An RNA allosteric ribozyme-CRISPR / Cas sensor for small molecule detection and its application
By modifying RNA allosteric ribozymes and combining them with the CRISPR/Cas detection system, simplified high-throughput small molecule substance detection is achieved, solving the problems of cumbersome detection steps and equipment consumption in existing technologies, and achieving fast and convenient detection effects.
Patent Information
- Application Number
- CN202411109431.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-13
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-08-13
AI Technical Summary
Existing nucleic acid detection technology has complicated steps and consumes a lot of manpower and material resources, especially in the detection of small molecule substances, which requires large instruments and multiple detection equipment.
A RNA allosteric ribozyme-CRISPR/Cas sensor was designed. By modifying the 5′ end of the RNA allosteric ribozyme to the crRNA sequence of the CRISPR/Cas protein and combining it with the CRISPR/Cas detection system, direct detection of target small molecules can be achieved, simplifying the detection process.
It realizes high-throughput detection in a short time without the need for large-scale instruments and equipment. It is suitable for grassroots testing and can perform qualitative and quantitative testing.
Smart Images

Figure CN118979097B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biochemistry and molecular biology, and specifically relates to an RNA allosteric ribozyme-CRISPR / Cas sensor for detecting small molecules and its application. Background Art
[0002] Functional nucleic acids (FNAs) are nucleic acids with specific functions and structures and are often used in the development of nucleic acid biosensors. RNA allosteric ribozymes are a type of functional nucleic acid, composed of a combination of an aptamer and a ribozyme. RNA allosteric ribozymes are essentially oligonucleotides that possess the specificity and affinity for binding to their target substances like aptamers, while also possessing the catalytic activity of ribozymes or deoxyribozymes. Allosteric ribozymes can be artificially designed and engineered for use in the development of nucleic acid biosensors to detect small molecule target effectors, such as ATP (adenine nucleoside triphosphate), TPP (thiamine pyrophosphate), and FMN (flavin mononucleotide).
[0003] When allosteric ribozymes sense small molecule target effectors, they typically undergo self-cleavage, producing small nucleic acid fragments that can be detected using molecular biology methods. In recent years, the CRISPR / Cas system has become widely used in nucleic acid detection, boasting high sensitivity and specificity. The CRISPR / Cas12 system, in particular, has seen widespread application in nucleic acid detection. However, the detection process often requires prior enrichment of the target nucleic acid in conjunction with nucleic acid amplification to enhance sensitivity. This necessitates the use of multiple detection instruments, consuming significant labor and material resources. Summary of the Invention
[0004] The purpose of the present invention is to provide an RNA allosteric ribozyme-CRISPR / Cas sensor for small molecule substance detection and its application, thereby solving the problems of existing nucleic acid detection technology with cumbersome steps and high labor and material resource consumption.
[0005] According to a first aspect of the present invention, an RNA allosteric ribozyme-CRISPR / Cas sensor for detecting small molecules is provided, comprising: a modified RNA allosteric ribozyme and a CRISPR / Cas detection system; the modified RNA allosteric ribozyme is obtained by modifying the 5′ end of an RNA allosteric ribozyme that can sense a target small molecule into a crRNA sequence of a CRISPR / Cas protein; the CRISPR / Cas detection system comprises a CRISPR / Cas protein, a recognition template, and a reporter molecule; wherein, by sensing the modified RNA allosteric ribozyme with a target small molecule and then adding the resulting sensing product to the CRISPR / Cas detection system, detection of the target small molecule can be achieved.
[0006] The RNA allosteric ribozyme capable of sensing a target small molecule substance is composed of an aptamer and a ribozyme. The structure of the RNA allosteric ribozyme is different according to the different target small molecule substances.
[0007] The catalytic active center of the RNA allosteric ribozyme is a hammerhead ribozyme.
[0008] The CRISPR / Cas protein is a Cas12 series protein, including: LbCas12a protein, AapCas12b protein. Although the embodiment of the present invention mainly uses LbCas12a as the research object for experiment, it should be understood that in principle, all Cas12 series proteins are applicable to the present invention, such as AapCas12b, and its reaction temperature is 60-65 ° C.
