Application of phosphatidylcholine transporter OsPCTP in regulating resistance to bacterial blight in rice
By overexpressing the phosphatidylcholine transporter OsPCTP in rice, the problem of low resistance to bacterial blight in rice varieties was solved, and the resistance to bacterial blight in rice was significantly enhanced, providing genetic resources for crop breeding.
Patent Information
- Application Number
- CN202411314271.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-20
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-09-20
AI Technical Summary
Existing rice varieties have low resistance to bacterial blight, which affects yield and rice quality, and there is a lack of effective quantitative resistance gene resources.
Overexpression of the phosphatidylcholine transporter OsPCTP in rice, followed by the construction of an overexpression vector and genetic transformation, enhanced the rice's resistance to bacterial blight.
It significantly improved rice's resistance to bacterial blight, provided valuable genetic resources for crop breeding, and enhanced resistance to bacterial blight.
Smart Images

Figure CN118979046B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of genetic engineering technology, and in particular to the application of phosphatidylcholine transporter OsPCTP in regulating resistance to bacterial blight in rice. Background Technology
[0002] Rice bacterial blight is one of the most serious bacterial diseases affecting rice production, causing 10%-80% yield loss annually and significantly impacting my country's food security and farmers' income. It is widely distributed, occurring in South, Central, and East my country, but is most frequent in southern rice-growing areas along rivers, lakes, coastlines, hills, and low-lying, flood-prone areas. Bacterial blight severely affects rice plant photosynthesis, occurring during the heading and grain-filling stages, impacting grain filling and leading to immature, low-quality, and brittle grains, seriously affecting rice yield, quality, and edibility. Therefore, breeding new rice varieties resistant to bacterial blight is the most economical, effective, sustainable, and environmentally friendly solution. Generally, based on the mechanism by which plants resist pathogen invasion, plant disease resistance can be divided into qualitative (complete) resistance and quantitative (partial) resistance. Compared to qualitative resistance, which is controlled by major R genes and has race-specific characteristics, quantitative resistance, regulated by multiple genes and lacking race-specificity, is considered to have a broader resistance spectrum and longer-lasting resistance. Therefore, continuously discovering and utilizing new genes related to quantitative resistance to bacterial blight, and cultivating and promoting new disease-resistant varieties, is of great significance for increasing farmers' income and ensuring my country's food security. Summary of the Invention
[0003] This application provides an application of the phosphatidylcholine transporter OsPCTP in regulating resistance to bacterial blight in rice, aiming to solve the technical problem of low resistance to bacterial blight in existing rice varieties.
[0004] To address the aforementioned technical problems, this application provides the following embodiment: the application of a phosphatidylcholine transporter OsPCTP in regulating resistance to bacterial blight in rice, wherein the phosphatidylcholine transporter OsPCTP is overexpressed in rice to enhance resistance to bacterial blight in rice.
[0005] As some optional embodiments of this application, the CDS sequence of the OsPCTP gene is linked to the overexpression vector pCAMBIA1301S to construct an OsPCTP overexpression vector; the constructed OsPCTP overexpression vector is then subjected to rice genetic transformation to obtain T0 generation overexpression transgenic plants.
[0006] As some optional embodiments of this application, the CDS sequence of the phosphatidylcholine transporter OsPCTP is shown in SEQ ID NO.3, the plant expression vector is pCAMBIA1301S, and the rice is Zhonghua 11.
[0007] As some optional embodiments of this application, the amino acid sequence of the phosphatidylcholine transporter OsPCTP is shown in SEQ ID NO.1, and the gene sequence of the phosphatidylcholine transporter OsPCTP is shown in SEQ ID NO.2.
[0008] As some optional embodiments of this application, after linking the CDS sequence of the OsPCTP gene to the overexpression vector pCAMBIA 1301S to construct an OsPCTP overexpression vector; and after performing genetic transformation of the constructed OsPCTP overexpression vector on rice to obtain transgenic plants, the method further includes:
[0009] The T0 generation overexpression transgenic plants were positively detected by polymerase chain reaction. The expression of OsPCTP in the positive transgenic plants was detected by real-time quantitative PCR. Transgenic plants with significantly increased OsPCTP expression were selected, and single-plant self-pollinated seeds were harvested.
