, exhibiting a resistance multiple exceeding 500-fold. All tested peach aphids were reared in this laboratory.

[0049] Reagents: Super Total RNA Extraction Kit and SV Gel and PCR Clean-Up System are products of Promega. First-Strand cDNA Synt hesis SuperMix with All-in-One First-Strand cDNA Synthesis Super Mix for qPCR (One-Step gDNA Removal) is a product of Beijing Quanshijin Company, along with the T7 High Yield RNA Transcription Kit, VAHTS RNA Clean Beads, and AceQ qPCR S. Green Master Mix was a product of Nanjing Novizan Technologies Co., Ltd.; the ABI real-time PCR 8-tube kit was purchased from Axygen; and the primers were synthesized by Shanghai Jereh Co., Ltd.

[0050] Example 1: Extraction of total RNA from peach aphids

[0051] The peach aphids, cryopreserved at -80℃, were removed, weighed (0.1g), and ground in liquid nitrogen. 300 μl of RNA lysis buffer and 300 μL of dilution buffer were added, mixed, and centrifuged at 17000×g for 5 min. The supernatant was collected, and 0.5 times the total volume of ethanol was added, mixed, and transferred to an elution tube for washing. 5 μl of DNase, 5 μl of IDN A enzyme I buffer, and 10 μl of nuclease-free water were added, mixed, and dropped into a centrifuge column. After 15 min, the column was washed twice with 600 μl of RNA washing buffer, centrifuged for 1 min, and the column was transferred to an elution tube (provided in the kit). 20 μl of nuclease-free water was added to the center of the column membrane, incubated at room temperature for 2 min, centrifuged at 14000×g for 1 min, and then added to RNA-free water. The obtained RNA was analyzed by gel electrophoresis, and its concentration and purity were determined using a spectrophotometer. The RNA was stored at -80℃ for later use.

[0052] Example 2 cDNA Synthesis

[0053] Prepare the reaction solution on ice according to the grouping in Table 1:

[0054] Table 1

[0055]

[0056] Gently mix the reaction solution and incubate the product at 42°C for 30 minutes; inactivate EasyScri ptR RT / RI by heating at 85°C for 5 seconds. Add SEQ ID No. 1 and SEQ ID No. 2 to the PCR instrument and react according to the following program: 45°C, 30 min; 99°C, 5 min; 5°C, 5 min. After the reaction, recover the tape to obtain the MpeABCC_4G gene and store it at 4°C.

[0057] SEQ ID No. 1:

[0058] ATGGACGCAACATCCAAAGAAGAAAAAC

[0059] SEQ ID No. 2:

[0060] AGGTATTTAGTTTGAGAATCTGTTAGC

[0061] The amplification result is shown in SEQ ID NO.3, and the protein is shown in SEQ ID NO.4.

[0062] Example 3: qPCR detection of MpeABCC_4G gene expression in the resistant strain

[0063] The cDNA was amplified using SEQ ID No. 5 and SEQ ID No. 6 according to the conditions in Table 2:

[0064] SEQ ID No.5:

[0065] AGCAGGAAAGAGTTCGTTGG

[0066] SEQ ID No. 6:

[0067] ATGGTTCTTGCGATGCGTAC

[0068] Table 2

[0069] name Volume (μl) cDNA 2 Norvitamin mix 10 F primer 0.4 R primer 0.4 RNase-freeWater 7.2 Total 20

[0070] Using total RNA from the peach aphid as a template, cDNA first-strand was synthesized via reverse transcription, followed by PCR amplification using designed specific primers. Electrophoresis was performed on a 1.2% agarose gel for detection. Figure 1 It can be seen that the PCR product has a clear and bright electrophoretic band at 5000bp. The target band is carefully cut out and purified under ultraviolet light and used to synthesize dsRNA.

[0071] Example 4: In vitro synthesis of MpeABCC_4G dsRNA from the peach aphid

[0072] dsRNA was prepared using the T7 High Yield RNA Transcription Kit.