[0009] It should also be understood that, according to the different types of CRISPR / Cas proteins, the crRNA sequences on the modified RNA allosteric ribozymes are also different. For different CRISPR / Cas detection systems, different modifications can be made at the 5′ end of the RNA allosteric ribozyme. The crRNA sequences of different Cas proteins are also different. The embodiments of the present invention mainly use LbCas12a proteins, so the crRNA and LbCas12a proteins are paired for use. If other Cas12 proteins are used instead, their crRNA sequences need to be changed accordingly.
[0010] Preferably, the recognition template is a double-stranded DNA template recognized by the CRISPR / Cas protein and crRNA complex.
[0011] Preferably, both ends of the reporter molecule are modified with a fluorescent group and a quencher group. Preferably, both ends of the reporter molecule are modified with a FAM fluorescent group and a BHQ1 quencher group, or a Cy5 fluorescent group and a BHQ2 quencher group.
[0012] It should be understood that the sequence 5′-TTATT-3′ of the reporter molecule selected in the embodiments of the present invention is a preferred embodiment of the LbCas12a protein. If other Cas12 proteins are used, this sequence also needs to be adjusted accordingly.
[0013] According to a preferred embodiment of the present invention, an RNA allosteric ribozyme-CRISPR / Cas sensor is provided, wherein the selected CRISPR / Cas protein is LbCas12a protein; the crRNA sequence of the LbCas12a protein is: 5′-UAAUUUCUACUAAGUGUAGAUAGUAGUAUGCAAGCCACGUA-3′; the sequence of the selected recognition template is: 5′-TTTGAGTAGTATGCAAGCCACGTA-3′; the sequence of the selected reporter molecule is: 5′-TTATT-3′.
[0014] According to a second aspect of the present invention, there is also provided a use of the RNA allosteric ribozyme-CRISPR / Cas sensor as described above in the detection of small molecules.
[0015] The applications include applications in the detection of ATP (adenine nucleoside triphosphate), TPP (thiamine pyrophosphate), c-di-GMP (cyclic diguanylate) and FMN (flavin mononucleotide).
[0016] RNA allosteric ribozymes are essentially oligonucleotides. After self-cleavage, the small nucleic acid fragments produced are RNA. Based on this characteristic of RNA allosteric ribozymes, the present invention designs the small RNA fragments produced by RNA allosteric ribozymes into crRNA sequences that sense CRISPR / Cas12a. The CRISPR / Cas detection method is combined with RNA allosteric ribozymes to establish an RNA allosteric ribozyme-CRISPR / Cas12a sensor, which is applied to high-throughput detection of actual samples.
[0017] The RNA allosteric ribozyme-CRISPR / Cas sensor for small molecule detection and its application provided by the present invention have the following advantages over the prior art:
[0018] 1) The modification of RNA allosteric ribozymes according to the method provided by the present invention does not affect the activity of the RNA allosteric ribozymes;
[0019] 2) The method provided by the present invention does not require large-scale instruments and equipment, and can detect small molecules in a short time, making it suitable for both grassroots and high-throughput detection;
[0020] 3) The method provided by the present invention can not only perform qualitative detection but also quantitative detection. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0022] Figure 1 Schematic diagram of the detection principle of the present invention;
[0023] Figure 2 The performance test results of the c-di-GMP allosteric ribozyme of Example 1 of the present invention are as follows;
[0024] Figure 3 This is the performance test result of the TPP allosteric ribozyme of Example 2 of the present invention;
[0025] Figure 4 The performance test results of the TPP allosteric ribozyme in blood filtrate of Example 3 of the present invention are as follows;
[0026] Figure 5 This is the result of detecting the TPP content in a blood sample using the TPP allosteric ribozyme-CRISPR Cas12a of Example 3 of the present invention. DETAILED DESCRIPTION
[0027] Example 1 Detection of c-di-GMP (cyclic diguanylate)
[0028] (1) Design of RNA allosteric ribozyme structure that senses c-di-GMP
[0029] c-di-GMP-sensing RNA allosteric ribozymes such as Figure 2 As shown in a, it should be understood that the RNA allosteric ribozyme is a prior art, which is obtained by transcription after extension with the following two primers. Primer 1: TAATACGACTCACTATAGGCACCTGATGAGGGGTGG GCACAGGGCAAACCATTCGAAAGAGTGGGACGCAAAGCCTCCGGC CTA AACCAGAAGACATGGTAG, Primer 2: CTTAGGCACTACGTGGCTTCACC ACGTTTCGTGTAGGGGTAACCCCGCTAC CTACCATGTCTTCTGGTTTAG , the template extension system and transcription system are shown in Table 1 and Table 2, respectively.