[0010] As some optional embodiments of this application, after the positive detection of the T0 generation overexpression transgenic plants using polymerase chain reaction, the detection of OsPCTP expression in the positive transgenic plants by real-time quantitative PCR, the selection of transgenic plants with significantly increased OsPCTP expression, and the harvesting of self-pollinated seeds from individual plants, the method further includes:
[0011] The self-pollinated seeds of the individual plants were planted into T1 generation families. The positive results of the T1 generation individual plants were detected by PCR. The field traits of the positive transgenic individual plants and the control ZH11 material after inoculation with bacterial blight were investigated. Transgenic individual plants with normal seed setting rate were selected and self-pollinated for seed saving. The field traits included resistance performance after inoculation with bacterial blight and field agronomic traits.
[0012] As some optional embodiments of this application, before linking the CDS sequence of the OsPCTP gene to the overexpression vector pCAMBIA 1301S to construct the OsPCTP overexpression vector, the method further includes:
[0013] The gene OsPCTP and its CDS sequence were amplified from rice variety ZH11 using polymerase chain reaction.
[0014] Compared to existing technologies, this application reveals for the first time the biological function of the rice phosphatidylcholine transporter OsPCTP, which regulates resistance to rice bacterial blight. Overexpression of this gene enhances resistance to rice bacterial blight. It can be seen that this application provides a valuable genetic resource for crop breeding, and the rice OsPCTP gene can be widely applied to crop hybridization breeding and hybrid seed production. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the specific embodiments of this application or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.
[0016] Figure 1 This is a schematic diagram showing the positive detection of T0 generation transgenic plants overexpressing OsPCTP and the detection of OsPCTP gene expression level in this application. Figure 1 A represents the relative expression level of the OsPCTP gene in transgenic plants as detected by qRT-PCR, where negative transgenic plants are shown in white bars and positive transgenic plants are shown in black bars; Figure 1 B represents the result of PCR detection using primers designed to cross introns within the OsPCTP gene;
[0017] Figure 2 The resistance performance of materials overexpressing OsPCTP in this application after inoculation with bacterial blight pathogen. ; Figure 2 A represents the resistance phenotype of plants overexpressing OsPCTP and ZH11 plants after inoculation with Bacillus subtilis type IV. Figure 2 B represents the lesion length of OsPCTP overexpressing plants and control ZH11 plants, **p<0.01;
[0018] Figure 3 This application utilizes yeast two-hybrid technology to demonstrate the interaction between OsPCTP and OsAPX8;
[0019] Figure 4 This application utilizes luciferase complementation detection technology to demonstrate the interaction between OsPCTP and OsAPX8.
[0020] The realization of the purpose, functional features and advantages of this application will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation
[0021] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this application, and not all of the embodiments. Based on the embodiments of this application, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of this application.
[0022] The phosphatidylcholine transporter OsPCTP described in this application is characterized by its interaction with the OsAPX8 protein in both yeast cells and tobacco. This application involved ligating the OsAPX8 gene into the pGADT7 vector and co-transforming yeast competent cells with an OsPCTP bait vector. The bacterial culture was then plated on SD / -Leu / -Trp doubly deficient medium and SD / -Ade / -Leu / -Trp / -His quadruple deficient medium, respectively. Colony growth indicated that OsPCTP and OsAPX8 do indeed interact. Furthermore, this application involved ligating the coding sequences of the OsPCTP and OsAPX8 genes into plant expression vectors JW771 and JW772, respectively, and transforming tobacco using Agrobacterium GV3101. After spraying with the luciferin substrate D-luciferin, the activated luciferase activity was measured, indicating that OsPCTP and OsAPX8 interact within the tobacco cell.
[0023] The purpose of this application is achieved through the following technical solution:
[0024] The OsPCTP gene was isolated from the rice variety ZH11. The CDS sequence of the OsPCTP gene was ligated into the pCAMBIA1301S vector to construct an overexpression vector. The recombinant vector was introduced into rice using Agrobacterium tumefaciens to obtain transgenic plants. Positive detection of the T0 generation transformed plants was performed using polymerase chain reaction (PCR), and seeds were harvested. Seeds from selected positive T0 generation plants were planted into T1 generation families, and after positive detection and inoculation with bacterial blight pathogens, positive plants with high resistance to bacterial blight were selected for seed production. Overexpression of OsPCTP further enhanced resistance to bacterial blight in rice. The OsPCTP interaction factor was verified using yeast two-hybrid and luciferase complementation experiments.
[0025] The objective of this application can also be further achieved using the following technical measures.
[0026] The gene OsPCTP, consisting of 4303 bases in length, was amplified from rice variety ZH11 using polymerase chain reaction (PCR). Its nucleotide sequence is shown in SEQ ID NO.2. The coding sequence (CDS) of the gene consists of 1308 bases and is shown in SEQ ID NO.3, encoding 435 amino acids, as shown in SEQ ID NO.1.