[0073] A pair of primers (SEQ ID No. 7 and SEQ ID No. 8) were designed based on the gene sequence to amplify the target gene fragment. The T7 promoter sequence was added before the upstream and downstream primers. In vitro transcription was performed: dsRNA was synthesized according to the system in Table 3 below. The components were gently mixed with a pipette, briefly centrifuged, and incubated at 37°C for 6 h. 1 μl of DNase I was added to the reaction system, and the mixture was incubated at 37°C for 15 min. The mixture was then stored at -20°C.

[0074] SEQ ID No.7:

[0075] GCGAAAGCTAATATTTTTGAAATTATTAC

[0076] SEQ ID No. 8:

[0077] CGAATTTTCATTGCAATATGAGACA

[0078] Table 3

[0079] name Volume (μl) 10×ReactionBuffer 2 ATPSolution 2 GTPSolution 2 CTPSolution 2 UTPSolution 1.5 Modified UTP (10mM) 5 Linear template DNA 1μg T7 RNA Polymerase Mix 2 <![CDATA[RNase-freeddH2O]]> upto20

[0080] Purification of dsRNA: The prepared dsRNA was purified using VAHTS RNA CleanBeads. After equilibrating the VAHTS RNACleanBeads to room temperature, mix thoroughly. Add the corresponding volume of VAHTS RNA CleanBeads to the original RNA solution, with the RNA CleanBeads volume = 1.8 × the original RNA solution volume. Mix thoroughly by pipetting ten times. Incubate at room temperature for 5 min to allow RNA to bind to the magnetic beads. Place the sample on a magnetic rack for 5 min, and after the solution becomes clear, carefully remove the supernatant. Keeping the sample in the magnetic rack, add 200 μl of freshly prepared 80% ethanol (Nuclease-free H2O) to rinse the magnetic beads; incubate at room temperature for 30 s, and carefully remove the supernatant. Repeat the above step, rinsing a total of 2 times. Keeping the sample in the magnetic rack, open the cap and air dry the magnetic beads for 10 min. Remove the sample from the magnetic rack, add an appropriate volume of Nuclease-free H2O, and mix thoroughly by pipetting 10 times. Let stand at room temperature for 5 minutes. Place the sample back on the magnetic rack for 5 minutes. After the solution becomes clear, carefully transfer the supernatant to a new Nuclease-free centrifuge tube to obtain purified dsRNA. Detect its concentration using a spectrophotometer and store at -80°C for later use.

[0081] The purified dsRNA sequence is as follows:

[0082] F:TAATACGACTCACTATAGGGGCGAAAGCTAAT, SEQ ID NO.9;

[0083] R: TAATACGACTCACTATAGGGCGAATTTTCATTG, SEQ ID NO. 10.

[0084] Example 5: Detection of MpeABCC_4E expression level in peach aphids via dsRNA injection

[0085] MpeABCC_4G dsRNA was injected into wingless peach aphids, and the aphids were reared on Chinese cabbage seedlings for 24 hours to observe and record their growth. The experiment was divided into two groups: a control group and an RNAi interference treatment group. Real-time PCR and the CT value comparison method were used to detect RNA interference efficiency. Total RNA was extracted from peach aphids in both the control and dsRNA feeding groups and reverse transcribed to synthesize cDNA templates. Primers SEQ ID NO.3 and SEQ ID NO.4 were designed based on the MpeABCC_4G gene sequence, with peach aphid Actin as an internal reference gene. qRT-PCR analysis was performed using the Novizan SYBR PremixEX Taq kit in a 20 μL system. Relative gene expression levels were measured using a 2...－ΔΔCT The calculations were performed using the method described above. One-way ANOVA was used to analyze the significant differences between data, and Tukey's test was used for multiple comparisons.