[0030] according to Figure 1 As shown in the schematic diagram of the detection principle, first the allosteric ribozyme that senses c-di-GMP needs to be transformed into Figure 2 The prepared c-di-GMP allosteric ribozyme was prepared by c-di-GMP-primer1 (TAATACGACTCACTATAGGTAATTTCTACTAAGTGTAG ATAGTAGTATGCAAGCCACGTAGTGCCTAAGGCACCTGATGAGGGG T GG GCACAGGGCAAACCATTC ) and c-di-GMP-primer2(ACCACGTTTCGTGTA GGGGTAACCCGCTACCTACCATGTCTTCTGGTTTAGGCCGGAGGCTTTG CGTCCCACTCTTTC GAATGGTTTGCCCTGTGC ) was obtained by extension, wherein the wavy part is the T7 promoter sequence, and the straight part is the complementary pairing region of the two primers. The extension conditions are shown in Table 1 (50 μL system):
[0031] Table 1 Template extension system
[0032]
[0033] Extension conditions: pre-denaturation at 95°C for 1 min, 5 cycles of 95°C (10 s) → 58°C (30 s) → 72°C (30 s), and after the cycle, 72°C for 1 min.
[0034] Transcription was performed using the double-stranded DNA product after PCR extension as a template. The transcription system is shown in Table 2. The reaction system was carried out at 37°C and incubated in a metal bath for 2-3 hours. The transcribed RNA was purified using 8% dP AGE. The corresponding bands were illuminated on a fluorescent plate using a handheld UV analyzer and recovered. Crush-Soak buffer was added, and the reaction was shaken at 4°C overnight. Three volumes of anhydrous ethanol were added, and the reaction was frozen at -20°C for 20 minutes. The reaction was centrifuged at 13,000 g at 4°C for 30 minutes, and the RNA was recovered by sedimentation. The concentration was measured using a Nanodrop 2000 and stored at -20°C.
[0035] Table 2 Transcription system
[0036]
[0037] (2) Cleavage reaction of RNA allosteric ribozyme that senses c-di-GMP
[0038] The cleavage reaction of the RNA allosteric ribozyme that senses c-di-GMP was carried out in the following system: 50mM Tris-HCl (pH 7.5), 100mM NaCl, 10mM MgCl2, and 45nM RNA allosteric ribozyme. After adding 0nM, 30nM, 100nM, 300nM, 1000nM, and 3000nM respectively, the reaction was carried out at 23°C for 3 minutes. 8% dPAGE electrophoresis was performed, and Cyber gold nucleic acid dye was used for staining for 10 minutes. The gel was imaged using a gel imaging system. After gel imaging, the band intensity was quantitatively analyzed using Quantity One software to calculate the cleavage rate. The dPAGE electrophoresis diagram is shown as follows: Figure 2 As shown in c.
[0039] According to the cleavage rate calculated in the gel image, a logarithmic curve of the cleavage rate of the c-di-GMP allosteric ribozyme and the c-di-GMP concentration was drawn. Figure 2 The EC50 value of the modified c-di-GMP allosteric ribozyme was 318.5 nM, which was comparable to that before modification, indicating that the structural modification of the RNA allosteric ribozyme by the strategy adopted by the present invention did not affect the activity of the enzyme.