[0027] Among them, SEQ ID NO.1 is as follows:
[0028] MAGETDSTPMAAGRAVPPPPEAAAPRLLLLGGGAELWRPVARGGGWATAAALLLLLASHLSVLLLRRLRLRRRLRPADAVSSSSAAAAAVVTADSAPGSAAGMDGLVTEGDLRELVGNLGVAAREPEREGWQQVVAKGNDDVSYRVWCDKPMEGPPRYLSVTTYERCSTELLRDFYMDNEYRMEWDNTVIKHEQLQFDENSGIEIGRTIKKFPLLTPREYILAWRVWEGNDKSFYCLVKECEHPVAPRQRKFVRVQLLRSGWCIRKIPGRDACRITVLHHEDNGMNIEMAKLAFAKGIWNYICKMNSALRRYPQRNISSISILTMQRLTKKFPQALETDVDANHHPQGNTRANVVPTHFARTSSRQQPGKKSSRATIASGLLLIGSIVCLSRGRSNLGAQLAMAFFLKKAFKQDKGSSSQRSISRTDVTEPRHLE;
[0029] Among them, SEQ ID NO.2 is as follows:
[0030]
[0031] Among them, SEQ ID NO.3 is shown below:
[0032]
[0033] The CDS sequence of the OsPCTP gene was ligated into the overexpression vector pCAMBIA1301S to construct an OsPCTP overexpression vector. Plasmids were extracted from the constructed OsPCTP overexpression vector and subjected to genetic transformation in rice by Wuhan Boyuan Biotechnology Co., Ltd., resulting in T0 generation overexpressing transgenic plants.
[0034] Polymerase chain reaction (PCR) was used to detect the positive expression of transgenic plants in the T0 generation. The expression of OsPCTP in the positive transgenic plants was detected by quantitative real-time PCR (qRT-PCR). Transgenic plants with significantly increased OsPCTP expression were selected and self-pollinated seeds were harvested from individual plants.
[0035] The self-pollinated seeds of the selected individual plants from the above steps were planted into T1 generation families. The positive results of the T1 generation individual plants were further tested by PCR. The field characteristics of the positive transgenic individual plants and the control ZH11 material after inoculation with bacterial blight were examined, such as the resistance performance after inoculation with bacterial blight and the field agronomic traits. Transgenic individual plants with normal seed setting rate were selected and self-pollinated for seed saving.
[0036] By constructing yeast expression vectors BD-PCTP and AD-APX8, transforming them into competent yeast cells, and screening them in yeast culture media with two-deficient and four-deficient conditions, the interaction between OsPCTP and OsAPX8 in yeast was verified.
[0037] By constructing luciferase expression vectors PCTP-nLUC and cLUC-APX8, and transforming Agrobacterium tumefaciens GV3101, the cells were then transformed into Tobacco Benzoenta using the leaf vein injection method. Under the action of the luciferase substrate D-luciferin, it was found that the experimental group PCTP-nLUC / cLUC-APX8 and the positive control group could be detected with obvious fluorescence signals in the in vivo imaging system, while the three negative control groups showed no fluorescence signals.
[0038] As can be seen, this application provides the application of the OsPCTP gene in improving resistance to rice bacterial blight. The steps involve overexpressing the OsPCTP CDS in the rice variety Zhonghua 11, resulting in transgenic plants exhibiting significantly enhanced resistance to bacterial blight pathogens. This application reveals for the first time the biological function of the rice phosphatidylcholine transporter OsPCTP, which regulates rice resistance to bacterial blight; overexpression of this gene enhances resistance to the disease. This application provides a valuable genetic resource for crop breeding, enabling the widespread application of the rice OsPCTP gene in crop hybridization breeding and seed production.
[0039] The technical solution described in this application will be explained in detail below with reference to specific embodiments:
[0040] Example 1: Cloning of the OsPCTP gene
[0041] DNA was extracted from the rice variety Zhonghua 11 and polymerase chain reaction (PCR) was performed using primers. The PCR product was sequenced to obtain the gene sequence of OsPCTP, which consists of 4303 bases. The nucleotide sequence is shown in SEQ ID NO.2.
[0042] The primer sequences are: upstream primer 5'-ATGGCGGGGGAGACGGATTC-3', downstream primer 5'-CTATTCCAAGTGCCTGGGTTCA.