[0086] The MpeABCC_4G gene was amplified using qPCR, showing that it was overexpressed in both indoor and field resistant lines, with expression folds exceeding 30-fold and 10-fold, respectively, compared to susceptible lines. Figure 2 ); while nAChR competitive regulatory insecticides can induce overexpression of the MpeABCC_4G gene in both indoor and field resistant lines. Figure 3 , Figure 4 ).

[0087] Example 6: Effect of dsRNA injection on insecticide toxicity

[0088] Fourth-instar adults of different strains of peach aphids were selected and injected with 2 ng / aphid of MpeABCC_4Gd sRNA into an artificial diet containing 20 ng / μL GroEL. After 24 h, total RNA was extracted from peach aphids in both the control and treatment groups, and RNA interference efficiency was detected using real-time quantitative PCR. Additionally, the lethal concentration (LC50) of different peach aphids in thiamethoxam, imidacloprid, thiamethoxam, flonicamid, and flupyradifurone was determined using the leaf disc method. 50 The mortality rate at the specified dose was determined by repeating the test three times.

[0089] The results showed that the survival rate of aphids injected with the target gene's dsRNA was not significantly different from that of the control, but the expression level of MpeABCC_4G in the aphids was significantly reduced. This indicates that injection of 2 ng / aphid of dsRNA can induce an RNAi effect of MpeABCC_4G in peach aphids, and can reduce the transcription level of the target gene. Figure 5 ).

[0090] Different nAChR competitive regulator insecticides LC 50 After interference at the specified dose, the mortality rate of laboratory-resistant peach aphids was significantly higher than that of untreated peach aphids in the field compared to those in the laboratory. Figure 6 , Figure 7 ).

[0091] Example 7: Preparation of dsRNA-containing nano-insecticide

[0092] Using hexadecyltrimethylammonium chloride (CTAC) as a template micelle, tetraethyl orthosilicate (TEOS) and cyclohexane solution were hydrolyzed at the oil-water interface (oil phase on top, water phase below) to form dendritic mesoporous silica (MSNs). CTAC was then removed by extraction with ammonium nitrate ethanol solution to obtain MSNs with a particle size of approximately 100 nm and a pore size of approximately 7 nm. 200 mg of MSNs was weighed into 30 mL of anhydrous ethanol and ultrasonically dispersed. A mixture of 500 μL of 3-aminopropyltriethoxysilane and 1.5 mL of ultrapure water was added dropwise, and the mixture was stirred at 25 °C for 5 h. The mixture was collected by centrifugation and dried under vacuum at 45 °C to obtain MSNs-NH2. 100 mg of MSNs-NH2 and 100 mg of nAChR competitive regulator insecticides (thiamethoxam, imidacloprid, thiamethoxam, flonicamid, flupyradifurone) were weighed into 30 mL of acetone and reacted at room temperature in the dark for 12 h with stirring. The mixture was then dried under vacuum at 45 °C to obtain the MSNs-insecticide. The content of nAChR competitive regulator insecticides in the product was determined by thermogravimetric analysis based on the pyrolysis temperature of the relevant nAChR competitive regulator insecticides. The MSNs-insecticide was mixed with MpeABCC_4G dsRNA PBS dispersion at ratios of 128:1, 64:1, 32:1, 16:1, 8:1, 4:1, 2:1, and 1:1, and mixed at room temperature for 30 min. The product was collected by centrifugation at 8000 rpm. The supernatant was subjected to RNA gel electrophoresis to determine the optimal binding ratio of SNs-insecticide and MpeABCC_4G dsRNA. After freeze-drying, nAChR competitive regulatory insecticide + MpeABCC_4G dsRNA nanoparticles were prepared and stored at low temperature. Bioassays were performed to determine the effective components of each treatment according to the insecticides. The spraying doses of imidacloprid, thiamethoxam, flonicamid, flupyrrolidone, and thiamethoxam were 150, 50, 50, 80, and 200 mg / Kg, respectively. The toxicity of different combinations of nanoparticles against different resistant peach aphids was determined, and synergistic ratios were screened for subsequent field control of resistant peach aphids. The results are shown in Table 4.