[0040] (3) CRISPR / Cas12a detection
[0041] CRISPR / Cas12a detection was performed in the following 20 μL system: 200 nM LbCas12a protein, 5 nM double-stranded detection template, 250 nM reporter molecule (5′-FAM-TTATT-BHQ1-3′), 2 μL RNA allosteric ribozyme cleavage product, 1× NEBuffer 2.1, 37°C, reaction time 30 min, and real-time fluorescence acquisition using a microplate reader (Boten, USA). The results are shown in Figure 2. Figure 2 As shown in Figure e, as the c-di-GMP sensing concentration increases, the fluorescence signal value increases accordingly, showing a positive correlation. From the real-time fluorescence curve, it can be concluded that CRISPR / Cas12a can detect a minimum of 30nM c-di-GMP. Based on the fluorescence value at 30 minutes of reaction, a logarithmic curve of fluorescence value and c-di-GMP concentration is drawn, and the result shows a linear relationship, as shown in Figure 5. Figure 2 As shown in Figure f, the CRISPR / Cas12a detection results of the cleavage system of a c-di-GMP standard with a known concentration can be used to draw a standard curve. The detection results of the cleavage system with an unknown c-di-GMP concentration can then be brought into the standard curve to calculate the c-di-GMP concentration of the unknown system.
[0042] Example 2 Detection of TPP (thiamine pyrophosphate)
[0043] (1) Design of RNA allosteric ribozyme structure that senses TPP
[0044] TPP-sensing RNA allosteric ribozymes such as Figure 3 As shown in a. It should be understood that the RNA allosteric ribozyme is a prior art, which is obtained by transcription after extension with the following two primers. Among them, the sequence of primer 3 is:
[0045] TAATACGACTCACTATAGGGTATGCAAGCCACGTAGTGCCTATACCTGAT
[0046] AGGTAGGCACCTGATGAGGCTCCCGGGGTGCCCT TGTGCGTCAAGGCTG AGAAATA , the sequence of primer 4 is:
[0047] AGCCACGTTTCGGAGCCTCCCTACGCTGGCATTATCCAGATCAGGTGATACGGG TATTTCTCAGCCTTGACGCACA , the template extension system and transcription system are shown in Table 3 and Table 4 respectively.
[0048] according to Figure 1 The detection principle diagram shown in the figure first requires the transformation of the allosteric ribozyme that senses TPP into Figure 3 The c-di-GMP allosteric ribozyme constructed was prepared by TPP-prime r1 (TAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGATAGTAGTAT GCAAGCCACGTAGTGCCTATACCTGATAG GTAGGCACCTGATGAGGCTC CCGGGGTG ) and TPP-primer2(AGCCACGTTTCGGAGCCTCCCTACGCTG GCATTATCCAGATCAGGTGATACGGGTATTTCTCAGCCTTGACGCACAAG GG CACCCCGGGAGCCTCATCAGGTGCCTAC ) was obtained by extension, and the extension conditions are shown in Table 3 (50 μL system):
[0049] Table 3 Template extension system
[0050]
[0051] Extension conditions: pre-denaturation at 95°C for 1 min, 5 cycles of 95°C (10 s) → 58°C (30 s) → 72°C (30 s), and after the cycle, 72°C for 1 min.
[0052] Transcription was performed using the double-stranded DNA product after PCR extension as a template. The transcription system is shown in Table 4. The reaction system was carried out at 37°C and incubated in a metal bath for 2-3 h. The transcribed RNA was purified using 8% dP AGE. The corresponding bands were illuminated on a fluorescent plate using a handheld UV analyzer and recovered. Crush-Soak buffer was added, and the reaction was shaken at 4°C overnight. Three volumes of anhydrous ethanol were added, and the reaction was frozen at -20°C for 20 min. The reaction was centrifuged at 13,000 g at 4°C for 30 min, and the RNA was recovered by sedimentation. The concentration was measured using a Nanodrop 2000 and stored at -20°C.