[0043] PCR program: 94℃ pre-denaturation for 5 minutes, 35 cycles (95℃ denaturation for 30 seconds; 58℃ annealing for 30 seconds; 72℃ extension for 4 minutes), 72℃ extension for 7 minutes.
[0044] RNA was extracted from leaves of the rice variety Zhonghua 11 and reverse transcribed into cDNA. This cDNA was then used as a template for polymerase chain reaction (PCR) using the primers described above. The obtained PCR product was sequenced to obtain the coding sequence (CDS) of the OsPCTP gene, consisting of 1308 bases. The CDS sequence is shown in SEQ ID NO.3. The PCR program was: 94℃ pre-denaturation for 5 minutes, 32 cycles (95℃ denaturation for 30 seconds; 56℃ annealing for 30 seconds; 72℃ extension for 1 minute), followed by a final extension at 72℃ for 7 minutes.
[0045] The coding sequence (CDS) was translated using Primer3 software (http: / / frodo.wi.mit.edu / ) to obtain the amino acid sequence, which encodes 435 amino acids. The sequence is shown in SEQ ID NO.1.
[0046] The primers were synthesized by Shanghai Sangon Biotech, and their sequences were determined by Shanghai Sangon Biotech. DNA and RNA extraction, PCR, and reagent formulations were based on those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, translated by Jin Dongyan et al., Science Press, 2002.
[0047] Example 2: Construction of recombinant vector and acquisition of transgenic plants
[0048] The sequence containing the CDS (SEQ ID NO.3) of the OsPCTP gene, amplified in Example 1, was ligated with the pCAMBIA 1301S vector linearized with Sma I restriction enzyme using homologous recombination via the ClonExpress II One Step Cloning Kit (Vazyme) and transformed into E. coli DH5α. Positive clones were selected and sequenced for verification, yielding the overexpression vector OsPCTP-OE.
[0049] The synthesis of primers and sequencing of positive clones were performed by Shanghai Sangon Biotech, and the restriction endonuclease Sma I and ligase were purchased from Takara Bio. The constructed OsPCTP overexpression vector was used to extract plasmids, which were then genetically transformed by Wuhan Boyuan Biotechnology to obtain transgenic plants.
[0050] Example 3: Identification of transgenic rice plants overexpressing the gene
[0051] Sixteen transgenic plants of the T0 generation, overexpressing OsPCTP, were obtained from Example 2 and named OE1 to OE16. DNA was extracted from the leaves of the T0 generation transgenic plants, and PCR was performed using primers that span the introns of the OsPCTP gene (primer sequences: upstream primer 5'-CACCAAGACAGCGGAAAT-3' and downstream primer 5'-TCGGGATAGACAAACAAT-3'). Positive transgenic plants were identified by amplifying a 440bp band. Figure 1 B).
[0052] PCR program: 94℃ pre-denaturation for 5 minutes, 32 cycles (95℃ denaturation for 30 seconds; 56℃ annealing for 30 seconds; 72℃ extension for 30 seconds), 72℃ extension for 7 minutes. RNA was extracted from leaves, reverse transcribed into cDNA, and subjected to quantitative real-time PCR. The internal control gene UBQ was used as a control (primer sequences: upstream primer 5'-AACCAGCTGAGGCCCAAGA-3' and downstream primer 5'-ACGATTGATTTAACCAGTCCATGA-3'). The expression level of the OsPCTP gene (primer sequences: upstream primer 5'-CTTCATCACGCCAACAGC-3' and downstream primer 5'-TTCCAAGTGCCTGGGTTC-3') in each transgenic plant was detected. The expression level of OsPCTP in transgenic positive plants was significantly increased. Figure 1 A) Harvest transgenic self-pollinated seeds.
[0053] The primers were synthesized by Shanghai Sangon Biotech, and their sequences were determined by Shanghai Sangon Biotech. DNA and RNA extraction, PCR, and reagent formulations were based on those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, translated by Jin Dongyan et al., Science Press, 2002.
[0054] Example 4: Application of the rice gene OsPCTP in improving the resistance of the rice variety Hua 11 to bacterial leaf blight.