[0093] Table 4. Mortality rate of peach aphids (%) after spraying MSNs-insecticide and MpeABCC_4G insecticides in different ratios.

[0094]

[0095] The above results indicate that the mortality rate of peach aphids caused by MSNs-insecticides combined with MpeABCC_4G 32:1 and 16:1 is significantly higher than that caused by MSNs-insecticides alone.

[0096] Example 8: Efficacy of nAChR competitive regulator insecticide + MpeABCC_4G dsRNA nanoparticles against peach aphids in the field.

[0097] To verify the efficacy of nAChR competitive regulator insecticides combined with MpeABCC_4G dsRNA nanoparticles against resistant peach aphids in the field, the following insecticides were sprayed: imidacloprid, thiamethoxam, flonicamid, flupyradifurone, and the following combinations of imidacloprid with MpeABCC_4G dsRNA nanoparticles, imidacloprid with MpeABCC_4G dsRNA nanoparticles, thiamethoxam with MpeABCC_4G dsRNA nanoparticles, flonicamid with MpeABCC_4G dsRNA nanoparticles, and flupyradifurone with MpeABCC_4G dsRNA nanoparticles. The experiment was conducted in a Chinese cabbage field in Chentang Village, Dahu Township, Minhou County, Fuzhou City. For each treatment, the effective ingredient was calculated based on the insecticide. The spraying dosages for imidacloprid, thiamethoxam, flonicamid, flupyradifurone, and thiamethoxam were 150, 50, 50, 80, and 200 mg / kg, respectively. The Chinese cabbage was sprayed, with one application during the peach aphid infestation period. The initial insect population was assessed before application, and the number of surviving insects was assessed at 3, 7, 10, and 14 days after application, for a total of 6 assessments. The survey method used fixed-plant surveys, with 10 Chinese cabbage plants surveyed per plot. Two plants from each plant were selected from five different directions (east, south, west, north, and center) for marking. The number of surviving insects per shoot was recorded. The relative control efficacy was calculated by comparing with the control group. See Table 5.

[0098] Table 5. Results of efficacy trials of nAChR competitive regulator insecticides against peach aphids.

[0099] deal with 3 days after taking the medicine 7 days after taking the medicine 10 days after taking the medicine 14 days after taking the medicine Thiamethoxam 70.1b 79.1b 75.0d 65.6c Thiamethoxam + dsRNA 83.0a 90.3a 91.5b 82.8a Imidacloprid 68.0b 77.6b 75.7d 66.0c Imidacloprid + dsRNA 84.6a 91.2a 91.3b 82.8a Thiamethoxam 66.5b 73.7b 74.3d 65.3c Thiamethoxam + dsRNA 81.9a 88.3a 89.4b 81.5ab Flupyradifurone 65.4b 62.1c 73.0d 66.2c Flupyradifurone + dsRNA 85.4a 89.5a 89.5b 80.7ab Flupyrrolidone 72.7b 79.0b 83.8c 72.6bc Flupyrrolidone + dsRNA 88.6a 90.2a 96.6a 83.9a

[0100] The above results indicate that overexpression of the ABC transporter protein ABCC_4E in peach aphids is closely related to the resistance of peach aphids to nAChR competitive regulatory insecticides, and RNAi of the ABCC_4E gene can significantly increase the toxicity of nAChR competitive regulatory insecticides, showing broad application prospects.

[0101] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0102] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of inhibiting insecticide resistance-related proteins in reducing the resistance of peach aphids to nicotinic acetylcholine receptor competitive regulator insecticides, characterized in that, The amino acid sequence of the insecticide resistance-related protein is shown in SEQ ID NO.

4.

2. The application according to claim 1, characterized in that, The nucleotide sequence encoding the insecticide resistance-related protein is shown in SEQ ID NO.

3.

3. To inhibit the use of the insecticide resistance-related protein described in claim 1 in the control of peach aphids.

Images