[0053] Table 4 Transcription system
[0054]
[0055] (2) TPP-sensing RNA allosteric ribozyme cleavage reaction
[0056] The cleavage reaction of the TPP-sensing RNA allosteric ribozyme was carried out in the following system: 50mM Tris-HCl (pH7.5), 100mM NaCl, 10mM MgCl2, and 45nM RNA allosteric ribozyme. After adding 0nM, 10nM, 25nM, 50nM, 100nM, 250nM, 500nM, and 1000nM TPP, the reaction was carried out at 23°C for 60 minutes. 8% dPAGE electrophoresis was performed, and the samples were stained with Cyber gold nucleic acid dye for 10 minutes and imaged using a gel imaging system. After gel imaging, the band intensity was quantitatively analyzed using Quantity One software to calculate the cleavage rate. The dPAGE electrophoresis pattern is shown in the figure below. Figure 3 As shown in c.
[0057] The cleavage rate of TPP allosteric ribozyme and the logarithmic curve of TPP concentration were drawn according to the cleavage rate calculated in the gel image. Figure 3 The EC50 value after modification is 68.5 nM, which is equivalent to that before modification, indicating that the structural modification of RNA allosteric ribozyme by the strategy adopted by the present invention does not affect the activity of the enzyme.
[0058] (3) CRISPR / Cas12a detection
[0059] CRISPR / Cas12a detection was performed in the following 20 μL system: 200 nM LbCas12a protein, 5 nM double-stranded detection template, 250 nM reporter molecule (5′-FAM-TTATT-BHQ1-3′), 2 μL RNA allosteric ribozyme cleavage product, 1× NEBuffer 2.1, 37°C, reaction time 30 min, and real-time fluorescence acquisition using a microplate reader (Boten, USA). The results are shown in Figure 2. Figure 3As shown in Figure e, as the TPP sensing concentration increases, the fluorescence signal value increases accordingly, showing a positive correlation. From the real-time fluorescence curve, it can be concluded that CRISPR / Cas12a can detect TPP at a minimum of 25nM. Based on the fluorescence value at 30 minutes of reaction, a fluorescence value and TPP concentration logarithmic curve was drawn, and the result showed a linear relationship, as shown in Figure 5. Figure 3 As shown in Figure f, the CRISPR / Cas12a detection results of the cleavage system of the TPP standard with known concentration can be used to draw a standard curve. Then, the detection results of the cleavage system with unknown TPP concentration can be put into the standard curve to calculate the TPP concentration of the unknown system.
[0060] Example 3 Detection of TPP content in blood samples
[0061] (1) Blood sample collection
[0062] Mouse type: C57
[0063] Sampling tube type: In whole blood, thiamine pyrophosphate is mainly present in red blood cells, so when measuring TPP in blood, it is necessary to first lyse the red blood cell membrane to release thiamine pyrophosphate and make it free in the solution. Due to the presence of thrombin, blood will coagulate in vitro after collection, and the sample needs to be treated to prevent coagulation. EDTA anticoagulant blood collection tubes are commonly used for blood collection. Generally, EDTA is in excess when used. However, excess EDTA will chelate Mg in the system. 2+ , which affects the activity of the RNA aptamer enzyme that senses TPP, so heparin was used as the sampling tube anticoagulant.
[0064] Blood collection method: Use cardiac blood collection. First, use carbon dioxide to euthanize the mouse. Then use a 1mL syringe to collect 0.4-0.6mL of cardiac blood from each mouse. Place the blood into a vacuum blood collection tube coated with lithium heparin. Mix by inverting the tube upside down and place on ice until use.