[0055] After obtaining transgenic lines in Example 3 that overexpressed the OsPCTP gene in the rice variety Zhonghua 11, based on the growth status and seed setting of the transgenic plants, two transgenic single plants, OE1 and OE2, were selected from the positive plants in Example 3 with significantly increased OsPCTP gene expression and planted into T1 generation transgenic families. Further PCR (using the same method as in Example 3) was used to detect the positive single plants in each family. At the tillering stage, the plants were inoculated with bacterial blight type IV strain using the leaf-cutting method. The length of lesions was counted 12 days after inoculation. It was found that the bacterial blight resistance of the positive single plants in both families was significantly higher than that of the negative control Zhonghua 11. Figure 2 A) In positive families OE1 and OE2, the lesion length was significantly shorter than that in the negative control Zhonghua 11. Figure 2 B).
[0056] Example 5: Yeast two-hybrid verification of OsPCTP interaction factors
[0057] Total RNA was extracted from leaves of the Zhonghua 11 variety and reverse transcribed into cDNA. Using this cDNA as a template, the full-length cDNA sequence of OsPCTP was amplified using primer pair BD-PCTP-F / R, and the full-length cDNA sequence of OsAPX8 was amplified using primer pair AD-APX8-F / R. These cDNA sequences were then ligated into pGBKT7 and pGADT7 vectors (pre-digested with EcoRI) using the ClonExpress II One Step Cloning Kit (Vazyme), respectively, via homologous recombination. The ligation products were heat-shocked into *E. coli* DH5α competent cells, and positive clones were selected. Colony PCR was performed using primer pairs T7-PF / BD-3R and T7-PF / AD-3R. Positive clones were then sent to Shanghai Sangon Biotech for sequencing identification. The plasmids of the correctly sequenced positive clones without base mutations were named BD-PCTP and AD-APX8, respectively.
[0058] The AD-APX8 plasmid was co-transformed into Y2H yeast competent cells with BD-PCTP and BD empty vector plasmid, respectively. The bacterial cultures were plated on SD / -Leu / -Trp dual-deficient medium and SD / -Ade / -Leu / -Trp / -His quadruple-deficient medium, respectively, and incubated at 30℃ for 4 days before being photographed. The results showed that all combinations grew normally on the yeast dual-deficient medium, indicating that the experimental procedures were correct; only the AD-APX8 and BD-PCTP combination grew on the yeast quadruple-deficient medium, indicating that OsPCTP and OsAPX8 interact within the yeast cell. Figure 3 ).
[0059] The primers for amplification and sequencing are as follows:
[0060] BD-PCTP-F:
[0061] ATGGCCATGGAGGCCGAATTCATGGCGGGGGAGACGGATT
[0062] BD-PCTP-R:
[0063] TCGACGGATCCCCGGGAATTCCTATTCCAAGTGCCTGGGTTCA
[0064] AD-APX8-F:
[0065] GCCATGGAGGCCAGTGAATTCATGGCGGAGCGCATCGCC
[0066] AD-APX8-R:
[0067] ATGCCCACCCGGGTGGAATTCTCAGCTCCCGAGCAGAGACG
[0068] T7-PF:TAATACGACTCACTATAGGGC
[0069] BD-3R: GAGTCACTTTAAAATTTGTAT
[0070] AD-3R: CGGGGTTTTTCAGTATCTACG
[0071] Example 6: Luciferase complementation experiment to verify the interaction factor of OsPCTP
[0072] Total RNA was extracted from leaves of Zhonghua 11, and the RNA was reverse transcribed into cDNA. Using this cDNA as a template, the full-length cDNA sequence of OsPCTP was amplified using primer pair PCTP-nLUC-F / R, and the full-length cDNA sequence of OsAPX8 was amplified using primer pair cLUC-Apx8-F / R. These cDNA sequences were then ligated into the JW771 and JW772 vectors respectively using homologous recombination with the ClonExpress II One Step Cloning Kit (Vazyme). The ligation products were heat-shocked and transformed into E. coli DH5α competent cells. Positive single clones were selected, and colony PCR was performed using primer pairs 71nLUC-F / R and 72cLUC-F / R. Positive clones were then sent to Shanghai Sangon Biotech for sequencing identification. The plasmids of the correctly sequenced positive clones without base mutations were named PCTP-nLUC and cLUC-Apx8, respectively.