[0065] (2) Blood sample processing:
[0066] The protein in the blood is denatured by chloroform treatment to release TPP, and then the blood filtrate is obtained by filtration. The specific operation steps are as follows:
[0067] ① Draw 150 μL of mouse whole blood from a vacuum blood collection tube coated with lithium heparin into a 1.5 mL centrifuge tube, add 300 μL of deionized water, and vortex for 10 seconds;
[0068] ② Add 750 μL of chloroform and vortex to mix evenly for 5 minutes;
[0069] ③ Centrifuge at 3100 rpm, 4°C for 10 min;
[0070] ④ Take the upper solution (about 400 μL), centrifuge at 16000g, 4℃ for 10 min to completely remove impurities;
[0071] ⑤ Take the supernatant (about 380 μL), add it to a 10 kDa ultrafiltration tube, and centrifuge at 8000g, 4°C, for 30 min;
[0072] ⑥ Recover the filtrate, which is the blood filtrate sample;
[0073] ⑦ If the next experiment is to be carried out immediately, the blood filtrate sample should be placed on ice for future use; if the next experiment is to be carried out after a long time, the blood filtrate sample should be stored in a -80℃ refrigerator for future use.
[0074] (3) Removal of TPP from blood filtrate samples
[0075] During the experiment, TPP-free blood filtrate was used as a matrix to study TPP-sensing RNA aptamers. Heat treatment was used to remove TPP from the blood filtrate sample. The specific steps were as follows: The treated blood filtrate sample was heated in a metal bath at 98°C for 2 hours, then cooled naturally to obtain the TPP-free blood filtrate sample. After treatment, the sample was stored at -20°C until use.
[0076] (4) Establishing a standard curve
[0077] A standard curve was established using a TPP-removed blood filtrate sample as the matrix, and the reaction was carried out in a 40 μL system: 30 μL of TPP-removed blood filtrate, 10 mM MgCl2, 1 mM EDTA, 45 nM TPP allosteric ribozyme, and 0 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, and 500 nM TPP were added, respectively. The reaction was carried out at 23°C for 60 min. The reaction product was divided into two parts, one part was 15 μL of the cleavage reaction product, and 15 μL of 2×dPAGE loading buffer was added to terminate the reaction. The reaction was then subjected to 8% dPAGE electrophoresis, stained with Cybergold nucleic acid dye for 10 min, and imaged with a gel imaging system; the other part was 25 μL of the cleavage reaction product, which was placed on ice for subsequent detection experiments. The dPAGE gel image is shown below. Figure 4 As shown in Figure a, the results show that in the blood filtrate sample matrix without TPP, the TPP-sensing allosteric ribozyme exhibited good cleavage activity, RNA was not degraded in this system, the background signal was normal, and the cleavage efficiency increased accordingly with the increase of the induced TPP concentration, indicating that it can react well in the blood filtrate matrix.
[0078] (5) TPP allosteric ribozyme cleavage reaction in the sample
[0079] The reaction was carried out in a 40 μL system: 30 μL blood filtrate, 10 mM MgCl2, 1 mM EDTA, 45 nM TPP allosteric ribozyme. The reaction was carried out at 23°C for 60 min. The reaction product was divided into two parts. One part was 15 μL of cleavage reaction product. The reaction was terminated by adding 15 μL of 2× dPAGE loading buffer. Then, 8% dPAGE electrophoresis was performed, stained with Cyber Gold nucleic acid dye for 10 minutes, and imaged by gel imaging system. The other part was 25 μL of cleavage reaction product. It was placed on ice for subsequent detection experiments. Its dPAGE gel image is shown below. Figure 5 As shown in a.
[0080] (6) CRISPR / Cas12a detection
[0081] CRISPR / Cas12a detection was performed in the following 20 μL system: 200 nM LbCas12a protein, 5 nM double-stranded detection template, 250 nM reporter molecule (5′-FAM-TTATT-BHQ1-3′), 2 μL RNA allosteric ribozyme cleavage product, 1× NEBuffer 2.1, 37°C, reaction time 30 min, and real-time fluorescence acquisition using a microplate reader (Boten, USA). The results are shown in Figure 2. Figure 4 As shown in Figure b, in the blood filtrate matrix, as the TPP sensing concentration increases, the fluorescence signal value increases accordingly, showing a positive correlation. From the real-time fluorescence curve, it can be concluded that CRISPR / Cas12a can detect TPP at a minimum of 25nM. Based on the fluorescence value at 30 minutes of reaction, a fluorescence value and TPP concentration logarithmic curve was plotted, and the result showed a linear relationship, as shown in Figure 2. Figure 4 As shown in c, the CRISPR / Cas12a detection results of the cleavage system of the TPP standard with known concentration can be used to draw a standard curve. Then, the detection results of the cleavage system with unknown TPP concentration can be put into the standard curve to calculate the TPP concentration of the unknown system.