[0073] The constructed expression vectors PCTP-nLUC and cLUC-Apx8, along with the empty vectors JW771(nLUC) and JW772(cLUC), were transformed into Agrobacterium tumefaciens GV3101 using electroporation. After screening for positive clones, the cells were cultured and propagated. Different experimental and control groups were then transformed into 4-6 week old Tobacco Benzoin seedlings using the Agrobacterium injection method. After culturing for 36-48 hours, the interaction between samples was qualitatively analyzed using a live imaging system under the action of the fluorescein substrate D-luciferin. The results showed that the experimental group PCTP-nLUC / cLUC-PCTP and the positive control group AtFLS2-nLUC / AtAGB1-cLUC both emitted strong fluorescent signals, while the three negative control groups cLUC / PCTP-nLUC, cLUC-Apx8 / nLUC, and cLUC / nLUC did not emit light. The above results indicate that OsPCTP and OsAPX8 can interact within tobacco cells. Figure 4 The amplification and sequencing primers are as follows:
[0074] cLUC-Apx8F:
[0075] TACGCGTCCCGGGGCGGTACCATGGCGGAGCGCATCGCC
[0076] cLUC-Apx8R:
[0077] ACGAAAGCTCTGCAGGTCGACTCAGCTCCCGAGCAGAGACG
[0078] PCTP-nLUC-F:
[0079] ACGGGGGACGAGCTCGGTACCATGGCGGGGGAGACGGATT
[0080] PCTP-nLUC-R:
[0081] CGCGTACGAGATCTGGTCGACTTCCAAGTGCCTGGGTTCAGT
[0082] 71cLUC-F:GATATCTCCACTGACGTAAG
[0083] 71cLUC-R:GTACGAGATCTGGTCGACTA
[0084] 72cLUC-F:TCAGAGAGATCCTCATAAAG
[0085] 72cLUC-R:GGTCGACTACTCGAGCTTC.
[0086] The above are merely preferred embodiments of this application and do not limit the patent scope of this application. Any equivalent structural or procedural transformations made using the content of this application's specification and drawings, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of this application.
Claims
1. The application of a phosphatidylcholine transporter OsPCTP in regulating resistance to bacterial blight in rice, characterized in that, Overexpression of the phosphatidylcholine transporter OsPCTP in rice enhances rice resistance to bacterial blight; the amino acid sequence of the phosphatidylcholine transporter OsPCTP is shown in SEQ ID NO.
1.
2. The application of the phosphatidylcholine transporter OsPCTP according to claim 1 in regulating resistance to bacterial blight in rice, characterized in that, The CDS sequence of the phosphatidylcholine transporter OsPCTP was linked to the overexpression vector pCAMBIA 1301S to construct the OsPCTP overexpression vector; the constructed OsPCTP overexpression vector was then subjected to rice genetic transformation to obtain T0 generation overexpression transgenic plants.
3. The application of the phosphatidylcholine transporter OsPCTP according to claim 2 in regulating resistance to bacterial blight in rice, characterized in that, The CDS sequence of the phosphatidylcholine transporter OsPCTP is shown in SEQ ID NO.3, and the rice variety is Zhonghua 11.
4. The application of the phosphatidylcholine transporter OsPCTP according to claim 2 in regulating resistance to bacterial blight in rice, characterized in that, After linking the CDS sequence of the phosphatidylcholine transporter OsPCTP to the overexpression vector pCAMBIA1301S to construct the OsPCTP overexpression vector, and performing genetic transformation of the constructed OsPCTP overexpression vector on rice to obtain transgenic plants, the process further includes: The T0 generation overexpression transgenic plants were positively detected by polymerase chain reaction. The expression of OsPCTP in the positive transgenic plants was detected by real-time quantitative PCR. Transgenic plants with significantly increased OsPCTP expression were selected, and single-plant self-pollinated seeds were harvested.
5. The application of the phosphatidylcholine transporter OsPCTP according to claim 4 in regulating resistance to bacterial blight in rice, characterized in that, The procedure includes: positive detection of the T0 generation overexpression transgenic plants using polymerase chain reaction, detection of OsPCTP expression in positive transgenic plants using real-time quantitative PCR, selection of transgenic plants with significantly elevated OsPCTP expression, and harvesting self-pollinated seeds from individual plants; and further includes: The self-pollinated seeds of the individual plants were planted into T1 generation families. The positive results of the T1 generation individual plants were detected by PCR. The field traits of the positive transgenic individual plants and the control ZH11 material after inoculation with bacterial blight were investigated. Transgenic individual plants with normal seed setting rate were selected and self-pollinated for seed saving. The field traits included resistance performance after inoculation with bacterial blight and field agronomic traits.
Citation Information
Patent Citations
Gene and protein for enhancing rice blast resistance and bacterial leaf blight resistance of rice and method for improving resistance to rice blast and bacterial leaf blight
CN112175965A
Application of OsTB1 gene and protein in regulation and control of resistance of rice to sheath blight and bacterial blight
CN117604020A