[0082] Using the above method, the TPP test results in the sample are as follows: Figure 5 As shown in b, the results show that this method can accurately measure the TPP content in the blood filtrate sample, and the measurement value is basically consistent with the HPLC detection method.
[0083] It should be understood that Example 2 is a theoretical study, and Example 3 is a test in actual samples. The above examples prove that the method of the present invention is also applicable to the detection of actual samples.
[0084] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. Various modifications are possible. Any simple, equivalent changes and modifications made in accordance with the claims and description of the present invention are within the scope of protection of the patent claims. Anything not fully described in this invention is conventional technology.
Claims
1. An RNA allosteric ribozyme-CRISPR / Cas sensor for small molecule detection, characterized in that: include: A modified RNA allosteric ribozyme and CRISPR / Cas detection system; the modified RNA allosteric ribozyme is obtained by modifying the 5′ end of an RNA allosteric ribozyme that can sense a target small molecule into a crRNA sequence of a CRISPR / Cas protein; the CRISPR / Cas detection system includes a CRISPR / Cas protein, a recognition template, and a reporter molecule; The RNA allosteric ribozyme capable of sensing a target small molecule is composed of an aptamer and a ribozyme. The structure of the RNA allosteric ribozyme varies depending on the target small molecule. The CRISPR / Cas protein is the LbCas12a protein. The recognition template is a double-stranded DNA template recognized by the CRISPR / Cas protein and crRNA complex. Both ends of the reporter molecule are modified with a fluorescent group and a quenching group. The target small molecule substance is c-di-GMP or TPP; The allosteric ribozyme that can sense c-di-GMP was prepared by PCR extension and T7 RNA polymerase transcription using c-di-GMP-primer1:TAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGATAGTAGTATGCAAGCCACGTAGTGCCTAAGGCACCTGATGAGGGGTGGGCACAGGGCAAACCATTC and c-di-GMP-primer2:ACCACGTTTCGTGTAGGGGTAACCCCGCTACCTACCATGTCTTCTGGTTTAGGCCGGAGGCTTTGCGTCCCACTCTTTCGAATGGTTTGCCCTGTGC; The allosteric ribozyme that can sense TPP was prepared by PCR extension and T7 RNA polymerase transcription using TPP-primer1: TAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGATAGTAGTATGCAAGCCACGTAGTGCCTATACCTGATAGGTAGGCACCTGATGAGGCTCCCGGGGTG and TPP-primer2: AGCCACGTTTCGGAGCCTCCCTACGCTGGCATTATCCAGATCAGGTGATACGGGTATTTCTCAGCCTTGACGCACAAGGGCACCCCGGGAGCCTCATCAGGTGCCTAC; The crRNA sequence of the LbCas12a protein is: 5′-UAAUUUCUAAGUGUAGAUAGUAGUAUGCAAGCCACGUA-3′; The sequence of the recognition template is: 5′-TTTGAGTAGTATGCAAGCCACGTA-3′; The sequence of the reporter molecule is: 5′-TTATT-3′; Among them, by sensing the modified RNA allosteric ribozyme with the target small molecule substance, and then adding the obtained sensing product to the CRISPR / Cas detection system, high-throughput detection of the target small molecule substance can be achieved.
2. The RNA allosteric ribozyme-CRISPR / Cas sensor according to claim 1, characterized in that The catalytic active center of the RNA allosteric ribozyme is a hammerhead ribozyme.
3. Use of the RNA allosteric ribozyme-CRISPR / Cas sensor according to any one of claims 1 to 2 in the preparation of a small molecule detection reagent, wherein the small molecule is TPP or c-di-GMP.
Citation Information
Patent Citations
Cas12a-CcrRNA system based on regulation and control of nuclease and circular guide RNA and application of Cas12a-CcrRNA system
CN114231530A